ID: 1084938711

View in Genome Browser
Species Human (GRCh38)
Location 11:72601091-72601113
Sequence TTGCTGAGCCCATCCTCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 182}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084938704_1084938711 21 Left 1084938704 11:72601047-72601069 CCAACACCCACTAGGTCCCAGGC 0: 1
1: 0
2: 2
3: 31
4: 290
Right 1084938711 11:72601091-72601113 TTGCTGAGCCCATCCTCCCACGG 0: 1
1: 0
2: 3
3: 24
4: 182
1084938705_1084938711 15 Left 1084938705 11:72601053-72601075 CCCACTAGGTCCCAGGCATCAGT 0: 1
1: 0
2: 2
3: 16
4: 245
Right 1084938711 11:72601091-72601113 TTGCTGAGCCCATCCTCCCACGG 0: 1
1: 0
2: 3
3: 24
4: 182
1084938700_1084938711 26 Left 1084938700 11:72601042-72601064 CCCCTCCAACACCCACTAGGTCC 0: 1
1: 0
2: 0
3: 20
4: 181
Right 1084938711 11:72601091-72601113 TTGCTGAGCCCATCCTCCCACGG 0: 1
1: 0
2: 3
3: 24
4: 182
1084938706_1084938711 14 Left 1084938706 11:72601054-72601076 CCACTAGGTCCCAGGCATCAGTA 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1084938711 11:72601091-72601113 TTGCTGAGCCCATCCTCCCACGG 0: 1
1: 0
2: 3
3: 24
4: 182
1084938702_1084938711 24 Left 1084938702 11:72601044-72601066 CCTCCAACACCCACTAGGTCCCA 0: 1
1: 0
2: 0
3: 32
4: 415
Right 1084938711 11:72601091-72601113 TTGCTGAGCCCATCCTCCCACGG 0: 1
1: 0
2: 3
3: 24
4: 182
1084938701_1084938711 25 Left 1084938701 11:72601043-72601065 CCCTCCAACACCCACTAGGTCCC 0: 1
1: 0
2: 1
3: 23
4: 405
Right 1084938711 11:72601091-72601113 TTGCTGAGCCCATCCTCCCACGG 0: 1
1: 0
2: 3
3: 24
4: 182
1084938699_1084938711 27 Left 1084938699 11:72601041-72601063 CCCCCTCCAACACCCACTAGGTC 0: 1
1: 0
2: 1
3: 12
4: 228
Right 1084938711 11:72601091-72601113 TTGCTGAGCCCATCCTCCCACGG 0: 1
1: 0
2: 3
3: 24
4: 182
1084938698_1084938711 28 Left 1084938698 11:72601040-72601062 CCCCCCTCCAACACCCACTAGGT 0: 1
1: 0
2: 1
3: 15
4: 300
Right 1084938711 11:72601091-72601113 TTGCTGAGCCCATCCTCCCACGG 0: 1
1: 0
2: 3
3: 24
4: 182
1084938708_1084938711 4 Left 1084938708 11:72601064-72601086 CCAGGCATCAGTAAGCAGCCAAG 0: 1
1: 0
2: 0
3: 11
4: 212
Right 1084938711 11:72601091-72601113 TTGCTGAGCCCATCCTCCCACGG 0: 1
1: 0
2: 3
3: 24
4: 182
1084938707_1084938711 5 Left 1084938707 11:72601063-72601085 CCCAGGCATCAGTAAGCAGCCAA 0: 1
1: 0
2: 0
3: 13
4: 155
Right 1084938711 11:72601091-72601113 TTGCTGAGCCCATCCTCCCACGG 0: 1
1: 0
2: 3
3: 24
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084938711 Original CRISPR TTGCTGAGCCCATCCTCCCA CGG Intronic