ID: 1084938708

View in Genome Browser
Species Human (GRCh38)
Location 11:72601064-72601086
Sequence CTTGGCTGCTTACTGATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084938708_1084938718 22 Left 1084938708 11:72601064-72601086 CCAGGCATCAGTAAGCAGCCAAG 0: 1
1: 0
2: 0
3: 11
4: 212
Right 1084938718 11:72601109-72601131 CACGGAACCCCATCCCCCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 114
1084938708_1084938711 4 Left 1084938708 11:72601064-72601086 CCAGGCATCAGTAAGCAGCCAAG 0: 1
1: 0
2: 0
3: 11
4: 212
Right 1084938711 11:72601091-72601113 TTGCTGAGCCCATCCTCCCACGG 0: 1
1: 0
2: 3
3: 24
4: 182
1084938708_1084938717 21 Left 1084938708 11:72601064-72601086 CCAGGCATCAGTAAGCAGCCAAG 0: 1
1: 0
2: 0
3: 11
4: 212
Right 1084938717 11:72601108-72601130 CCACGGAACCCCATCCCCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084938708 Original CRISPR CTTGGCTGCTTACTGATGCC TGG (reversed) Intronic