ID: 1084938717

View in Genome Browser
Species Human (GRCh38)
Location 11:72601108-72601130
Sequence CCACGGAACCCCATCCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 199}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084938708_1084938717 21 Left 1084938708 11:72601064-72601086 CCAGGCATCAGTAAGCAGCCAAG 0: 1
1: 0
2: 0
3: 11
4: 212
Right 1084938717 11:72601108-72601130 CCACGGAACCCCATCCCCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 199
1084938707_1084938717 22 Left 1084938707 11:72601063-72601085 CCCAGGCATCAGTAAGCAGCCAA 0: 1
1: 0
2: 0
3: 13
4: 155
Right 1084938717 11:72601108-72601130 CCACGGAACCCCATCCCCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 199
1084938710_1084938717 -2 Left 1084938710 11:72601087-72601109 CCTGTTGCTGAGCCCATCCTCCC 0: 1
1: 0
2: 0
3: 28
4: 265
Right 1084938717 11:72601108-72601130 CCACGGAACCCCATCCCCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 199
1084938709_1084938717 3 Left 1084938709 11:72601082-72601104 CCAAGCCTGTTGCTGAGCCCATC 0: 1
1: 0
2: 2
3: 13
4: 196
Right 1084938717 11:72601108-72601130 CCACGGAACCCCATCCCCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084938717 Original CRISPR CCACGGAACCCCATCCCCCC AGG Intronic