ID: 1084941466

View in Genome Browser
Species Human (GRCh38)
Location 11:72615488-72615510
Sequence CAGAGTGGGTAGAGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1231
Summary {0: 1, 1: 0, 2: 6, 3: 122, 4: 1102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084941456_1084941466 10 Left 1084941456 11:72615455-72615477 CCAGAGTCTGGAGTCAGGAAAGG 0: 1
1: 0
2: 0
3: 35
4: 355
Right 1084941466 11:72615488-72615510 CAGAGTGGGTAGAGGGAGGGAGG 0: 1
1: 0
2: 6
3: 122
4: 1102
1084941452_1084941466 17 Left 1084941452 11:72615448-72615470 CCCTCACCCAGAGTCTGGAGTCA 0: 1
1: 0
2: 0
3: 19
4: 196
Right 1084941466 11:72615488-72615510 CAGAGTGGGTAGAGGGAGGGAGG 0: 1
1: 0
2: 6
3: 122
4: 1102
1084941453_1084941466 16 Left 1084941453 11:72615449-72615471 CCTCACCCAGAGTCTGGAGTCAG 0: 1
1: 0
2: 1
3: 22
4: 242
Right 1084941466 11:72615488-72615510 CAGAGTGGGTAGAGGGAGGGAGG 0: 1
1: 0
2: 6
3: 122
4: 1102
1084941455_1084941466 11 Left 1084941455 11:72615454-72615476 CCCAGAGTCTGGAGTCAGGAAAG 0: 1
1: 0
2: 4
3: 20
4: 329
Right 1084941466 11:72615488-72615510 CAGAGTGGGTAGAGGGAGGGAGG 0: 1
1: 0
2: 6
3: 122
4: 1102
1084941450_1084941466 24 Left 1084941450 11:72615441-72615463 CCTCAGTCCCTCACCCAGAGTCT 0: 1
1: 0
2: 2
3: 31
4: 444
Right 1084941466 11:72615488-72615510 CAGAGTGGGTAGAGGGAGGGAGG 0: 1
1: 0
2: 6
3: 122
4: 1102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084941466 Original CRISPR CAGAGTGGGTAGAGGGAGGG AGG Intronic
900204721 1:1427076-1427098 CAGGGCGGGAAGAGGGAGGGGGG - Intronic
900274336 1:1814080-1814102 AAAAGTGGGAAGGGGGAGGGTGG - Intronic
900378929 1:2374067-2374089 CACCATGGGGAGAGGGAGGGTGG + Intronic
900548494 1:3241827-3241849 CAGCGTGGACAGAGGGAGGGCGG + Intronic
900649479 1:3723905-3723927 CAAAGGGGGTTGAGGGATGGTGG + Intronic
900653870 1:3745398-3745420 CTGAGTCGGGAGAGGGAGGCTGG - Intergenic
900681763 1:3920394-3920416 GAGGGAGGGAAGAGGGAGGGAGG - Intergenic
900871662 1:5308599-5308621 CAATGTGGGAAGAGGGAGAGAGG - Intergenic
900916559 1:5643740-5643762 CAGAGCTGGAAGAGGAAGGGCGG + Intergenic
901078428 1:6569996-6570018 CAGGGAGGAGAGAGGGAGGGAGG + Intronic
901144098 1:7053625-7053647 CAGAGTGGAGTGAGGGAGGAAGG - Intronic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
901343480 1:8516939-8516961 GATGGTGGGGAGAGGGAGGGAGG + Intronic
901435190 1:9243190-9243212 CAGAGGGGGTGGTGGGAGGAGGG + Intronic
901523776 1:9806219-9806241 CAGGGGGGGTGGAGGGGGGGAGG + Intronic
901645582 1:10715275-10715297 CAGAGTTGGTTGAGGAAGAGAGG - Intronic
901714240 1:11140304-11140326 CAGATTGGGTGGGGGGCGGGGGG + Intronic
902036622 1:13462749-13462771 CTGATTGGGAAGAGGGAAGGAGG + Intergenic
902041448 1:13495473-13495495 CATGGTGGGGAGGGGGAGGGAGG + Intronic
902074809 1:13775860-13775882 CAGGGTGGGTGAAGGGATGGGGG - Intronic
902364084 1:15959498-15959520 AAGAGGGAGGAGAGGGAGGGAGG + Intronic
902772277 1:18652167-18652189 CAGAGCCGGTAGAGGGTGGGAGG + Intronic
903003137 1:20280656-20280678 ATGAGTGGGTACAGGGCGGGTGG + Intergenic
903009843 1:20321845-20321867 CAGAGTGGGTAGAGAGGAGGTGG + Intronic
903034693 1:20486156-20486178 CAGAGGGGGGAGAGGGAGGCAGG + Exonic
903331552 1:22599592-22599614 GGGAGTGGAGAGAGGGAGGGAGG + Intronic
903364534 1:22797821-22797843 CAGAGTGCCTAGAGAGCGGGAGG - Intronic
903550755 1:24156208-24156230 CAGTGAGGGTAGAAGGAAGGAGG + Exonic
904054036 1:27658691-27658713 CAACGTGGGCAGAGGGAAGGAGG + Intergenic
904497600 1:30895854-30895876 GAGGGTGGGAGGAGGGAGGGAGG + Intronic
904886506 1:33742579-33742601 CAGAGGGGGTTGGGGGGGGGGGG - Intronic
904921866 1:34014214-34014236 CAGAGTGGGAACAGGGAGACTGG - Intronic
904988793 1:34574493-34574515 TGGAGTGGTTAGAGGGAGGGAGG - Intergenic
904995411 1:34627702-34627724 CAGAGTGGGGAAGGGGAGGTAGG + Intergenic
905037289 1:34926439-34926461 CAGACTGGGGAGGGGCAGGGTGG + Intronic
905447996 1:38039682-38039704 CGGGGTGGGTAGTGGGAGGTGGG + Intergenic
905506201 1:38481492-38481514 CAGAGTGGGATGAAGGAAGGTGG - Intergenic
905694655 1:39965739-39965761 CAGGGTGGGTAGAGGTAGTGGGG - Intronic
905774359 1:40659043-40659065 CAGATGTGGCAGAGGGAGGGTGG + Intronic
906139078 1:43522714-43522736 AAGAATGGGGAGAGGGAAGGGGG + Intergenic
906201318 1:43962225-43962247 CAGATTGGGTACAGGGAGTTGGG - Intronic
906240380 1:44239002-44239024 AGCAGTGGGGAGAGGGAGGGTGG - Intronic
906259669 1:44377539-44377561 CAGAGTACGGAGAGAGAGGGAGG + Intergenic
906303787 1:44703345-44703367 GTGAATGGGGAGAGGGAGGGAGG - Intronic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906677782 1:47705699-47705721 GGGAGAGGGTAGAGGGAGGTGGG + Intergenic
907272654 1:53299926-53299948 CAGAGTGGGCTGACAGAGGGAGG + Intronic
907614721 1:55912617-55912639 CAGAGTGGGTACTGGGAGCGGGG - Intergenic
908000145 1:59671522-59671544 CAGAGTAGGTGGAGGGAGGAAGG + Intronic
908089096 1:60667859-60667881 CAGAGTGGGGAGAGGCAGGGGGG + Intergenic
908611763 1:65868918-65868940 CAGACGGGGTGGTGGGAGGGAGG - Intronic
909469300 1:76008826-76008848 GAGGGTGGGAAGAGAGAGGGAGG - Intergenic
909706068 1:78586183-78586205 GCCGGTGGGTAGAGGGAGGGCGG - Intergenic
909738754 1:79001172-79001194 GAGAGGGGGGGGAGGGAGGGAGG + Intronic
910294164 1:85627983-85628005 AGGACTGGGTAGAGGGAGTGGGG - Intergenic
910460829 1:87446301-87446323 CAGAGTGGGTATAGGAAGAAGGG + Intergenic
911335643 1:96576904-96576926 CAGAGTGGGACGGGGGAAGGAGG + Intergenic
911538151 1:99125234-99125256 AAGGGTGGGAAGAGGGAGAGAGG - Intergenic
911550689 1:99275893-99275915 CACAGTAGGGAGAGGGAGAGGGG + Intronic
911618292 1:100038410-100038432 CAGGGTGGGGGAAGGGAGGGAGG - Intronic
911735718 1:101334625-101334647 CAGAAGGGGGAGAGGGAGGGAGG - Intergenic
911794996 1:102064414-102064436 AAGAGTGGGTGGCGGGAGGAGGG + Intergenic
912197738 1:107419160-107419182 GAGAGAGGCTAAAGGGAGGGAGG - Intronic
912230621 1:107788344-107788366 GAGAGTGGGCAGAGTGAGGGTGG - Intronic
912368093 1:109151316-109151338 GGGAGTGGGAGGAGGGAGGGAGG + Intronic
912386144 1:109272205-109272227 CAGGCTGGGAAGAAGGAGGGTGG - Intronic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912667214 1:111593072-111593094 CTGAGTGGGTGGAGGGGGCGGGG + Intronic
912960593 1:114192170-114192192 CAGTGTGGGTGGAGAGAGAGCGG + Intergenic
913114667 1:115685126-115685148 CAGAGAGTGGAGAGGGAGGAAGG - Intronic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
913365796 1:118037029-118037051 CAGGGTTGTTAGAGGTAGGGTGG + Intronic
913429554 1:118776012-118776034 TAGAGGGAGTAGAGAGAGGGGGG + Intergenic
914250393 1:145917612-145917634 CAGAGAGGGTACAGGAAGGAGGG + Intronic
914746693 1:150506395-150506417 CAGAGTGGTTGGGGGGAGGCGGG + Intronic
914835698 1:151205109-151205131 CAAACTGGGGAGAGGGAAGGTGG + Intronic
914848109 1:151293909-151293931 GAGACTCGGTTGAGGGAGGGGGG - Intronic
914899042 1:151702334-151702356 CACACTGGGAAGGGGGAGGGAGG - Intergenic
915058311 1:153157914-153157936 CAGAGAGGGGGGTGGGAGGGGGG + Intergenic
915082371 1:153360924-153360946 CTGGTTGGGTAGAGGCAGGGTGG - Exonic
915087333 1:153397563-153397585 CAGAGTGGGAAGAGACAAGGTGG + Intergenic
915312847 1:155013014-155013036 CAGGGTGATTTGAGGGAGGGAGG + Intronic
915443124 1:155958901-155958923 CAGTGTGGGTGGGGGGTGGGGGG + Intronic
915530506 1:156500061-156500083 GAGAGGAGGGAGAGGGAGGGAGG + Intronic
915650784 1:157308933-157308955 GAGAGAGGGAAGAGGGAGGGAGG - Intergenic
915780684 1:158546837-158546859 GAGAGTGGGTGGTAGGAGGGAGG - Intergenic
916403608 1:164475118-164475140 GACAGTGGGCAGAGGGATGGCGG + Intergenic
916720768 1:167483409-167483431 CAGGGTAGGGAGGGGGAGGGAGG - Intronic
917002040 1:170370986-170371008 CAGGGTGGGGGGAGGGAGGAGGG - Intergenic
917194528 1:172451260-172451282 CAAAGTGAGTAGAGAGAGAGTGG - Intronic
917213586 1:172655793-172655815 CAAAGTGGAGAGAGGGAGAGAGG - Intergenic
917632558 1:176904457-176904479 CAGCATGGGGAGAGGGAGTGCGG + Intronic
917848900 1:179043296-179043318 CAGAGTGGGTGCGGGGAGTGGGG + Intronic
918093277 1:181315371-181315393 CAGCGCGGGTGGAGGGATGGAGG + Intergenic
919058836 1:192605784-192605806 GAGAGAGGAGAGAGGGAGGGAGG + Intergenic
919204340 1:194401676-194401698 CAGAGTGAGGAGAGGAAAGGAGG + Intergenic
919453912 1:197801141-197801163 CAGAGTGGGCACTGGGAGTGGGG - Intergenic
919523790 1:198621972-198621994 GAGAGAGAGAAGAGGGAGGGAGG + Intergenic
920101269 1:203518446-203518468 CAGAGTGGAGAGTGGGAGGTGGG - Intergenic
920116363 1:203624498-203624520 GAGGGAGGGAAGAGGGAGGGAGG + Intergenic
920227849 1:204450934-204450956 CAGAGGGCGCAGAGGCAGGGCGG + Intronic
920434310 1:205938310-205938332 CAGGGTGGGTGGAGGTATGGAGG - Intronic
920501433 1:206487847-206487869 CACAGAGGAAAGAGGGAGGGAGG - Intronic
920651180 1:207838522-207838544 CAGAGGGCGGAGAGTGAGGGGGG + Intergenic
921289461 1:213643615-213643637 AAAAGGGGGTTGAGGGAGGGAGG - Intergenic
921674765 1:217965378-217965400 CAGAGCGGGTACAGGGAGCTAGG + Intergenic
921827416 1:219688682-219688704 CATGGTGAGGAGAGGGAGGGTGG - Intronic
922268101 1:224006266-224006288 CATACTTGGTAGAGGGAGGTAGG - Intergenic
922384337 1:225067101-225067123 GAGAGTGGGATGAGGGAGAGAGG - Intronic
922504332 1:226117918-226117940 CAGAGTGGGTCTAGGGACGTGGG + Intergenic
922949022 1:229542674-229542696 CAGAGTGGGAAGAGACAGGATGG + Intronic
922978067 1:229801562-229801584 CAGAGTGGATGGAGGGACAGTGG + Intergenic
923142698 1:231174593-231174615 CAGAGAAGGGAGAGGGAGAGGGG - Intronic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923238506 1:232058180-232058202 CAGAGAGGGCAGAGGGCAGGAGG - Intergenic
923393398 1:233536102-233536124 CAGAGTTGGGATAGGGAGAGGGG + Intergenic
924123238 1:240823811-240823833 CAGAGTGGGGGGCGGGAGGGGGG - Intronic
924256474 1:242188190-242188212 CAGAGCGGCAAGAGGGAGGGCGG + Intronic
924441823 1:244092610-244092632 GAGACTGGGTAGATGGAGGTAGG - Intergenic
1062833571 10:622247-622269 GAGAGATGGTAGGGGGAGGGAGG + Intronic
1062955083 10:1534818-1534840 AAGAGTGGGGTGAGAGAGGGCGG + Intronic
1063114310 10:3063460-3063482 AAGAGTGGGTAGGGAGAGGAGGG + Intergenic
1063175155 10:3544231-3544253 GAGAGTGGGCAGAGGGGGTGGGG - Intergenic
1063430954 10:5987871-5987893 CAGAGTGGGGAGAAGGCGGGTGG + Intergenic
1063437305 10:6044783-6044805 AAGAGTGGGTGGAGGGGGAGTGG - Intronic
1063624796 10:7678863-7678885 CAGAGAGGGGGAAGGGAGGGAGG + Intergenic
1063876479 10:10484193-10484215 CAGAGAGAGGAGGGGGAGGGAGG - Intergenic
1063960365 10:11301402-11301424 CAGGGTGGGGTGCGGGAGGGGGG - Intronic
1065125095 10:22566460-22566482 GAGTGTGCGTAGAGGGAAGGGGG - Intronic
1066381840 10:34908518-34908540 CAGAGTGGGCAGTGGTAGGTGGG - Intergenic
1066725596 10:38389343-38389365 CATACTTGGTAGAGGGAGGTAGG + Intergenic
1067284766 10:44899469-44899491 CAGAGTGTGTGGAGGAAGGATGG + Intergenic
1067521512 10:47010619-47010641 CAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1067831008 10:49610979-49611001 CGGAGTGGGCAGCGGCAGGGTGG - Exonic
1067844694 10:49710465-49710487 GAGAGTGGGGAGAGGCAGGGAGG - Intergenic
1068054185 10:51990714-51990736 CTCAGAGGGTAGAGGGTGGGAGG - Intronic
1068830719 10:61491580-61491602 GAGAGAGGGAAGAGGGAGGGAGG + Intergenic
1068870574 10:61939505-61939527 CAGATGGGGTAGAGGGTGAGAGG - Intronic
1069464042 10:68622258-68622280 CAAAGAGGGAAGAGGGAGAGAGG - Intronic
1069560736 10:69427582-69427604 TAGAGTGGAGAGAGGGAAGGAGG - Intergenic
1069637748 10:69936033-69936055 AAGAGAGGGAGGAGGGAGGGAGG + Intronic
1069676864 10:70254938-70254960 CTGAGGGGGTCCAGGGAGGGCGG - Exonic
1069785674 10:70986442-70986464 TACAGTGGGAAGAGGGCGGGTGG + Intergenic
1069785844 10:70987513-70987535 CAGAGTGGGCAGTGGGTAGGAGG - Intergenic
1069917324 10:71795703-71795725 CGGGGTGGGAGGAGGGAGGGAGG - Intronic
1070109334 10:73467804-73467826 CAGGGCTGGTAGAGGGAGGAAGG + Intronic
1070159652 10:73858531-73858553 GAGGGTGGGCAGAGGGAAGGGGG - Intronic
1070543290 10:77432848-77432870 CAGAGGGGGAAGGGGCAGGGAGG + Intronic
1070660177 10:78300030-78300052 CAGAGAGGAAGGAGGGAGGGAGG - Intergenic
1070712299 10:78691568-78691590 TAGAGTGGGTAGATGGAAGATGG + Intergenic
1070771218 10:79083395-79083417 CAGTGTGGCTAGATGGAGTGAGG + Intronic
1070793475 10:79203436-79203458 CTGAGTGGGAGGAGGGAGTGTGG - Intronic
1070940184 10:80337651-80337673 GAGAGCGTGTAGAGGGAGTGAGG - Intronic
1071227143 10:83543821-83543843 GAGACTGGGGTGAGGGAGGGAGG - Intergenic
1071363270 10:84872483-84872505 AATAGAGGGTACAGGGAGGGAGG + Intergenic
1071849379 10:89552984-89553006 CAAAGTGGACAGAGGGACGGAGG - Intronic
1072009370 10:91290241-91290263 CAGAGTGGGAAGCAGGAGGAGGG + Intergenic
1072207852 10:93220884-93220906 CAGAGGGGCTAGAGAGAGAGAGG - Intergenic
1072253540 10:93600545-93600567 CCGAATGGGTGGAGGGAGGGAGG - Intronic
1072652645 10:97307653-97307675 GAGAGTGGGAAGAAGGAGAGTGG + Intergenic
1073037492 10:100574584-100574606 GAGAGAGGGGAGAGGGAGGAAGG - Intergenic
1073148041 10:101293078-101293100 CAAAGAGTGTATAGGGAGGGTGG - Intergenic
1073441287 10:103554178-103554200 CAGAGGGGGAAGAGGGAGGCTGG - Intronic
1073444698 10:103573805-103573827 CAGAGTGGGGACTGTGAGGGAGG - Intronic
1073630290 10:105141404-105141426 CAGAGAGGGTGGAGGGAGATTGG + Intronic
1074002438 10:109386721-109386743 GAGGGAGGGGAGAGGGAGGGAGG + Intergenic
1074322906 10:112420211-112420233 CAGAGTTGGGAGAGAGAGGAAGG - Intronic
1074602289 10:114927093-114927115 GAGAGAGGGGGGAGGGAGGGGGG + Intergenic
1074699930 10:116083890-116083912 CAGAGTGGCAGGAGGGATGGAGG - Intronic
1074763943 10:116686880-116686902 CAGTGTGGGAAGAGGGATGAGGG - Intronic
1074763949 10:116686912-116686934 TAGTGTGGGTAGAGAGATGGGGG - Intronic
1075027806 10:118999376-118999398 CACAATGGGGAGAGGGAGAGAGG + Intergenic
1075257202 10:120934725-120934747 CAAAGCAGGCAGAGGGAGGGGGG - Intergenic
1076109159 10:127848228-127848250 GAGAGAGGGGGGAGGGAGGGAGG + Intergenic
1076125441 10:127970406-127970428 TGGGGTGGGTAGAGGGTGGGAGG - Intronic
1076222199 10:128743252-128743274 CAGAGGGGCCAGAGGCAGGGTGG + Intergenic
1076563492 10:131382471-131382493 CAGGATGGTGAGAGGGAGGGAGG - Intergenic
1076661343 10:132057810-132057832 CATGCTGGGTTGAGGGAGGGAGG - Intergenic
1077102781 11:829556-829578 CAGAGCGGGCAGTGGGAGCGGGG - Intronic
1077150825 11:1072398-1072420 CAGGGTGGGGAGAGGCTGGGGGG + Intergenic
1077163246 11:1123089-1123111 GAGAGAGGGAAGAGGGAGGAAGG - Intergenic
1077322269 11:1947660-1947682 CCGCGTGGGGAGTGGGAGGGTGG + Intronic
1077338616 11:2016353-2016375 AAGAGGGGGTACAGGGTGGGTGG - Intergenic
1077356359 11:2120717-2120739 CAGAGTCGGTGGAGGTAGTGGGG - Intergenic
1077356642 11:2121884-2121906 CAGACTGCATTGAGGGAGGGGGG - Intergenic
1077400517 11:2354099-2354121 GAGAGTGGGGAGAGGCAGAGAGG - Intergenic
1077455984 11:2681214-2681236 AAGAGTGGGTAGAAGGAAGCAGG + Intronic
1077491637 11:2863335-2863357 CAGGCTGGGCAGAGTGAGGGAGG + Intergenic
1077956553 11:7026807-7026829 CATGGGGGGTAGGGGGAGGGGGG + Intronic
1078126835 11:8574097-8574119 GTGAGTGGGGATAGGGAGGGAGG - Intronic
1078159776 11:8830702-8830724 CAGAGTGGGTGAAAGCAGGGAGG - Intronic
1078303246 11:10156140-10156162 CAGAGTGGGCACTGGGAGCGAGG - Intronic
1078859991 11:15238148-15238170 AAGAGTGGGTAAAGGCAAGGAGG + Intronic
1078892761 11:15572459-15572481 CAGGGTGGGTGGGGGTAGGGTGG - Intergenic
1079083505 11:17429720-17429742 GAGAGTGGGTGGTGGGAGGAGGG + Intronic
1079156167 11:17949727-17949749 CAGGGGAGGTAAAGGGAGGGTGG + Intronic
1079683504 11:23326970-23326992 TGGAGGGGGGAGAGGGAGGGGGG + Intergenic
1080244481 11:30164044-30164066 CAGACTGGGTAGTGGGGTGGGGG + Intergenic
1080988526 11:37501900-37501922 GAGCGTTGGTAGAGTGAGGGTGG + Intergenic
1081287450 11:41288483-41288505 GAGAGTGGGTGGAGGGAGATAGG + Intronic
1081340760 11:41924424-41924446 CATTGTGGGGAGAGGGAGGAAGG - Intergenic
1081489490 11:43556554-43556576 AGGTGAGGGTAGAGGGAGGGAGG - Intronic
1081492768 11:43580358-43580380 CAGAATGGGTAGAGAGTTGGGGG + Intronic
1081831753 11:46120834-46120856 CAGAGGGGGAAGGGGGAGGGAGG + Intronic
1081862472 11:46341200-46341222 AAGGCTGGGCAGAGGGAGGGAGG - Intronic
1082982740 11:59138071-59138093 CAGTGTGTGTACAGGGAAGGGGG + Intergenic
1083168911 11:60910476-60910498 AGGAGGGGGAAGAGGGAGGGGGG - Intergenic
1083293668 11:61703652-61703674 GTGAGTGGGTAGATGGAGGATGG + Intronic
1084040788 11:66541583-66541605 CAAAGTGTGTAGAGTGAGGGGGG + Intronic
1084162709 11:67358646-67358668 CTGAGTGAGTAGGGGGCGGGTGG - Intronic
1084450002 11:69231038-69231060 CAGAGATGAGAGAGGGAGGGAGG + Intergenic
1084507016 11:69574725-69574747 CTGAGTGGATGGTGGGAGGGAGG - Intergenic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1084739926 11:71133133-71133155 ATGAGTGGATGGAGGGAGGGAGG + Intronic
1084863666 11:72039135-72039157 CAGAGAGGGTACAGGCAGAGTGG - Intronic
1084938990 11:72602318-72602340 CAGTGTGGGGAGAGACAGGGTGG - Intronic
1084941466 11:72615488-72615510 CAGAGTGGGTAGAGGGAGGGAGG + Intronic
1085043333 11:73339667-73339689 CAGATTGGGCAGAAGTAGGGAGG + Intronic
1085419506 11:76343437-76343459 CAGAGTGGCTAGAGGATTGGAGG - Intergenic
1085472177 11:76765392-76765414 GCGAGTGGGGAGAGGGAGAGAGG - Intergenic
1085586018 11:77706819-77706841 GAAAGTGGGTGGAGGGTGGGAGG - Intronic
1085696008 11:78705274-78705296 CAGAGTCAGTGGAGGGAGAGAGG + Intronic
1085806726 11:79643270-79643292 AAGGGAGGGAAGAGGGAGGGAGG + Intergenic
1085960143 11:81452146-81452168 TGGGGTGGGTAGAGGGTGGGCGG - Intergenic
1086275802 11:85127236-85127258 GAGAGTGGGTGGGGGGCGGGGGG - Intronic
1086712611 11:90027531-90027553 CAGGGTCGGTAGTAGGAGGGAGG + Intergenic
1086850076 11:91798716-91798738 CAGAGGGGGCAGAGGCAGTGGGG - Intergenic
1087831140 11:102820880-102820902 CAGAGAAGGCAGAGGGATGGGGG - Intergenic
1088236471 11:107730066-107730088 CAGACTTGGAAGAGGGATGGTGG - Intergenic
1088550730 11:111009958-111009980 CAGGGTGGATTGAGGGATGGGGG + Intergenic
1088616564 11:111635476-111635498 GAGAGAGGGCGGAGGGAGGGAGG + Intronic
1089323487 11:117642016-117642038 TGGAGTGGGGAGAGGCAGGGTGG - Intronic
1089374323 11:117983786-117983808 CAGAGAGGGGATGGGGAGGGGGG - Intergenic
1089572270 11:119418609-119418631 CACTGTGGGTGGAGGCAGGGAGG + Exonic
1090148905 11:124360213-124360235 AAGAAGGGGAAGAGGGAGGGAGG + Intergenic
1090197247 11:124827209-124827231 CAGGGTGGCTAGAGCAAGGGAGG - Intergenic
1090399928 11:126442693-126442715 CAGAGCAGGCAGAGGGAGGGGGG - Intronic
1090406482 11:126478829-126478851 CTGCGTGAGTAGTGGGAGGGAGG + Intronic
1090442702 11:126737350-126737372 CACAGTGGGCAGGGAGAGGGCGG + Intronic
1090836040 11:130454688-130454710 AGGAGTGGGAAGAGAGAGGGAGG + Intronic
1202805287 11_KI270721v1_random:2973-2995 CCGCGTGGGGAGTGGGAGGGTGG + Intergenic
1202821600 11_KI270721v1_random:71535-71557 AAGAGGGGGTACAGGGTGGGTGG - Intergenic
1091696204 12:2629972-2629994 CAGAGTGGGGAGTTGGAAGGGGG + Intronic
1092171426 12:6375948-6375970 CTGAGTGAGTAGAGGCAGGTGGG + Intronic
1092182017 12:6452476-6452498 TAGTGTGTGTGGAGGGAGGGTGG + Intronic
1092892428 12:12981186-12981208 CAGGGTGGGTAGGAGGAGGGAGG + Intronic
1093233185 12:16574093-16574115 CAGAGTAGGTGGAGGAAGGTTGG - Intronic
1094634460 12:32211831-32211853 CACTGTGGGGAGAGGGAGAGAGG + Intronic
1095385526 12:41645719-41645741 AAGAGAGAGAAGAGGGAGGGAGG + Intergenic
1095477783 12:42603502-42603524 CATAGAGGGTGGAGGGAGCGGGG - Intergenic
1095688566 12:45063027-45063049 CAGGGTGGGAAGTGGGAGGGTGG - Intergenic
1096155119 12:49337248-49337270 CAGAGTGGGAAGTGCGGGGGCGG + Intergenic
1096267449 12:50135095-50135117 GAGAGAGAGGAGAGGGAGGGAGG + Intronic
1096467137 12:51852882-51852904 CAGAGAGGGCAGAGTGGGGGTGG - Intergenic
1096505580 12:52090430-52090452 GAGAGTGGGGAGGGGGCGGGGGG + Intergenic
1096522578 12:52192502-52192524 GAGAGGGGGTAGAAGGAAGGGGG - Intergenic
1096672646 12:53209429-53209451 AAGAGTGGGAACAGAGAGGGTGG + Intergenic
1097083574 12:56450930-56450952 CATACTGGGTCGAGGAAGGGAGG + Exonic
1098216392 12:68224691-68224713 GAGAAAGGGGAGAGGGAGGGAGG + Intronic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1098342497 12:69467202-69467224 CCTAGTGGGTAGAGGCAGGCGGG + Intergenic
1098370072 12:69749350-69749372 CAGACAGGGCAGAGGGTGGGAGG - Intronic
1098637320 12:72800541-72800563 AAGAGTGAGTATAGGGATGGAGG - Intergenic
1099413347 12:82358810-82358832 CAGAGTGGGAAGCAGGTGGGTGG + Exonic
1099922540 12:88977442-88977464 CAGAGAGGAAAGGGGGAGGGTGG - Intergenic
1100321039 12:93493230-93493252 GAGAGGGGGTCGGGGGAGGGAGG - Intronic
1100321635 12:93498768-93498790 GAGAGGGGGTCGGGGGAGGGAGG + Intronic
1100349377 12:93764315-93764337 CAGAGTTGCTGGAGGGAAGGGGG + Intronic
1100569840 12:95837313-95837335 GAGAGAGGGTGGAGAGAGGGAGG + Intergenic
1100728063 12:97430928-97430950 GAGAGTGGGTGGAGAGAGGGTGG - Intergenic
1100748062 12:97667307-97667329 AAGGGAGGGAAGAGGGAGGGAGG + Intergenic
1100868956 12:98890128-98890150 CTGGGTGGGTAAATGGAGGGAGG + Intronic
1100946881 12:99794710-99794732 CACAGGGGTTAGAGGGAGGTGGG + Intronic
1101876400 12:108599167-108599189 CAGCGTGGGTAAAGGTATGGTGG + Intergenic
1102193972 12:111011311-111011333 CAGAGTGGGATGTGGGAAGGTGG + Intergenic
1102501179 12:113353630-113353652 AAGAGTGGAGGGAGGGAGGGAGG - Intronic
1102556037 12:113727264-113727286 AAGAGAGGGGGGAGGGAGGGAGG - Intergenic
1102565496 12:113794811-113794833 CACAGTGGGGAGGGGGGGGGTGG - Intergenic
1102754119 12:115323061-115323083 GAGAGAGGGAGGAGGGAGGGAGG + Intergenic
1102760053 12:115377128-115377150 GAGAGAGGGAAGAGAGAGGGTGG - Intergenic
1102875268 12:116444102-116444124 CAGAGTGGGTATGGGTTGGGGGG + Intergenic
1102983723 12:117262448-117262470 CAGAGAGAGGAGAGGGAGGGAGG + Intronic
1102991683 12:117320716-117320738 CATAGTGAGTGGAGGGAGAGTGG - Intronic
1103036882 12:117664142-117664164 GTGAGTGGGGAAAGGGAGGGAGG - Intronic
1103724358 12:122990399-122990421 CCTGGTGGGTAGAGGGAGGGAGG - Intronic
1103795429 12:123499844-123499866 CTGAGTGGTCAGAGGAAGGGAGG - Intronic
1103988661 12:124784019-124784041 CAGAATGGGGACAGGGAAGGAGG - Intronic
1104002420 12:124868707-124868729 CAGAGTGGGCAAGGAGAGGGAGG - Intronic
1104058528 12:125248801-125248823 CACAGTGGGCAGAGGGAGAAGGG - Intronic
1104536341 12:129621381-129621403 CAGTGGGGGCAGGGGGAGGGTGG - Intronic
1104546069 12:129714057-129714079 CAGTGTGGTTGGAGGGAGGTAGG - Intronic
1104757661 12:131279154-131279176 CAGTGTGGGGAGAGGGAGAGGGG + Intergenic
1104765134 12:131325586-131325608 CAGAGTGGGTGTCAGGAGGGCGG + Intergenic
1104814224 12:131636815-131636837 CAGAGTGGGTGTCAGGAGGGTGG - Intergenic
1104833058 12:131767828-131767850 CATTGAGGGTGGAGGGAGGGAGG + Intronic
1104943298 12:132404789-132404811 CAGAGGGGGCTGAGGGTGGGGGG - Intergenic
1104984091 12:132586987-132587009 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984115 12:132587074-132587096 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984154 12:132587231-132587253 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1105206519 13:18230475-18230497 CAGAGAGAGTAGAGCGGGGGTGG - Intergenic
1105211651 13:18260687-18260709 ATGAATGGATAGAGGGAGGGAGG + Intergenic
1105299430 13:19118906-19118928 CAGGGTGGGGAGCGGGAGGGAGG + Intergenic
1105299494 13:19119215-19119237 AAAAGTGGGTAGATGGAGTGGGG + Intergenic
1105337154 13:19483923-19483945 CTGATTGGGTAGGGGGAGGGGGG - Intronic
1105509263 13:21037790-21037812 CAGAGTGGGCAGGGCCAGGGTGG + Intronic
1105533135 13:21237897-21237919 GAGAGAGAGTAGGGGGAGGGAGG - Intergenic
1105683229 13:22751780-22751802 TAGGGTGGGGAGAGGGAGTGGGG - Intergenic
1105846660 13:24299601-24299623 CAGAGTGGGCAGAGGTAGAGAGG + Intronic
1105920514 13:24958955-24958977 CAGAGTGGGGAGGGGGTGGCAGG + Intergenic
1106029904 13:25990568-25990590 CAGCTGGGGCAGAGGGAGGGAGG + Intronic
1106269274 13:28138460-28138482 AGGAGGGGGTAGAAGGAGGGAGG - Intergenic
1107417678 13:40216550-40216572 CAGGGGGTGTAGATGGAGGGAGG - Intergenic
1107675441 13:42791813-42791835 CAGAGAGGAGAGAGGGATGGGGG - Intergenic
1108002282 13:45915311-45915333 CAGAGTGGGTACAGGGAGCAGGG - Intergenic
1108035522 13:46286518-46286540 CATTGTGGGTGGGGGGAGGGGGG - Intergenic
1108408031 13:50124385-50124407 TTGAGTGGGCAGAGGGAGAGAGG - Intronic
1108436469 13:50406010-50406032 GAGGGGGGGAAGAGGGAGGGAGG - Intronic
1108640728 13:52380324-52380346 AAGAGTGGGCAGTGGGAGGACGG - Intronic
1108953490 13:56120075-56120097 CACAGTGGGTAGTAGGAAGGTGG - Intergenic
1108955986 13:56157425-56157447 CAGGGAGGATGGAGGGAGGGGGG + Intergenic
1109514069 13:63418039-63418061 CAGGGTGGGGAGAGGGGGGAGGG + Intergenic
1110514069 13:76387735-76387757 CAGAGTGGATAGAGGAAGTCTGG + Intergenic
1110540389 13:76700907-76700929 GAGAGAGGGAAGGGGGAGGGAGG + Intergenic
1111047186 13:82829287-82829309 CAGAGTGGGAAGCTGGAGAGGGG + Intergenic
1111448326 13:88379948-88379970 AAGGGTGGATAGAGGGTGGGAGG - Intergenic
1111654787 13:91139157-91139179 TAGGGTAGGTTGAGGGAGGGAGG - Intergenic
1112057330 13:95702232-95702254 CAGACTGGGAAGAGGCAGGAGGG - Intronic
1112372382 13:98805037-98805059 CAGACCGGGAAGAGGCAGGGCGG - Exonic
1112390183 13:98976147-98976169 CAGAGAGGGGTGAGGGAGTGAGG - Intronic
1113100008 13:106707076-106707098 CAGAGTGGGAAGGAGTAGGGAGG + Intergenic
1113179787 13:107612087-107612109 GAGAGAGGGGAGGGGGAGGGAGG + Intronic
1113325353 13:109276326-109276348 GAGAGTTGTAAGAGGGAGGGAGG + Intergenic
1113391878 13:109905711-109905733 AAGGGTGTGTGGAGGGAGGGAGG - Intergenic
1113618007 13:111694745-111694767 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113618018 13:111694804-111694826 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113618064 13:111695039-111695061 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623540 13:111780006-111780028 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623551 13:111780065-111780087 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623597 13:111780300-111780322 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113947354 13:114051639-114051661 CAGTGTGGGCACAGGAAGGGCGG - Intronic
1114050937 14:18919470-18919492 CAGGGTGGGGAGCGGGAGGGAGG - Intergenic
1114111622 14:19482452-19482474 CAGGGTGGGGAGCGGGAGGGAGG + Intergenic
1114515618 14:23298007-23298029 CAGTGGGGGAAGAGGGAGGGAGG + Exonic
1114532135 14:23402863-23402885 TAGAGTTGGGAAAGGGAGGGAGG + Intronic
1114663985 14:24368021-24368043 AAGAGAGGACAGAGGGAGGGAGG + Intronic
1115117205 14:29895445-29895467 GAGAGTGGGAACAGGGAGGGCGG - Intronic
1117006837 14:51428999-51429021 GAGAGAGGGGAGAGAGAGGGTGG + Intergenic
1117248738 14:53913954-53913976 CAGAGTGGGGAGCAGGAAGGTGG - Intergenic
1117257844 14:53998707-53998729 GAAACTGGGCAGAGGGAGGGGGG - Intergenic
1117654067 14:57936594-57936616 TCTAGTGGGTAGAGGGAGGTAGG + Intronic
1118621776 14:67620266-67620288 CAGAGAATGGAGAGGGAGGGAGG + Intronic
1118710732 14:68517266-68517288 CAGAGAGGGGAGAGGAGGGGAGG + Intronic
1118935030 14:70279865-70279887 GAGAGTGGGGGGAGGGAGGAGGG + Intergenic
1119009734 14:70972249-70972271 CAGGGTGGGGAGAGCAAGGGGGG + Intronic
1119180213 14:72600325-72600347 CAGAGAGGAGGGAGGGAGGGAGG - Intergenic
1119217035 14:72876926-72876948 GGGAGTGGGGAGAGGGAAGGAGG - Intronic
1120549656 14:85854444-85854466 TAATGTGGGTAGTGGGAGGGAGG - Intergenic
1120880502 14:89412173-89412195 CAGAGTGGGCAGGGGATGGGGGG + Exonic
1121013930 14:90536928-90536950 CAGAGTCCTTAGAGGGAGGCAGG + Exonic
1121066212 14:90968299-90968321 CACAATAGGAAGAGGGAGGGAGG - Intronic
1121113843 14:91330285-91330307 CAGAGTCGGAAGAGAGAGTGGGG + Intronic
1121187025 14:91982456-91982478 CAGAGGGGGAAAAGGGAGAGGGG + Intronic
1121506852 14:94484188-94484210 CAGGGTGGGAAGATGTAGGGAGG + Intergenic
1121676729 14:95759579-95759601 CAGAGTGAGAGGAGAGAGGGGGG - Intergenic
1121840286 14:97128451-97128473 CAGGGAGGGGAGGGGGAGGGGGG + Intergenic
1122245199 14:100397722-100397744 CAGAGTGTGCAAAGGCAGGGAGG + Intronic
1122329195 14:100901635-100901657 CAGAGTGAGTGGAAGGAGCGAGG - Intergenic
1122448095 14:101782754-101782776 GAGAGAGGGGAGAGAGAGGGAGG - Intronic
1122748647 14:103916799-103916821 GTGAGTGGGTGGAGGGAGGGAGG - Intronic
1122873294 14:104651161-104651183 AAGAGTGGGTAGGGGTGGGGAGG - Intergenic
1122941020 14:104981418-104981440 CAGAGTGGGCAGGAGAAGGGAGG - Intergenic
1123154368 14:106210147-106210169 CAGAGCGGGTGGAAGGAGGCTGG - Intergenic
1202859782 14_GL000225v1_random:73659-73681 CTGGGTGGGTAGAGGGAGTGTGG + Intergenic
1123962814 15:25423928-25423950 CAGAGTGGTCACAGTGAGGGTGG - Intronic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1124354493 15:28984810-28984832 CAGAGATGGCAGTGGGAGGGGGG - Intronic
1124592442 15:31065268-31065290 CAGAGTGGGTAGAATGGGGATGG - Intronic
1124693616 15:31845709-31845731 CAGAGTGGGTAGAGGGTACAGGG - Intronic
1124909624 15:33906186-33906208 TGGAATGGGTGGAGGGAGGGAGG + Intronic
1125104751 15:35957505-35957527 AAGAGTGGGTAGTGGAAAGGAGG - Intergenic
1125501960 15:40245498-40245520 CACAGAGGGTGGAGGGAGCGAGG + Intronic
1126592192 15:50351650-50351672 GAGAGAGGAAAGAGGGAGGGAGG + Intronic
1126759947 15:51960888-51960910 GAGTGTGGGGAGAGGGAAGGGGG + Intronic
1127019128 15:54726298-54726320 AAAAGAGGGTAGAGGGAGAGAGG - Intergenic
1127165615 15:56243291-56243313 CAGAGGGGTGGGAGGGAGGGAGG + Intergenic
1127483653 15:59399967-59399989 CAGAGAGGCTCCAGGGAGGGTGG + Intronic
1127690216 15:61388070-61388092 CAAAGAGGGTAGAGGCAGGAAGG + Intergenic
1127808902 15:62546134-62546156 CACAGTGTGGAGAGGGAGGTCGG + Intronic
1127907576 15:63387646-63387668 CAGAGAGGGAAGGGGGAGGAAGG + Intergenic
1127920723 15:63492225-63492247 CACAGTGGCCAGAGAGAGGGAGG + Intergenic
1128737708 15:70062663-70062685 CAGAGTGGGAGGGGGGATGGGGG - Intronic
1128803387 15:70512616-70512638 CAGAGTGGGGAGAGAGGGAGAGG + Intergenic
1129177856 15:73852912-73852934 CAGAGTGGGGTGAGGGAGCTGGG - Intergenic
1129463603 15:75712024-75712046 GAGAGTGGGTAGTGGGTGGGGGG + Intronic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1129721285 15:77879378-77879400 GAGAGTGGGTAGTGGGTGGGGGG - Intergenic
1130190074 15:81725933-81725955 CAAAGTGGGGGCAGGGAGGGAGG - Intergenic
1130230784 15:82095069-82095091 CAGAGTGGGGAGAGGCCGTGGGG + Intergenic
1130262636 15:82369904-82369926 CAGAGTGGGGAAGGAGAGGGAGG - Intergenic
1130278591 15:82499043-82499065 CAGAGTGGGGAAGGAGAGGGAGG + Intergenic
1131225945 15:90624472-90624494 CAGAGGGTGAGGAGGGAGGGTGG - Intronic
1131316055 15:91338673-91338695 GAGAGTGAGGAGAGAGAGGGAGG + Intergenic
1131442666 15:92470670-92470692 GAAATTGGGTAGAGGGAGTGGGG + Intergenic
1131462166 15:92625149-92625171 CAGAGTTTGGGGAGGGAGGGAGG - Intronic
1131983212 15:98016375-98016397 GGGAGAGGGTAGAGGGTGGGTGG - Intergenic
1132583820 16:697226-697248 CAGGCTGGGTGGTGGGAGGGTGG + Exonic
1132664613 16:1075915-1075937 CAGGGTGGGGGGAGAGAGGGAGG - Intergenic
1132751584 16:1460142-1460164 CAGAGTGAGGAGATGGAAGGAGG + Intronic
1132856011 16:2044866-2044888 CAGGGTGTGTCGAGGGCGGGGGG - Intronic
1132883356 16:2171932-2171954 CAGAGTGCGGAGAGGCAGGCAGG - Intronic
1132934359 16:2473410-2473432 CAGTCTGGGTAGAAGGTGGGAGG - Exonic
1132936748 16:2485055-2485077 GAGAGTAGGTGGAGGGAGGCTGG - Intronic
1133018732 16:2956579-2956601 CAGCGTGGGCAGAGCCAGGGAGG - Intergenic
1133293560 16:4738384-4738406 TACAGTGGGGAGTGGGAGGGAGG + Intronic
1133392816 16:5422976-5422998 AGGAGTGGGGAGAGGGAGGAGGG + Intergenic
1133485334 16:6214409-6214431 GGGAGTGGGGAGAGGGAGAGAGG + Intronic
1133584683 16:7181510-7181532 AAGGGAGGGAAGAGGGAGGGAGG - Intronic
1133840826 16:9407745-9407767 CAGAGGTGGTGGAGGGAGAGAGG + Intergenic
1133873825 16:9714272-9714294 CAGAGTGGGGAGAGGGAGATTGG - Intergenic
1133890872 16:9877641-9877663 GAGAGGGGGGAGAGGGAGAGAGG - Intronic
1133998193 16:10763131-10763153 CAGGGGTGGTAGAGGGAGGCCGG + Intronic
1134040099 16:11061861-11061883 CAGAGTTGGGAGACGGAGGAAGG - Intronic
1134112643 16:11524745-11524767 CTGGGTGGCTGGAGGGAGGGAGG - Intergenic
1134492015 16:14702721-14702743 CAGAATGGGTGGACCGAGGGTGG - Intergenic
1134497396 16:14741843-14741865 CAGAATGGGTGGACCGAGGGTGG - Intronic
1134687634 16:16169786-16169808 AAGAGTGCGTAGAGGCAGAGGGG + Exonic
1135102009 16:19614019-19614041 CTGAGTGGGTAGAGCGTGGGGGG + Intronic
1135547288 16:23374803-23374825 CCGAGTGGAGAGAGGTAGGGAGG + Intronic
1136153203 16:28365496-28365518 CAGAATGGGGGGATGGAGGGTGG + Intergenic
1136209883 16:28749777-28749799 CAGAATGGGGGGATGGAGGGTGG - Intergenic
1136295223 16:29297796-29297818 CAGGGTGGGTGGATGGATGGTGG + Intergenic
1136402440 16:30025881-30025903 CAGAGGGGAAAGAGGAAGGGCGG - Intronic
1136408507 16:30063695-30063717 GAGAGAGGGTTGAGGGAGGTGGG - Intronic
1136540759 16:30926577-30926599 CAGAGTGGGGAGGGGGACGCAGG - Intronic
1136548219 16:30967087-30967109 TAGGGTGGGGAGAGGGAGAGGGG + Intronic
1137063381 16:35811967-35811989 CAGCATGGGTGGAGGAAGGGAGG - Intergenic
1137320907 16:47380617-47380639 CAGGGTTGGTATAGGGAGAGTGG + Intronic
1137627130 16:49916307-49916329 CAGAGTGGGAACAAGGAGGGTGG - Intergenic
1137758673 16:50922847-50922869 CAGAGTGGGAAGGAAGAGGGTGG + Intergenic
1138234562 16:55371081-55371103 CGAAGTAGGTAGAGGGAAGGAGG - Intergenic
1138575245 16:57903558-57903580 CAAGGTGGGTAAAGTGAGGGGGG + Intronic
1138832754 16:60395031-60395053 CAGGGTGGGCAGAGAGATGGTGG - Intergenic
1138941267 16:61793406-61793428 GCTAGAGGGTAGAGGGAGGGAGG - Intronic
1139041499 16:63004460-63004482 CAGAGCAGGGAGAGGAAGGGGGG - Intergenic
1139094987 16:63694609-63694631 CCAAGTGGGAGGAGGGAGGGAGG + Intergenic
1139308195 16:66005952-66005974 CAGAGTGGGTAAGGGGAGGCTGG + Intergenic
1139375052 16:66491637-66491659 CAGACAGGGTGGAGGGATGGGGG + Intronic
1139672119 16:68499087-68499109 CAGTAGGGGAAGAGGGAGGGAGG - Intergenic
1139783691 16:69373037-69373059 AAGAGGGGGATGAGGGAGGGAGG + Intronic
1139851499 16:69953373-69953395 CTGAGTGGATGCAGGGAGGGGGG - Intronic
1139880475 16:70176285-70176307 CTGAGTGGATGCAGGGAGGGGGG - Intronic
1140026740 16:71297662-71297684 GAGAGTGGGGAGAGGAAGGCAGG - Intergenic
1140372035 16:74419232-74419254 CAGAGTGGATGCAGGGAGGGGGG + Intronic
1140700178 16:77574486-77574508 TTGAGTGGGTGGAGGCAGGGAGG - Intergenic
1141083737 16:81076910-81076932 AAGGGTGGGTAGACGGAGGACGG - Intronic
1141193626 16:81842880-81842902 CAGGGAGGGCTGAGGGAGGGTGG + Intronic
1141667773 16:85474704-85474726 GGGAGTGGGGAGAGGGAGGAGGG - Intergenic
1142017075 16:87755148-87755170 CCACGTGGGAAGAGGGAGGGTGG + Intronic
1142198218 16:88748537-88748559 CACAGCGGGCAGCGGGAGGGCGG + Intronic
1142237465 16:88928958-88928980 CAGAGTGGGTGGTGGAAGGGAGG + Intronic
1142251371 16:88993566-88993588 GAGGGAGGGAAGAGGGAGGGAGG - Intergenic
1142272342 16:89096729-89096751 CAGAGTCGGCCGAGGGAAGGGGG - Intronic
1142401284 16:89860057-89860079 GGGAGTTGGTGGAGGGAGGGAGG + Intronic
1142507983 17:377568-377590 GAGAGTGGGGAGAGGGGAGGGGG + Intronic
1142615947 17:1135181-1135203 CAGAGTGAGCAGAGGGGGAGAGG + Intronic
1142959640 17:3544547-3544569 CACAGTGGGTGGAGGGGGAGGGG + Intronic
1143114927 17:4576925-4576947 CAGAGTGGGCAGTGGGGGTGGGG - Intergenic
1143122232 17:4615713-4615735 CAGAGTGGGTGGAGAGAGCTGGG - Intergenic
1143249875 17:5515229-5515251 CAGAGTGGGGATCGGGAGTGGGG + Intronic
1143476050 17:7204574-7204596 AAGAGTGGGGAGAGGGGGGTAGG + Intronic
1143480454 17:7224938-7224960 CAGCCTGGGGAGAGGGAAGGAGG - Exonic
1143500744 17:7337101-7337123 CAGGAAGGGTAGAAGGAGGGTGG - Intronic
1143823187 17:9581536-9581558 GAGAGAGAGGAGAGGGAGGGAGG + Intronic
1143949884 17:10624050-10624072 AAGACTGGGGAGAGGGAGCGAGG - Intergenic
1144202893 17:12957064-12957086 CTCAGTGGGTAGAGGGGGTGAGG - Intronic
1144482578 17:15639876-15639898 GAGAGTGGGAAGAGGGAGAGAGG - Intronic
1144916105 17:18725155-18725177 GAGAGTGGGAAGAGGGAGAGAGG + Intronic
1145261597 17:21357880-21357902 CAGAGTGGGGACTGGGAAGGAGG - Intergenic
1145772320 17:27502345-27502367 CCCAGTGGGTGGAGGGAGAGTGG + Intronic
1145988027 17:29060684-29060706 AAGAGTGGGAGGAGGCAGGGGGG + Intergenic
1146234957 17:31150620-31150642 CAAAATGAGGAGAGGGAGGGTGG - Intronic
1146307834 17:31744142-31744164 AGGAGAGGGTGGAGGGAGGGAGG + Intergenic
1146390120 17:32414379-32414401 CAGGGTGGGTACAGGGAGAATGG - Intergenic
1146536463 17:33657038-33657060 CAGAGTGGCTAGGGAGAAGGAGG + Intronic
1146654089 17:34625184-34625206 CAGAATGGGGGCAGGGAGGGAGG + Intronic
1146906842 17:36623531-36623553 GAGAGAGGGTAGAAGGAAGGAGG - Intergenic
1146910494 17:36645537-36645559 GAGAGTGGGAGGAGGGAGGGAGG - Intergenic
1147177244 17:38663576-38663598 GAGAGTGGGGAGAGAGAGGGTGG - Intergenic
1147258534 17:39196043-39196065 CAGAATGGGGAGAGTGAGTGAGG + Intronic
1147436838 17:40421572-40421594 CAGAGTGGGGGCAGGGTGGGTGG - Intergenic
1147845954 17:43403975-43403997 AGGAGAGGGAAGAGGGAGGGAGG - Intergenic
1147969954 17:44213914-44213936 ATGAGTGGGCTGAGGGAGGGAGG - Intronic
1148068133 17:44888581-44888603 CAGAGTGGGAACTGGGAAGGTGG + Intronic
1148221236 17:45863875-45863897 CAGAGTGGGGAGGGGGAGTGTGG - Intergenic
1148457541 17:47819109-47819131 AAGTGTTGGTAGAGGGAGAGGGG + Intronic
1148552717 17:48560112-48560134 CAGAGAAGGCAGAGGAAGGGAGG + Intronic
1148553610 17:48564789-48564811 AGGAGTGGGGACAGGGAGGGCGG + Intronic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1148984974 17:51613347-51613369 GAGAGTGGGGAGAGGGAGAGGGG - Intergenic
1148985051 17:51613535-51613557 CAGAGGGGGGAGAGAGGGGGAGG - Intergenic
1149332754 17:55603737-55603759 CGGGGTGGGTGGTGGGAGGGAGG + Intergenic
1149458079 17:56805427-56805449 AGGAGTGGGTGCAGGGAGGGAGG - Intronic
1149546680 17:57509047-57509069 CAGACTGGGAAGATGGAGGCAGG - Intronic
1149652168 17:58282269-58282291 AAGAGTGGGTGGCGGGAAGGTGG - Intergenic
1150431456 17:65121740-65121762 AAGAGCGGGGGGAGGGAGGGAGG - Intergenic
1150677780 17:67259579-67259601 AAGGAGGGGTAGAGGGAGGGAGG + Intergenic
1150859444 17:68786319-68786341 GAGGGAGGGAAGAGGGAGGGAGG - Intergenic
1150956153 17:69862644-69862666 CAAAGTGGGGAGTGGGCGGGGGG - Intergenic
1151146156 17:72043291-72043313 CAGAGTGGAAATAGGGAGAGAGG - Intergenic
1151195163 17:72426045-72426067 GAGAGTGGGATGAGGGTGGGAGG - Intergenic
1151398003 17:73837355-73837377 TGGAGTGGGAAGAGGGAGGAGGG + Intergenic
1151523154 17:74645557-74645579 CAAAAAGGGTAGAGGGAGTGAGG + Intergenic
1151535986 17:74738950-74738972 CATAGTGGGTAGAAGGAGGAGGG - Intronic
1151546712 17:74797742-74797764 CAGAGTGACTGGAGGAAGGGGGG + Intronic
1151553852 17:74836841-74836863 CAGACTGGGTGGAAGGTGGGTGG - Exonic
1151888738 17:76939665-76939687 CAGAGTGGGGAGGAGGAAGGGGG - Intronic
1151908701 17:77066896-77066918 CATGGTGGGCAGAGGCAGGGCGG - Intergenic
1152472836 17:80499931-80499953 CAAAGAGGCCAGAGGGAGGGGGG + Intergenic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1152526477 17:80890816-80890838 GAGAGTGCGTAGACGGAGAGTGG + Intronic
1152583671 17:81179874-81179896 GAGGGTGGGTAAAGGGAGTGGGG + Intergenic
1152635349 17:81428576-81428598 CAGGGTGGGTGGAGGGAGTGGGG - Intronic
1155068438 18:22289652-22289674 ACCAGTGGGTAGGGGGAGGGAGG - Intergenic
1156279289 18:35618885-35618907 CAGACCGAGTTGAGGGAGGGAGG + Intronic
1156363291 18:36403240-36403262 AAAGGTGGGTAGAGGGAGGAGGG - Intronic
1156488314 18:37480715-37480737 CAAAGTTGAAAGAGGGAGGGAGG + Intronic
1156501958 18:37565865-37565887 GAGAGAGAGGAGAGGGAGGGAGG - Exonic
1157128482 18:44980601-44980623 CAGAGGAGGGAGAGGCAGGGAGG + Intronic
1157493511 18:48139613-48139635 CACAGTGATTAGGGGGAGGGAGG - Intronic
1158058713 18:53312961-53312983 GGGAGTGGGGAGAGGAAGGGAGG + Intronic
1158172525 18:54615437-54615459 AAGAGTGGGTGGAAGGAGAGGGG + Intergenic
1158488321 18:57888103-57888125 CTGAGTGGGTAGATGGGGGTGGG - Intergenic
1158678718 18:59547129-59547151 GAGAGAGGGGAGAGAGAGGGAGG + Intronic
1158836138 18:61333665-61333687 CAGAGGGGGTAGGGGGGTGGGGG + Exonic
1158851037 18:61496038-61496060 GAGAGGGGGGAGAGGAAGGGAGG - Intronic
1158851046 18:61496062-61496084 GAGAGGGGGGAGAGGAAGGGAGG - Intronic
1158851091 18:61496188-61496210 TAGAGGGGGGAGAGGAAGGGAGG - Intronic
1159866172 18:73707895-73707917 CAGAGCAGGAAGAGAGAGGGAGG + Intergenic
1160373880 18:78396302-78396324 GAGAGGGGGCACAGGGAGGGCGG + Intergenic
1160459872 18:79030812-79030834 ACGAGTGTGTAGAGGGAGGCAGG + Intergenic
1160566785 18:79790906-79790928 GAGAGAGGAGAGAGGGAGGGAGG - Intergenic
1160596720 18:79980600-79980622 CAGGGTGGGGAGAGGGGGAGGGG + Intronic
1160703178 19:517907-517929 CAGGCTGGGTAGAGGCTGGGAGG + Intronic
1160703195 19:517956-517978 CAGGCTGGGTAGAGGCTGGGAGG + Intronic
1160872116 19:1282331-1282353 GAGAGTGGGAAGGGGGAGGAGGG + Intergenic
1160940515 19:1618519-1618541 CAGAGTGAGGAGAGGGAGAGAGG - Intronic
1160970696 19:1766554-1766576 CAGAGAGGGGAGAGGGAGGGAGG + Intronic
1161035154 19:2080269-2080291 CAGAGAGGGGAGAGGGAGTGAGG + Intronic
1161050449 19:2161065-2161087 CTGAGTGGGTAGGGAGAGAGAGG + Intronic
1161142248 19:2654629-2654651 CTGAGTGGGGGGAGGGAGAGAGG + Intronic
1161220166 19:3114730-3114752 CAGAGAGGATAGAGGTTGGGAGG + Intronic
1161226155 19:3146909-3146931 CAGAGTGAGGAGGGGGAGAGAGG - Intronic
1161241365 19:3225396-3225418 AAGAGTGGGGTGAGGGAGGGAGG - Intronic
1161243056 19:3233664-3233686 CAGAGTGAGGAGGGGGAGAGAGG + Intronic
1161253093 19:3291736-3291758 CAGAGTGAGGAGGGGGAGAGAGG + Intronic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161442604 19:4300812-4300834 CAGAGTGAGGACAGGGAGAGAGG + Intronic
1161589326 19:5121975-5121997 CAGCGTGGACAGGGGGAGGGAGG - Intronic
1161610483 19:5239224-5239246 CAGAGAGGGATGAGGGAGAGAGG + Intronic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161642947 19:5435706-5435728 CAGAGTGAGGAGGGGGAGAGAGG - Intergenic
1161756428 19:6137456-6137478 CAGAGTGAGGAGGGGGAGGGAGG + Intronic
1162141804 19:8589696-8589718 CAGCTTGGGCAGAGGGAGTGGGG + Intronic
1162157794 19:8691439-8691461 CAGAAAGGGAAGAGGGAGGGAGG - Intergenic
1162247157 19:9410906-9410928 CGGGCTGGGGAGAGGGAGGGAGG + Intergenic
1162343267 19:10105249-10105271 CAGAGGGGGCTGAGGGTGGGGGG - Intergenic
1162480325 19:10923713-10923735 CAGAGTGGGTGGTGGCTGGGGGG - Intronic
1162564531 19:11437998-11438020 GAAAGGTGGTAGAGGGAGGGAGG + Intronic
1162583575 19:11545482-11545504 CAGGGAAGGTGGAGGGAGGGGGG + Intronic
1163009728 19:14417481-14417503 CCGGGTGGGTGGGGGGAGGGGGG + Intronic
1163350968 19:16776974-16776996 GAGAGTGGGGAGGGGAAGGGAGG + Intronic
1163458708 19:17423879-17423901 CAGAGTTGGGAGAGGGAAGTAGG - Intronic
1163567192 19:18058707-18058729 CAGTGTGGGCAGAAAGAGGGAGG + Intergenic
1163598081 19:18231974-18231996 CAGGGTGGGGTGAGGGAGTGGGG + Intronic
1163598818 19:18235774-18235796 CAGTGTGGCTGGAGGGTGGGAGG - Intronic
1163632166 19:18423081-18423103 CAGAGTGGGCTGAGGGAGGCTGG + Intronic
1163633574 19:18428681-18428703 CACAGGGGGTAGGGGGTGGGCGG - Intronic
1163685618 19:18710222-18710244 CTGGGTGGGTAGATGGAGGAAGG - Intronic
1164392838 19:27840727-27840749 GGCAGTGGGTGGAGGGAGGGCGG - Intergenic
1164398701 19:27888118-27888140 CAGAGTGGGGAGATGGTGGTGGG + Intergenic
1164526262 19:29015727-29015749 GAGAGGGGGGAGAGAGAGGGAGG - Intergenic
1164534713 19:29076528-29076550 CAGCCTGGGTCGAGGCAGGGCGG - Intergenic
1164559209 19:29277083-29277105 CACAGGGGGAAGAGGGAGGGAGG + Intergenic
1164797040 19:31041666-31041688 CAGTTTGGGTGGAGGGATGGAGG - Intergenic
1165080900 19:33305462-33305484 GAGAGTGGGGTGAGGGAGGGTGG + Intergenic
1165346221 19:35250055-35250077 CAGGCTGGGAAGAGGGATGGCGG + Intronic
1165425624 19:35743908-35743930 CATAGAGGGTAGAGAGATGGAGG + Intronic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1165771824 19:38384806-38384828 CAGTGTGGGTAGGGGGTGGCTGG + Intronic
1165906203 19:39196361-39196383 CAGAGTGGGGAGGGGGAGGAGGG + Intergenic
1165945830 19:39441589-39441611 GAGGCTGGGTAGAGAGAGGGAGG + Intronic
1166047693 19:40238991-40239013 CAGGGTGGGAGGTGGGAGGGAGG + Intronic
1166088257 19:40491283-40491305 CAGAGTGGCTAGAGAATGGGAGG + Intronic
1166329582 19:42070219-42070241 GAGAGAGAGAAGAGGGAGGGAGG + Intronic
1166599594 19:44082249-44082271 CAGGGTGGGAAGAGGGGGTGGGG - Intronic
1166634470 19:44437966-44437988 GAGAGTGGATAGTGGGAGGAGGG + Intronic
1166983818 19:46648346-46648368 AGGAGTGGGGAGAGTGAGGGGGG + Exonic
1167253005 19:48410848-48410870 TAGGCTGGGTAGCGGGAGGGAGG + Intronic
1167429674 19:49447262-49447284 CAGTGTGGGAGGATGGAGGGAGG + Intronic
1167452622 19:49581142-49581164 CAGAGCGGGTAGGGGTCGGGAGG + Intronic
1167529172 19:50004281-50004303 CAGGGTGGGGAGAGGGCAGGAGG - Intronic
1167596467 19:50430915-50430937 ATGAGTGGGAAGGGGGAGGGAGG + Exonic
1168153620 19:54461639-54461661 AAGAATGCGGAGAGGGAGGGAGG - Exonic
1168242926 19:55096247-55096269 CACAGAAGGTATAGGGAGGGAGG - Exonic
1168271826 19:55254346-55254368 CAGAGCTGGTGGAGGGAGAGCGG - Intronic
1168321280 19:55511469-55511491 CAGCGTGGGCAGAGGCTGGGAGG + Intronic
1168472330 19:56649734-56649756 CAGTGTGGCTGGAGGGTGGGAGG + Intronic
1168691775 19:58381721-58381743 CATAGTGGGAGGAGGAAGGGAGG - Intergenic
925305964 2:2848657-2848679 CACAGTGGGGAGAGAGAGAGGGG - Intergenic
926085389 2:10016580-10016602 CAGGGTGAGTAGGAGGAGGGAGG + Intergenic
926087864 2:10031377-10031399 CAGAGGGGGTTGAGTGTGGGGGG - Intergenic
926313042 2:11688284-11688306 GACTGTGGGGAGAGGGAGGGTGG - Intronic
926325171 2:11779176-11779198 CAGAGTGGGGTGGGGAAGGGTGG + Intronic
926630448 2:15130794-15130816 CAGTGTGGGAAGAGAGAGGGTGG - Intergenic
926633851 2:15160576-15160598 CAGTGTGGGCGGGGGGAGGGGGG + Intergenic
926683526 2:15681057-15681079 GGGAGGGGGGAGAGGGAGGGAGG + Intergenic
926930312 2:18031521-18031543 GAGAGAGGGAGGAGGGAGGGAGG - Intronic
927201764 2:20582636-20582658 CCGAGTGGAAAGAGGGTGGGTGG - Intronic
927461457 2:23302107-23302129 CAAAGTGGGGGGGGGGAGGGTGG - Intergenic
927463790 2:23322021-23322043 CAGAGTGTGCAGAGGGAGATGGG + Intergenic
927506916 2:23620756-23620778 CAGAGGTGGGAGAGGGAGGCAGG + Intronic
927557890 2:24049029-24049051 CAGAGCTGGGGGAGGGAGGGAGG - Intronic
927659522 2:24981061-24981083 GGGAGGGGGGAGAGGGAGGGAGG + Intergenic
927904656 2:26848088-26848110 CAGAGTGGGGAGCGGGGGAGGGG - Exonic
928424876 2:31169536-31169558 CAGAGTGAGTGGTGGGAGGTGGG - Intergenic
928644625 2:33339033-33339055 GAGAATGGATAGAGGGAGGGAGG + Intronic
928742659 2:34373258-34373280 GAGAGAGGGAGGAGGGAGGGAGG - Intergenic
928924981 2:36568197-36568219 CAGAGTGGGAGGGGGAAGGGAGG + Intronic
928996970 2:37303204-37303226 CAGAGTGGGATGTGGGAGAGGGG - Intronic
929573511 2:43038481-43038503 CAGAGTGGGGAGAGGAGGGGCGG - Intergenic
930837614 2:55811351-55811373 AAGAGAGGGTAGAGAAAGGGAGG - Intergenic
931999278 2:67869163-67869185 CACAGTGTGGAGAGGGAAGGAGG - Intergenic
932302536 2:70677230-70677252 GGGAGAGGGGAGAGGGAGGGAGG + Intronic
932356062 2:71069084-71069106 CAGGGTGGGGAGTGGGAGTGGGG + Intronic
932424438 2:71620172-71620194 CAGATTTTGGAGAGGGAGGGAGG + Intronic
933465701 2:82648166-82648188 CAGAGGGGGTGGGGAGAGGGAGG + Intergenic
933606594 2:84390120-84390142 CAGAGTGGGTTCTGGGAGTGGGG + Intergenic
933778585 2:85786614-85786636 CACAGTGGGTAGTGGGAGCCAGG - Intronic
933927307 2:87106050-87106072 CAGGGAGTGTGGAGGGAGGGAGG - Intergenic
934113237 2:88761680-88761702 TGGAGTGGGGAGGGGGAGGGGGG - Intergenic
934301970 2:91781768-91781790 ATGAATGGATAGAGGGAGGGAGG - Intergenic
934511329 2:94946715-94946737 AAAAGTGAGTAGATGGAGGGGGG - Intergenic
934604331 2:95682707-95682729 CAGAGGGAGTAGCGCGAGGGAGG - Intergenic
934681018 2:96284001-96284023 CAGGCTGGAAAGAGGGAGGGAGG + Exonic
934736051 2:96690410-96690432 AGGTGTGGGAAGAGGGAGGGAGG + Intergenic
935210874 2:100938582-100938604 CAGAGAGGAGGGAGGGAGGGAGG - Intronic
936488323 2:112946579-112946601 CAGTGTAGCAAGAGGGAGGGAGG - Intergenic
937005046 2:118503785-118503807 TAGAGTGGGAAGAGGGAGGAAGG + Intergenic
937814062 2:126231666-126231688 AAGAGAAGGAAGAGGGAGGGTGG - Intergenic
938026228 2:127951336-127951358 CAGAGTGGGTAGAGGAAAATAGG - Intronic
938101429 2:128500348-128500370 GAGGGTGGGAAGAGGGTGGGAGG + Intergenic
938126831 2:128680337-128680359 AAGAGAGGGGGGAGGGAGGGAGG - Intergenic
938287528 2:130129958-130129980 CGGGGTGGGGAGCGGGAGGGAGG + Intergenic
938584108 2:132671550-132671572 AAGAAGGGGGAGAGGGAGGGAGG - Intronic
938903231 2:135816228-135816250 CAGAGAGGGAAGAGGCAAGGAGG - Intronic
939144015 2:138390731-138390753 CAGATGGCGTGGAGGGAGGGCGG - Intergenic
939244517 2:139606454-139606476 CATGGGGGGTGGAGGGAGGGGGG + Intergenic
939480593 2:142742832-142742854 CATTGGGGGTGGAGGGAGGGGGG - Intergenic
941170034 2:162125269-162125291 CAGACAGGGAGGAGGGAGGGGGG - Intergenic
941274536 2:163474102-163474124 TAGTGTGGGTAGAGTGGGGGTGG + Intergenic
941508413 2:166376065-166376087 AGGAGTGGAGAGAGGGAGGGAGG - Intergenic
941563747 2:167082091-167082113 TGTGGTGGGTAGAGGGAGGGGGG - Intronic
942105049 2:172625275-172625297 CAGAGTGGGGACGGGGAGAGTGG - Intergenic
942483910 2:176419397-176419419 CAGTGTGGGAAGAGAGAAGGGGG - Intergenic
942919661 2:181356380-181356402 CAGTGTGGGTTCAGGGATGGGGG - Intergenic
943484784 2:188465539-188465561 CAGTGTGGGCTGAGGGAGAGAGG - Intronic
944501050 2:200360556-200360578 CGGAGTGGGGAGAGGAAGGGGGG + Intronic
944546600 2:200805115-200805137 CAGATGGGGAAGAGGGAGGTAGG - Intergenic
945504920 2:210628165-210628187 AAGAGTGGGTAGAAGGGGAGGGG - Intronic
945853163 2:215034407-215034429 CAGAGTGTGGAGAGGAATGGGGG + Intronic
945929762 2:215843037-215843059 CAGAGTGAGAGGAGGGAGAGTGG - Intergenic
946051817 2:216869245-216869267 CATAGTGGGTGGAGGGGTGGAGG - Intergenic
946159093 2:217825314-217825336 GAGTGTGGCTAGAGGGAGGTGGG - Intronic
946411605 2:219517893-219517915 CAGAGTGGGGAGTGGGAAGGAGG - Intronic
946803038 2:223441708-223441730 CAGAGTTGGGAGAGGGAATGGGG + Intergenic
946921620 2:224585791-224585813 CATGGTGGGGAGTGGGAGGGGGG + Intergenic
946962484 2:224999498-224999520 AAGAGGGGAGAGAGGGAGGGAGG - Intronic
947255464 2:228159129-228159151 CTGAGTTGGTAAAGGCAGGGTGG - Intronic
947323764 2:228952238-228952260 GAGAGGGAGAAGAGGGAGGGCGG + Intronic
947534642 2:230933189-230933211 CAGAGAGGGCGGAGGGAAGGGGG - Intronic
947792907 2:232877977-232877999 CAGAGTGGGGAAAGGGAAAGAGG - Intronic
947935780 2:234002218-234002240 AGGAGTGGGCAGAGGGAGGAGGG + Intronic
948257094 2:236576435-236576457 GAAAGTGGAGAGAGGGAGGGAGG - Intronic
948408829 2:237743287-237743309 CAGAGGGGAGGGAGGGAGGGTGG + Intronic
948453457 2:238093013-238093035 CAGGGTGGGAAGAGGGTTGGAGG - Intronic
948486552 2:238285005-238285027 CAAGGCGGGTAGGGGGAGGGAGG + Intronic
948756493 2:240162577-240162599 CAGGGCGGGTGGAGGGAGGCGGG + Intergenic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
948865189 2:240771565-240771587 CAGGGTGGGAAGATGCAGGGAGG - Intronic
948938279 2:241182552-241182574 CTGAGTGGGAAGGAGGAGGGTGG + Intronic
949050627 2:241895659-241895681 CTGTGTGGGTGGATGGAGGGGGG + Intronic
1168744832 20:229922-229944 CAGAGGGGGTAGAGCTAGGGAGG + Intergenic
1169307726 20:4507542-4507564 TTGAGGGGGTGGAGGGAGGGCGG + Intergenic
1169790227 20:9402380-9402402 TAGAGTGGCTTGAGTGAGGGTGG + Intronic
1170315021 20:15032121-15032143 CAGAGTGGGCACTGGGAGTGAGG + Intronic
1170369677 20:15635585-15635607 GAGGGTGGGTGGAGGGAGGGAGG + Intronic
1170645536 20:18193893-18193915 GACCGTGGGTAGAGGGAGAGGGG - Intergenic
1170704509 20:18733176-18733198 CTCAGTGGGCAGAAGGAGGGTGG + Intronic
1170745752 20:19097583-19097605 CAGAGTGAGAAGAGGGAGAGGGG + Intergenic
1171232400 20:23498038-23498060 GAGAGAGGGAAGAGGGAGAGAGG + Intergenic
1172095296 20:32457387-32457409 CAGAGTGGGTGGGGGAGGGGTGG + Intronic
1172173939 20:32961103-32961125 CAGAGTGGGGAGCGGGAATGGGG - Intronic
1172230813 20:33334338-33334360 GAGGGTGGGTAGATGGATGGTGG + Intergenic
1172273877 20:33669507-33669529 CAGGGTGGGTAGATGGGTGGGGG - Intronic
1172506550 20:35467075-35467097 CAGTGTGGGGAGAAGAAGGGAGG + Intronic
1172536907 20:35680989-35681011 GAGAAGGGGTAGAAGGAGGGAGG - Intronic
1172643366 20:36455147-36455169 CAGAGTAAGAGGAGGGAGGGAGG - Intronic
1172663004 20:36580192-36580214 CAGAGTGGGATAAGGGAAGGAGG - Intronic
1172789217 20:37490980-37491002 CAGAGAGTGTAGAGGGAAGATGG - Intergenic
1172808724 20:37632033-37632055 CAGAGTGGCTGGGTGGAGGGTGG - Intergenic
1173188067 20:40856555-40856577 CAGTGTGGGGAGAGGGTGGTTGG - Intergenic
1173502974 20:43566885-43566907 GTGGGTGGGTAGAAGGAGGGAGG + Intronic
1173617461 20:44412494-44412516 CAGAGTGTGTAGGGGGAAGCCGG + Intronic
1173651899 20:44671742-44671764 CAGACTGGGTGTGGGGAGGGCGG - Intergenic
1173665041 20:44757261-44757283 CAGAGTGAGCAAAGGAAGGGTGG - Intronic
1173905553 20:46626181-46626203 GGGAGTGGGAAGAAGGAGGGAGG - Intronic
1174184998 20:48700065-48700087 CTGAGTAGGTAGATGGAGGCAGG - Intronic
1174763506 20:53229775-53229797 GAGAGAGGGAGGAGGGAGGGAGG + Intronic
1174885098 20:54325140-54325162 GAGAGTGGGCAGAGGGAGGTAGG + Intergenic
1175157941 20:56985883-56985905 CAGGGATGCTAGAGGGAGGGTGG - Intergenic
1175361658 20:58415943-58415965 CAGAGTAGGGAGAGGAAGGTTGG + Intronic
1175487312 20:59355527-59355549 AAGAGAGGGGAGAGGGAGAGAGG - Intergenic
1175487411 20:59355785-59355807 AAGAGGGGGGAGAGGGAGAGAGG - Intergenic
1175858400 20:62135081-62135103 AACAGTGGGTGGAGGGAGGGTGG + Exonic
1175921412 20:62452055-62452077 GAGAGTGGGGAGAGGGAGAGGGG + Intergenic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175978467 20:62725383-62725405 CACAGTGGGAAGCGGGAGGCGGG + Intronic
1175990291 20:62785324-62785346 CCGGGTGGGGAGATGGAGGGTGG + Intergenic
1176289869 21:5038099-5038121 CAGCATGGGGAGTGGGAGGGGGG - Intronic
1176521135 21:7825430-7825452 CACAGTGAGTAAAGGGATGGTGG + Exonic
1176719115 21:10379081-10379103 CAGAGAGGGGAGAGAGAGGGGGG - Intergenic
1177244249 21:18502219-18502241 CAGAGGAGATAGAGGGATGGAGG + Intergenic
1177457195 21:21355515-21355537 GAGAGAGGGAGGAGGGAGGGAGG + Intronic
1178615578 21:34130115-34130137 CACAGTGGGTGGGGGGATGGGGG - Intronic
1178655155 21:34455442-34455464 CACAGTGAGTAAAGGGATGGTGG + Intergenic
1178914484 21:36699051-36699073 CGGAGGGGGGAGCGGGAGGGGGG - Intergenic
1179546886 21:42118606-42118628 CAGTCTGGGGAGAGGTAGGGAGG + Intronic
1179558539 21:42196076-42196098 GAGAGTGGGGAGGGAGAGGGAGG + Intergenic
1179788571 21:43743099-43743121 CAGAGCGGGGGGAGGGAGGTGGG - Intronic
1179867382 21:44225540-44225562 CAGCATGGGGAGTGGGAGGGGGG + Intronic
1179874899 21:44262509-44262531 CAGGGTGGGTGGGTGGAGGGCGG + Intergenic
1180159195 21:45991474-45991496 GCGAGTGGGCAGCGGGAGGGCGG + Intronic
1180356599 22:11848365-11848387 TACTGTGGGTAGAGGGTGGGGGG - Intergenic
1180469414 22:15641845-15641867 CAGGGTGGGGAGCGGGAGGGAGG - Intergenic
1180759434 22:18188233-18188255 CAGAGAGAGTAGAGCGGGGGTGG + Intergenic
1180769744 22:18372533-18372555 CAGAGAGAGTAGAGCGGGGGTGG + Intergenic
1180776585 22:18490133-18490155 CAGAGAGAGTAGAGCGGGGGTGG - Intergenic
1180782428 22:18528714-18528736 CAGGGTGGGGTGAGGCAGGGCGG + Intronic
1180809313 22:18747502-18747524 CAGAGAGAGTAGAGCGGGGGTGG - Intergenic
1180814459 22:18780955-18780977 ATGAATGGATAGAGGGAGGGAGG + Intergenic
1180819538 22:18816591-18816613 CAGAGTGAGTAGGTGGAGTGGGG - Intergenic
1180827681 22:18875489-18875511 CAGAGAGAGTAGAGCGGGGGTGG + Intergenic
1181072234 22:20352483-20352505 CAGAGAGAGTAGAGCGGGGGTGG - Intronic
1181195308 22:21181424-21181446 CAGAGAGAGTAGAGCGGGGGTGG - Intergenic
1181200647 22:21215291-21215313 ATGAATGGATAGAGGGAGGGAGG + Intronic
1181205764 22:21251036-21251058 CAGAGTGAGTAGGTGGAGTGGGG - Intergenic
1181214139 22:21311350-21311372 CAGAGAGAGTAGAGCGGGGGTGG + Intergenic
1181345022 22:22213424-22213446 GAGAGTTGGCAGAGGGAGGGAGG + Intergenic
1181524587 22:23472988-23473010 CAGAAAGAGTAGAGCGAGGGTGG + Intergenic
1181582730 22:23837026-23837048 GAGGGTGGGGAGAGGGAGGGAGG + Intronic
1181590029 22:23878343-23878365 CAGTGTGGGGCGGGGGAGGGGGG + Intronic
1182062034 22:27405249-27405271 GTGAGAGGGAAGAGGGAGGGAGG - Intergenic
1182103750 22:27674534-27674556 AGGAGTGGGGAGAGGGAGGAAGG - Intergenic
1182476967 22:30581670-30581692 CAGTGTGGGTGCAGGGATGGGGG + Intronic
1182487455 22:30647918-30647940 CAGAGGGGATATAGGGAGAGTGG + Intronic
1182551104 22:31101107-31101129 CAGAGAGGGTCCAGGGAGGCGGG + Intronic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1182848090 22:33447799-33447821 GAGAGTGGGTGGAAGGAGGAAGG + Intronic
1183325336 22:37188309-37188331 GAGAGAGGGCGGAGGGAGGGCGG + Intronic
1183437582 22:37804640-37804662 CAGAGGGGGTAGAGGTGTGGAGG + Intergenic
1183546171 22:38455688-38455710 CAGCGCGGGCAGAGGGAGGCGGG - Intergenic
1183616249 22:38947594-38947616 GAAAGTGAGTAGAGAGAGGGGGG - Intergenic
1183722749 22:39571972-39571994 TAGAGAGGGTAGTGGGAGGCAGG + Intronic
1183966280 22:41444877-41444899 CAGATTGGGTGGGGGGAAGGGGG - Intronic
1184104658 22:42360345-42360367 CAAAGTGGGTGGAGTGGGGGTGG - Intergenic
1184335955 22:43853417-43853439 CAGAGTGGGCAGGGGTGGGGTGG - Intronic
1184642387 22:45879469-45879491 CAGGGAGGGAAGGGGGAGGGAGG - Intergenic
1185002497 22:48254420-48254442 CAAAGAAGGAAGAGGGAGGGAGG + Intergenic
1185096402 22:48808400-48808422 GGGAGTGGGGAGAGGGAGGGTGG + Intronic
1185229843 22:49673623-49673645 GAGAGGGGGAAGGGGGAGGGAGG + Intergenic
1185348101 22:50319461-50319483 CCGGGTGGGTAGGGGCAGGGGGG - Intronic
1185398244 22:50603467-50603489 CAGTGTGGTCAGACGGAGGGTGG - Exonic
1203221157 22_KI270731v1_random:44377-44399 CAGAGTGAGTAGGTGGAGTGGGG + Intergenic
1203226270 22_KI270731v1_random:80144-80166 ATGAATGGATAGAGGGAGGGAGG - Intergenic
1203231573 22_KI270731v1_random:113717-113739 CAGAGAGAGTAGAGCGGGGGTGG + Intergenic
1203264558 22_KI270734v1_random:6642-6664 ATGAATGGATAGAGGGAGGGAGG + Intergenic
1203269668 22_KI270734v1_random:42444-42466 CAGAGTGAGTAGGTGGAGTGGGG - Intergenic
1203277781 22_KI270734v1_random:101486-101508 CAGAGAGAGTAGAGCGGGGGTGG + Intergenic
950079333 3:10209862-10209884 AATAGCGGGGAGAGGGAGGGAGG + Intronic
950193236 3:10992401-10992423 GGGGGTGGGGAGAGGGAGGGAGG + Intergenic
950462878 3:13135647-13135669 CGGAGTGGGTGGAGAGAAGGGGG + Intergenic
950464832 3:13147317-13147339 CAGACTCAGAAGAGGGAGGGTGG - Intergenic
950583961 3:13879994-13880016 CGGAGCGGGAGGAGGGAGGGAGG + Exonic
950788367 3:15453792-15453814 AAGAAGGGGGAGAGGGAGGGAGG + Intronic
950948644 3:16976722-16976744 GAGAGTGGGGAGATGGAGGGAGG + Intronic
952211309 3:31231623-31231645 AAGAGTTGTTGGAGGGAGGGGGG + Intergenic
952867077 3:37861682-37861704 CAGGGTGAGTGGAGGGCGGGAGG - Intergenic
953805761 3:46066029-46066051 AAGGGTGGGTGGAAGGAGGGAGG + Intergenic
954145383 3:48631855-48631877 GAGTGAGGGTAGGGGGAGGGAGG - Intronic
954425852 3:50442775-50442797 CAGCTGGGGTAGAGGGAGGAGGG + Intronic
954671616 3:52294138-52294160 CAGCCTGGGTTGAGAGAGGGAGG + Intergenic
954698943 3:52441779-52441801 CAGGGTGAGAACAGGGAGGGTGG - Intronic
954713132 3:52514682-52514704 CAGGCTGGGGAGAGGGATGGAGG - Exonic
954748292 3:52799346-52799368 GAAAGTGGGGAGAGGGACGGAGG - Intronic
954936516 3:54331926-54331948 CAGGGTAGATTGAGGGAGGGAGG - Intronic
955286871 3:57650131-57650153 CTCAGTGGGGAAAGGGAGGGAGG + Intronic
955675535 3:61444356-61444378 CAGGGTGGAGGGAGGGAGGGAGG - Intergenic
955803965 3:62714523-62714545 CAGTGTGGGTGAAGGGAGGAAGG + Intronic
955925499 3:64000271-64000293 CAAATTGGGTCGGGGGAGGGTGG + Exonic
956163269 3:66377042-66377064 CTGAGTAGGTATGGGGAGGGGGG + Intronic
956219332 3:66884809-66884831 GAGAGTGGGGAGAGGGAAGGAGG + Intergenic
956374142 3:68596054-68596076 CAGAGTGGGGTGGGGAAGGGAGG + Intergenic
956805640 3:72808324-72808346 CAGAGTGGGTTGTGGGAAAGTGG - Intronic
956847338 3:73195671-73195693 CAGGGTGGGGAGTGGGAGGAAGG - Intergenic
958085363 3:88798739-88798761 CATGGTGGGTAGAGGGATGCTGG - Intergenic
959950545 3:112175578-112175600 CAGAGCGCCCAGAGGGAGGGTGG - Intronic
960253697 3:115487331-115487353 CAAAGTGGGTGGAGGTAGGAGGG - Intergenic
960338356 3:116445594-116445616 CAGGGTGGGGGGAGGGTGGGGGG - Intronic
960928756 3:122822958-122822980 CACAGTGGGGAGGTGGAGGGCGG - Intronic
961017918 3:123481772-123481794 CAGAGAGGGCTGAGGGAGGCAGG + Intergenic
961440711 3:126951561-126951583 GAGAGAAGGAAGAGGGAGGGAGG + Intronic
961522521 3:127475232-127475254 CAGGGTGGGTAGAGGTAGACTGG + Intergenic
961563697 3:127748364-127748386 CAGAGGTGGGAGAGGGAGGAGGG + Intronic
961597706 3:128032062-128032084 CAGATAATGTAGAGGGAGGGGGG - Intergenic
962739988 3:138356627-138356649 CAGAGATGATAGAAGGAGGGTGG + Intronic
962982814 3:140506302-140506324 AAGAATGGGCAGAAGGAGGGAGG - Intronic
963284221 3:143417482-143417504 GAGCGGGGGGAGAGGGAGGGAGG + Intronic
963893880 3:150664970-150664992 CTAAGTGGGGAGAGGAAGGGAGG + Intronic
964928977 3:161992239-161992261 AAGAGAGAGTAGATGGAGGGAGG - Intergenic
965173458 3:165299050-165299072 AACAGTGGGTTGAGGGAGGCAGG - Intergenic
965652274 3:170946938-170946960 GAGAGAGGAGAGAGGGAGGGAGG + Intergenic
966060546 3:175749217-175749239 GAGAGGGGGTAGGGGGAGGAGGG + Intronic
966336579 3:178874502-178874524 CAGAGTGGGAAGAGAGAGCTAGG - Intergenic
966542156 3:181103885-181103907 CAGAGTGGAAAGAGTGAGGCAGG + Intergenic
966716579 3:183018734-183018756 CAGAGAGGGAAGAGGGATGAGGG + Intronic
966924524 3:184635774-184635796 CAGCGTGGGGAGAGAGAGGCAGG + Intronic
967870352 3:194224232-194224254 CAGAGGAGGTGGAGGTAGGGGGG - Intergenic
968180523 3:196591864-196591886 CCCAGCGGGTAGAGCGAGGGAGG + Intergenic
968505721 4:970452-970474 CAGAGCCCTTAGAGGGAGGGTGG + Intronic
968601481 4:1512007-1512029 CAGAGCGGGCATAGGGAGGAAGG + Intergenic
968652499 4:1765842-1765864 CAGAGTGGGGAGAAGGGAGGAGG + Intergenic
968780692 4:2578936-2578958 CAGAGGAGGTAGAGGAAGGCAGG + Intronic
968943666 4:3652460-3652482 CCCAGTGGCTGGAGGGAGGGAGG + Intergenic
968952536 4:3702392-3702414 CAGTCTGGGCAGTGGGAGGGGGG - Intergenic
968973200 4:3807093-3807115 GAGAGAGGGAGGAGGGAGGGAGG - Intergenic
968978517 4:3834427-3834449 CTGTGTGGGTGGATGGAGGGTGG - Intergenic
969519289 4:7666450-7666472 CAGGGTGGGAGGAGGGAGGAAGG - Intronic
969526597 4:7706973-7706995 CAGAGCTGGTTGAGGGTGGGTGG - Intronic
969669782 4:8583308-8583330 CACCGTGGTTAGAGGGAGGCAGG + Intronic
969696895 4:8740075-8740097 CAGGCTGGGCAGGGGGAGGGTGG + Intergenic
969870843 4:10103786-10103808 GAGAGTGGGAGGAGGGAGGTGGG - Intronic
970536464 4:17035193-17035215 GAGAGTGGGGAGAGAGAGAGAGG + Intergenic
970828470 4:20307074-20307096 TAGAGCGGGTGGAGGGATGGAGG - Intronic
971230633 4:24798345-24798367 GAGACTGAGTGGAGGGAGGGTGG - Intronic
973288159 4:48442691-48442713 GAGAGTGAGAAGTGGGAGGGGGG + Intergenic
974862971 4:67545707-67545729 CAGAGCGGCTAGAGGTAGGGCGG - Intergenic
974976080 4:68893639-68893661 AATAGAGGGTAGAGGGTGGGAGG - Intergenic
975504387 4:75122419-75122441 AGGAGAGGGGAGAGGGAGGGAGG + Intergenic
976668129 4:87622260-87622282 CAGACAGGGTCGAGGAAGGGAGG + Intergenic
976722241 4:88179983-88180005 AAGAGGAGGTAGAGAGAGGGGGG + Intronic
977407558 4:96619359-96619381 CAGAAAGGGTGGAGGAAGGGAGG - Intergenic
977758986 4:100708059-100708081 AAAAGTGGCTAGAGGGAAGGAGG + Intronic
978219813 4:106256507-106256529 CAGAGTGTGTACAGGGAGCCGGG + Intronic
980086244 4:128393209-128393231 CTAAGTGGGGAGGGGGAGGGAGG + Intergenic
980623448 4:135341313-135341335 CATGGTGGGTGGAGGTAGGGGGG + Intergenic
980729133 4:136804661-136804683 CAGAGAGGGGAGATGGAGGGAGG - Intergenic
981000401 4:139823640-139823662 CAGAGCGGGGTGAGGGAAGGCGG - Intronic
981031136 4:140126992-140127014 AAGACTGGGTGGAGGGAGGTCGG - Intronic
981350993 4:143729426-143729448 CAGAGTGGGTAGAGAAGTGGGGG + Intergenic
982406626 4:155027513-155027535 CAGAGTGGCCAAAGAGAGGGTGG - Intergenic
983268010 4:165528120-165528142 GAGAGTGGATAGTGGGAGGAGGG - Intergenic
983387414 4:167082798-167082820 GAGAGAGGACAGAGGGAGGGAGG + Intronic
984301248 4:177920996-177921018 CAGAGTGGCTAAATGGAGGGGGG - Intronic
985310154 4:188588851-188588873 TAGAATGTTTAGAGGGAGGGAGG - Intergenic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985487335 5:158792-158814 CAGAGTGGGGAGGGAGATGGAGG - Intronic
985627664 5:998235-998257 GAGGGAGGGAAGAGGGAGGGAGG + Intergenic
985968001 5:3352258-3352280 GTGTGTGGGTTGAGGGAGGGGGG + Intergenic
986004202 5:3654410-3654432 CAGAGTGGGGAGAGGGACTTTGG + Intergenic
986164752 5:5263970-5263992 CAGAGAGGGTAGCTGGAGAGGGG + Intronic
986337545 5:6766689-6766711 CAGCGAGGGGAGAGGGAGGGAGG - Intergenic
986424201 5:7614284-7614306 CAGAGGGGATAGAGAGATGGAGG - Intronic
986691518 5:10317410-10317432 GAGAGGGGGGAGAGGGAGAGAGG - Intergenic
986851258 5:11816615-11816637 GAGAGAGGGAAGAGGGAGAGGGG + Intronic
987034130 5:14003498-14003520 CAGAGAGGTGAGAGGGAGGAAGG - Intergenic
987061678 5:14249380-14249402 CAGAGTGAGTGGAGTGGGGGAGG + Intronic
987475509 5:18387603-18387625 AATAGTGGGTAGGGGGAGTGGGG - Intergenic
987607109 5:20151143-20151165 CAGGGTGGGGAGAGAAAGGGGGG - Intronic
987615426 5:20267942-20267964 GAGAGTGGGAAGAGGGAAGGAGG - Intronic
988509379 5:31853120-31853142 AAGAGTGGGAAAAGGGAAGGGGG + Intronic
988787625 5:34579153-34579175 GAGAAAGGGTAAAGGGAGGGAGG + Intergenic
989209968 5:38848551-38848573 CTGAGTGGGAGGAGGGAGGATGG - Intronic
989231845 5:39095836-39095858 CACACTGGGGTGAGGGAGGGAGG + Intergenic
989667530 5:43873831-43873853 CAGAATGGGTGGAGGCTGGGAGG + Intergenic
990099538 5:52164581-52164603 CACACTGGGTAGGGGGAGAGGGG - Intergenic
990416424 5:55591344-55591366 CGGGGTGGGGAGAGGGAGAGAGG + Intergenic
990831894 5:59968423-59968445 ACTAGAGGGTAGAGGGAGGGTGG + Intronic
991166217 5:63567325-63567347 CATTTTGGGTAGAGGGAAGGAGG - Intergenic
991385026 5:66077747-66077769 GTGTGTGTGTAGAGGGAGGGAGG - Intronic
991651692 5:68862216-68862238 CAGAATGAGTAGAGGCAGAGAGG + Intergenic
991651986 5:68865112-68865134 CAGAGTGGGCAGAAGCAGGGTGG + Intergenic
992093327 5:73338844-73338866 CAGAGCGGGGAGAGGGAGGAGGG + Intergenic
992426959 5:76667708-76667730 CAGAGTGAGAAGGGGGAGTGAGG - Intronic
992447952 5:76850733-76850755 AAGAGAGGGAAGAGGGATGGAGG + Intronic
992489057 5:77223379-77223401 AAGAATGGGTGGGGGGAGGGGGG - Intronic
994251004 5:97537090-97537112 TAGAGTGGGCAGAGCGAGAGAGG - Intergenic
994472352 5:100224064-100224086 CAGAGTGATTAAAGGGAGAGAGG - Intergenic
994540288 5:101086536-101086558 AAGGGTGGGTGGTGGGAGGGCGG - Intergenic
994912951 5:105936943-105936965 CTGAGTGGCGAGAGGGAGGTAGG - Intergenic
995551414 5:113285499-113285521 CAGAGTGAGCAGGGGGAGAGTGG - Intronic
995815045 5:116158296-116158318 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815050 5:116158311-116158333 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815055 5:116158326-116158348 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815060 5:116158341-116158363 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815065 5:116158356-116158378 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815070 5:116158371-116158393 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815075 5:116158386-116158408 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815080 5:116158401-116158423 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815085 5:116158416-116158438 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815090 5:116158431-116158453 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815095 5:116158446-116158468 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
995815100 5:116158461-116158483 GAGAGAGGGGAGAGGGAGAGAGG - Intronic
996461710 5:123752433-123752455 CACAGTGGGTAGAGTTGGGGAGG + Intergenic
997582948 5:135028625-135028647 CGGAGTGGGAAGTGGGAGGAGGG + Exonic
998187928 5:139997274-139997296 CTGGGTGGGTAAAGGAAGGGTGG - Intronic
998516306 5:142757677-142757699 CAGAGTGGGCAGAGGGAGAAGGG + Intergenic
998592219 5:143489801-143489823 GTGAGTGGGGAGAGGAAGGGAGG + Intergenic
998735569 5:145136089-145136111 TGGAGAGGGTAGAGGGAAGGAGG - Intergenic
999060177 5:148625253-148625275 CAGGAAGGGTAGAGAGAGGGTGG + Intronic
999099885 5:149014786-149014808 CAGAGTGGGGAGAGAAAGGCAGG - Intronic
999108993 5:149099596-149099618 CACAGTGGGAAGAGCGGGGGTGG + Intergenic
999329122 5:150660802-150660824 GTGAGAAGGTAGAGGGAGGGAGG + Intergenic
999392643 5:151205499-151205521 AGGCGTGGGTAGAGGGTGGGAGG + Intronic
999673379 5:153976454-153976476 AAGAGTGAGGAGAGGGAGGATGG - Intergenic
999956595 5:156709848-156709870 CAGAGTAGGGGGCGGGAGGGTGG - Intronic
999982870 5:156974856-156974878 AAGAGTGGGGGGAGGGAGGGAGG + Intergenic
1000184094 5:158842148-158842170 CAGATTTGGTAAAGGAAGGGGGG + Intronic
1000206283 5:159062476-159062498 AAGATTGGGGAGGGGGAGGGAGG + Intronic
1001092394 5:168751038-168751060 GAGAGAGGCTAGGGGGAGGGAGG + Intronic
1001129580 5:169052869-169052891 CAGAGTGGGGTGAGGGAGGGTGG - Intronic
1001155489 5:169269249-169269271 CAGAGTGGTTAAGGAGAGGGAGG - Intronic
1001276224 5:170353652-170353674 AGGAGTGGGTGGAGAGAGGGAGG + Intronic
1002133577 5:177095507-177095529 CAGAGGGAGTGGAGGGAGCGTGG - Intronic
1002161291 5:177315276-177315298 CAGAGATGGCAGAGGCAGGGAGG - Intergenic
1002338325 5:178495659-178495681 GAGAGTGGGAAGGGGGAGGAAGG + Intronic
1002527876 5:179824982-179825004 CAGAGTGGGAGGAAGGAGAGGGG + Intronic
1002606324 5:180385070-180385092 GAGGGTGGGAAGAGGGAGTGGGG + Intergenic
1002840106 6:898094-898116 GAGAGAGGCGAGAGGGAGGGAGG + Intergenic
1002840622 6:902319-902341 GAGGGAGGGTAAAGGGAGGGAGG - Intergenic
1002902709 6:1423498-1423520 GAGGGTGGGGAGAGGTAGGGAGG - Intergenic
1002940873 6:1714652-1714674 CAGAGTGGGTAAAGGAAAGATGG + Intronic
1003017866 6:2482476-2482498 CGGAGTGGGGAGAGAGAGAGGGG + Intergenic
1003081354 6:3024139-3024161 CAGAGTTGCCGGAGGGAGGGTGG - Intergenic
1003153135 6:3569916-3569938 CAGGGAGGGGAGAGGGAGGGAGG - Intergenic
1003263765 6:4549162-4549184 GAGGGTGGGAAGAGGGAGAGAGG + Intergenic
1003389119 6:5698334-5698356 GAGAGAGAGTAGGGGGAGGGAGG + Intronic
1003484975 6:6567664-6567686 TAGAGTGGGGAGAGGGGGAGAGG - Intergenic
1003661556 6:8067024-8067046 CAGGGTGGGGACAGGGAGGAAGG - Intronic
1003997597 6:11558603-11558625 AAGAGTGGGGAGTGGGAGGTGGG - Intronic
1004106923 6:12674412-12674434 CAGAGTGGGTTTGGGGAGTGGGG + Intergenic
1004170972 6:13295427-13295449 GAGAAATGGTAGAGGGAGGGAGG + Intronic
1004565473 6:16791998-16792020 CCCAATGGGGAGAGGGAGGGAGG - Intergenic
1004664435 6:17736501-17736523 GAGAGCGGGGAGAGGGAGAGGGG + Intergenic
1004943285 6:20584497-20584519 CAGTGTGGGGAGAGGAAGGAAGG + Intronic
1004963558 6:20821099-20821121 CAGAGTGTTTGGAGGGAGAGCGG + Intronic
1005223958 6:23620071-23620093 GAGAGGGGGGAGAGAGAGGGAGG + Intergenic
1005654287 6:27917674-27917696 CCCAGTGGGAAGAGAGAGGGAGG + Intergenic
1005881625 6:30066933-30066955 CAGAGTGGGTGTGGCGAGGGCGG - Intronic
1005993808 6:30919956-30919978 CTGAGTGGGGAATGGGAGGGAGG + Intronic
1006272549 6:32975138-32975160 CAGAGTGGGTGGGAGGTGGGTGG + Intronic
1006397952 6:33799251-33799273 CAGCGTGGGTTGAGGGAGGGCGG - Intronic
1006518467 6:34557427-34557449 CAGAGAAGGTTGAGGGAGGATGG + Intergenic
1006829556 6:36960646-36960668 GGGTGGGGGTAGAGGGAGGGGGG - Intronic
1006852098 6:37106042-37106064 CAGCATGGGTAGAGGCAGGAAGG + Intergenic
1007207505 6:40164546-40164568 CAGAGTGCTTTGAGGCAGGGGGG - Intergenic
1007849773 6:44791947-44791969 CAGAGTGGGTAGAGCAGGGAGGG - Intergenic
1008268647 6:49463271-49463293 TAGATTGGCTGGAGGGAGGGCGG - Intergenic
1008526681 6:52414080-52414102 CAGAGTTGGTAGGTGGGGGGTGG + Intergenic
1008624989 6:53306360-53306382 GAGAGAGGGGAGAGGGAGAGGGG + Intronic
1008856568 6:56095397-56095419 CAGAGTTGGGAGGGGGAGAGTGG - Intronic
1010474068 6:76264618-76264640 CTAAGTGGGTAGAGTGGGGGAGG - Intergenic
1012122302 6:95384122-95384144 CAGAGTGGGCACCGGGAGTGGGG - Intergenic
1012545110 6:100410642-100410664 TGGAGTGGGTAGAGTGAGGCAGG + Intronic
1012697670 6:102408625-102408647 GAGAGAGGGAGGAGGGAGGGAGG - Intergenic
1013216612 6:108033118-108033140 GAGGGAGGGAAGAGGGAGGGAGG - Intergenic
1013246796 6:108294799-108294821 CAGTCTGGGCAGTGGGAGGGAGG - Intergenic
1013343859 6:109240598-109240620 CAGAGTGGGTAGAGGGTCAGAGG - Intergenic
1013599855 6:111693713-111693735 CAGAGCAGGGAGAGGGAGAGTGG - Intronic
1013605823 6:111746808-111746830 GAGAGAGGGTAGAGGGAGGGAGG + Intronic
1013608592 6:111773555-111773577 CAGAGGAGGGAGAGGGAGAGGGG + Intronic
1014550138 6:122780484-122780506 CAGAGTGGGGATGGGGAGAGGGG + Intronic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015533088 6:134240832-134240854 CAGTGAGGGCAGAGGAAGGGTGG + Intronic
1015867196 6:137739490-137739512 CAGAAGGGGTAAAGGGAGTGTGG - Intergenic
1016542052 6:145177587-145177609 TAGTGGGGGTAGAGGGAGGTGGG + Intergenic
1016700550 6:147049105-147049127 AAGAGTGGGTATAGGGAGTGAGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017067543 6:150543272-150543294 CTGAGAGGGTAGAGAAAGGGTGG - Intergenic
1017068279 6:150549815-150549837 TAGAGTGGAGAGAGGGAGGAAGG + Intergenic
1017074686 6:150606888-150606910 CAGAGTTGGGAGAGGGTGGGAGG - Intronic
1017747280 6:157458161-157458183 CAGGGTAGGTAGAAGAAGGGAGG + Intronic
1017752034 6:157496968-157496990 GTGTGTGGGTAGAGGTAGGGTGG + Intronic
1017869846 6:158478098-158478120 GAGAGTGGGAGGAGGGAGGAGGG + Intronic
1017891924 6:158645759-158645781 CAGAATGGGTGAGGGGAGGGAGG - Intergenic
1018053254 6:160030053-160030075 CAGACTGGGAAGAGAGAGGGAGG - Intronic
1018676824 6:166229476-166229498 CTGTGTGGGTGGGGGGAGGGAGG + Intergenic
1018678107 6:166240863-166240885 CAGAGTGGGGAGGTGGAGAGTGG + Intergenic
1018890132 6:167977067-167977089 CTGAGTGGGGGGAGGGAGGAGGG + Intergenic
1018892120 6:167989900-167989922 CTGCGTGGGTACAGGGAGGCCGG - Intergenic
1019419582 7:944835-944857 CAGGGTGGGTAGAGTGGGGATGG - Intronic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019819782 7:3234055-3234077 CAAATTCGGGAGAGGGAGGGAGG + Intergenic
1019825239 7:3279202-3279224 GAGAGGGGGGAGAGGGAGAGAGG + Intergenic
1019896046 7:3984187-3984209 GAGAGGGGGCAGAGGGATGGAGG + Intronic
1020186579 7:5963371-5963393 AGGAGCGGGGAGAGGGAGGGAGG - Intronic
1020296337 7:6761403-6761425 AGGAGCGGGGAGAGGGAGGGAGG + Intronic
1020340216 7:7101893-7101915 CTGAGTAGGCAGAGGGAGGTTGG - Intergenic
1020790857 7:12626839-12626861 CAGTGTATGTAGGGGGAGGGTGG + Intronic
1021103324 7:16608560-16608582 CAGATTTGCCAGAGGGAGGGAGG + Intronic
1021164924 7:17325800-17325822 CAGGGTGGGAGGAGGGAGAGAGG + Intronic
1021327976 7:19297759-19297781 GAGAGTGGGAGGAGGGAGAGGGG + Intergenic
1021509999 7:21425279-21425301 GAGAGAGGGGAAAGGGAGGGAGG - Intergenic
1022311458 7:29200373-29200395 GAAGGTGGATAGAGGGAGGGAGG - Intronic
1022381724 7:29866727-29866749 CAGAGAAGGAAAAGGGAGGGTGG - Intronic
1022389812 7:29933715-29933737 CATAGTAGGAGGAGGGAGGGAGG + Intronic
1022393012 7:29959947-29959969 GAAAGTGGGGGGAGGGAGGGAGG + Intronic
1022451582 7:30520811-30520833 CAGAGTGGAGAGAGGCAGGAAGG + Intronic
1022625755 7:32034318-32034340 CATAATGGGTAGGGGGAGTGGGG - Intronic
1023006506 7:35875548-35875570 CATACTTGGTAGAGGGAGGTAGG - Intronic
1023352598 7:39335197-39335219 CAGAGTGGTTGCAGGAAGGGAGG - Intronic
1024067709 7:45755415-45755437 CATACTTGGTAGAGGGAGGTAGG + Intergenic
1024266825 7:47613133-47613155 AACACTGGGGAGAGGGAGGGAGG - Intergenic
1024797260 7:53035440-53035462 GAGAAAGGGGAGAGGGAGGGAGG + Intergenic
1024936856 7:54719601-54719623 CAGAGTGGGTAGGGGGAAGTGGG - Intergenic
1024959715 7:54961187-54961209 GAGAGAGGACAGAGGGAGGGAGG + Intergenic
1025934298 7:66022333-66022355 CATAGATGCTAGAGGGAGGGAGG + Intergenic
1026806107 7:73430413-73430435 GGGAGGGGTTAGAGGGAGGGAGG - Intergenic
1026809568 7:73451529-73451551 CAGACTGGGGAGAGGGATGAGGG + Intronic
1027569554 7:79847234-79847256 CAGAGCTGGAAGAGGGATGGAGG - Intergenic
1027815075 7:82958365-82958387 AAGGATGGGGAGAGGGAGGGAGG - Intronic
1028281547 7:88936025-88936047 AAGAGAGGGAAGAGGGAGGGTGG - Intronic
1028420068 7:90622635-90622657 CTAAGTGGGTAGTGGGAGTGTGG + Intronic
1028751858 7:94391856-94391878 GGGAGAGGGGAGAGGGAGGGAGG - Intergenic
1028994629 7:97086162-97086184 CAGGGCAGGTAGAGGGAGGCAGG + Intergenic
1029477785 7:100795164-100795186 CAGAGAGGGTTGTGGGAGGGGGG - Intronic
1029545635 7:101209026-101209048 CAGAATGGGAAGGGGCAGGGAGG + Intronic
1029696576 7:102217580-102217602 CATGGTGTCTAGAGGGAGGGAGG + Intronic
1030086936 7:105824034-105824056 CAGAGTGGATGGACTGAGGGTGG + Intronic
1030829119 7:114198785-114198807 AAGAGTGGGGAGAAGGAGAGAGG + Intronic
1031081782 7:117265128-117265150 GAGAGAGGGAGGAGGGAGGGAGG - Intergenic
1031899408 7:127392753-127392775 CCGAGTGGGTGGGGGGAGTGTGG + Intronic
1032056498 7:128688788-128688810 GACTGTGGGGAGAGGGAGGGGGG - Intergenic
1032675868 7:134129269-134129291 CAGAGTGGAGGGAGGGAGGAAGG - Intronic
1032825205 7:135561944-135561966 CAGCCTGGGCAGAGTGAGGGAGG - Intronic
1032947424 7:136869781-136869803 TGGAGTGGGTGGCGGGAGGGGGG - Intronic
1033246452 7:139720416-139720438 CACAGTGCGTAGATGGAGGTCGG - Intronic
1033444734 7:141410447-141410469 CAGAGGTGGGGGAGGGAGGGAGG - Intronic
1033676817 7:143549616-143549638 GAGAGTGGGTGGAGGGAGAAAGG - Intergenic
1033943233 7:146681496-146681518 AAGGGTGGGGAGTGGGAGGGTGG + Intronic
1034160832 7:148993278-148993300 CACAGTGGGGTCAGGGAGGGTGG + Intergenic
1034347917 7:150398278-150398300 CAGCGTGGGTTGAGGGAGGAGGG + Exonic
1034674262 7:152881192-152881214 CACACTGGGTGGGGGGAGGGGGG + Intergenic
1034892820 7:154855602-154855624 TAGAGTGGGCAGAGGGTGGGTGG - Intronic
1034928516 7:155142097-155142119 GAGAGGGAGAAGAGGGAGGGAGG - Intergenic
1035237656 7:157509164-157509186 GAGAGAGGGGAGAGGGAGAGGGG + Intergenic
1035239903 7:157522809-157522831 TGGAGTGGCAAGAGGGAGGGAGG - Intergenic
1035242864 7:157543496-157543518 CATAGTTGGTGGAGGGATGGAGG + Intronic
1035352912 7:158258983-158259005 CAGCGTCGGTACAGGGAGGCAGG + Intronic
1036425403 8:8641386-8641408 CAGAGTGTGTAGGAGGAGGGAGG - Intergenic
1036561544 8:9903762-9903784 CGGAGGGGGTGGAGGGATGGGGG + Intergenic
1036648433 8:10626225-10626247 CAGAGTGAATAGCGGGAGGATGG + Intronic
1036975389 8:13405291-13405313 CACAGAGGGGAGAAGGAGGGAGG - Intronic
1037710390 8:21350903-21350925 CACAGTGGGAAGGAGGAGGGAGG + Intergenic
1037716812 8:21407904-21407926 CAGAGTGGGGAGGAGGAAGGTGG - Intergenic
1037776242 8:21837810-21837832 TAGGGTGGGCAGAGGGAAGGAGG - Intergenic
1037920641 8:22803085-22803107 GAGAGTGAGGAGAGGCAGGGAGG - Intronic
1038445076 8:27598090-27598112 CAGAGCGGGGAGAGGCTGGGCGG + Exonic
1038650849 8:29402002-29402024 AAGAGAGGGAAGAGGGAGGGAGG - Intergenic
1039335467 8:36584371-36584393 TAGAGTGGAGAGAGGGTGGGGGG - Intergenic
1039494270 8:37968981-37969003 CAGATTGCGTACGGGGAGGGGGG + Intergenic
1039591996 8:38757217-38757239 AAGGGTGGGGCGAGGGAGGGCGG - Intronic
1040103117 8:43522300-43522322 CAGTGTTGGTTGAGGGTGGGGGG + Intergenic
1040362901 8:46684263-46684285 CAGAGTTGGCAAAGGGAGTGGGG + Intergenic
1040517140 8:48144463-48144485 GAGGGTGGGTGGATGGAGGGTGG + Intergenic
1040989628 8:53335917-53335939 CAGAGTAGGCAGATGGGGGGTGG - Intergenic
1041098117 8:54369826-54369848 GAGAGAGGGGGGAGGGAGGGAGG - Intergenic
1041313469 8:56539163-56539185 CAGAATGGGGAGGAGGAGGGAGG + Intergenic
1041457018 8:58072008-58072030 CACAGCAGGCAGAGGGAGGGAGG - Intronic
1041719355 8:60962156-60962178 GAGAGGGGGGAGAGAGAGGGAGG - Intergenic
1041796893 8:61754345-61754367 CAGAGAGGAAAGAGGGAGGAGGG - Intergenic
1042643167 8:70956789-70956811 CAGAGTGGGTGTCGGGAGTGGGG + Intergenic
1042777590 8:72450893-72450915 CAAAGTGGGCAGAGACAGGGTGG + Intergenic
1043398153 8:79858261-79858283 CAGTGTGGTTAGATGGAGAGAGG - Intergenic
1043638342 8:82414830-82414852 TAATGTGAGTAGAGGGAGGGAGG - Intergenic
1044036638 8:87311942-87311964 CAGAGTGGGGAGGGAGAGAGGGG + Intronic
1044119952 8:88382477-88382499 AAGGGAGGGAAGAGGGAGGGAGG - Intergenic
1044221074 8:89670166-89670188 CAGACAGGGGAGAGGGAGAGAGG - Intergenic
1044542260 8:93421048-93421070 CACAGTGGATGGATGGAGGGAGG - Intergenic
1044829189 8:96229383-96229405 CCGGGTGGGTGGAGGGAGGCTGG - Intronic
1044848080 8:96401235-96401257 CACAGGGGTTAGGGGGAGGGAGG + Intergenic
1044900299 8:96936977-96936999 CAGAGAGGGAGGAGAGAGGGAGG - Intronic
1045151092 8:99409090-99409112 CAGAGTGGCTAAATGGAAGGTGG - Intronic
1046417191 8:113933107-113933129 CAGTGTGGTTAGAGGGTGTGTGG - Intergenic
1046539055 8:115555568-115555590 CAGAGGGGGTTGATGAAGGGAGG + Intronic
1046709413 8:117493032-117493054 GACAGAGGGTAGAAGGAGGGAGG - Intergenic
1046719982 8:117608439-117608461 GAGGGAGGGAAGAGGGAGGGAGG - Intergenic
1047670018 8:127135953-127135975 CAGAGTGAGAAGAGGGCTGGAGG - Intergenic
1047690328 8:127345858-127345880 CCAAGTGGGTGGAGGGAGGAAGG - Intergenic
1048346029 8:133575206-133575228 CAGAGCGGAGAGGGGGAGGGGGG - Intergenic
1048383128 8:133885878-133885900 GAGAGAGGGTAGGGGGAGAGAGG + Intergenic
1048529613 8:135235470-135235492 CACAGTTGGTACAGGGAGGAGGG - Intergenic
1048550904 8:135432917-135432939 CAGCCTTGGGAGAGGGAGGGAGG + Intergenic
1049319510 8:141988532-141988554 GAGAGTGGGAAAGGGGAGGGAGG - Intergenic
1049320171 8:141992068-141992090 GAGAGTGGGTGGAGTGAGTGAGG - Intergenic
1049370331 8:142261272-142261294 GAGAGAGGATAGAGGGAGGGAGG + Intronic
1049370348 8:142261324-142261346 GAGAGAGGGAGGAGGGAGGGAGG + Intronic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049501693 8:142970852-142970874 CAGAGAGGGCAGAGGGGTGGAGG + Intergenic
1049501718 8:142970924-142970946 CAGAGAGGGCAGAGGGGTGGAGG + Intergenic
1049610743 8:143553638-143553660 CAGCCTGGGAGGAGGGAGGGAGG - Exonic
1049616013 8:143576046-143576068 ATGAGTGGGTAGGCGGAGGGTGG - Intronic
1049760386 8:144329495-144329517 TAGAGTGGGTGGAAGGATGGAGG - Intergenic
1049975786 9:860448-860470 CAGAGTAAGAAGAGTGAGGGAGG - Intronic
1050010521 9:1181490-1181512 CAGAGTGGGTAGAGCGGAGATGG - Intergenic
1050287024 9:4114127-4114149 CAGAGTGAGTAGAGGGACCCAGG - Intronic
1051014966 9:12463207-12463229 GAGAGAGGGAAGAGGGAGGGAGG - Intergenic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1051691982 9:19724516-19724538 GAGTGTGGGTAGAGGTTGGGAGG + Intronic
1051897774 9:22006261-22006283 CAGAGTGGTCAGAGCCAGGGTGG + Intronic
1052821225 9:33139182-33139204 AGGAGTGGGTTGAGGTAGGGAGG + Intronic
1053152845 9:35753941-35753963 CAGAGAGGGCACAGGGAGGATGG - Exonic
1053199974 9:36145665-36145687 ATGGGTGGGTAGATGGAGGGAGG + Intronic
1053299220 9:36936741-36936763 CAGGGTGGGGACAGGGAGGTGGG + Intronic
1054975779 9:71143330-71143352 GAGAGTGGGGAGTGGGAGGAGGG - Intronic
1055381325 9:75710102-75710124 GAGAGAGAGGAGAGGGAGGGAGG - Intergenic
1055430761 9:76241110-76241132 GTTTGTGGGTAGAGGGAGGGGGG + Intronic
1055496894 9:76864293-76864315 CAGAGGGGGTAGCAGGAAGGAGG + Intronic
1055913211 9:81374487-81374509 AGGAGTGGATAGAGGGAGGCAGG + Intergenic
1055934132 9:81589298-81589320 GAGAGAGGGCAGAGGGATGGGGG - Intronic
1056367274 9:85918263-85918285 GAGAGAGGGGAGAGGGAGGAAGG - Intergenic
1056531821 9:87495107-87495129 TAGAGTGGGTGGAGGGGGAGAGG + Intergenic
1056587830 9:87939871-87939893 CAGGGTGGGGAGCGGGAGGGAGG + Intergenic
1056609037 9:88113074-88113096 CAGGGTGGGGAGCGGGAGGGAGG - Intergenic
1056794932 9:89651712-89651734 GGGAGTGGGAAGAGGCAGGGAGG + Intergenic
1056914210 9:90730631-90730653 CTGAGTGGGGACAGGGAAGGGGG - Intergenic
1057197005 9:93120911-93120933 CAGAATGGGTAGTGGGGGGTTGG + Intergenic
1057202667 9:93151102-93151124 GGGAGTAGGGAGAGGGAGGGAGG + Intergenic
1057294564 9:93827717-93827739 CAGAGAGGGCAGAGGCACGGTGG - Intergenic
1057483370 9:95462987-95463009 AAGGGTGGGTGGGGGGAGGGGGG - Intronic
1057519875 9:95752144-95752166 CTGAGAGGGCAGCGGGAGGGGGG - Intergenic
1057694018 9:97310951-97310973 CAGAGTGTCTAGAGGGAGCTGGG - Intronic
1057696483 9:97326377-97326399 TATAGTGGAGAGAGGGAGGGTGG + Intronic
1057791422 9:98127459-98127481 CAGAGTGGGCAGAGGGACCTGGG + Intronic
1058078559 9:100676171-100676193 CAGAGTTGGAAGAAGGAGGTGGG + Intergenic
1058198084 9:102003352-102003374 CAGTGTGTGTTGGGGGAGGGTGG - Intergenic
1058748201 9:108012726-108012748 CAGAGTGGGTTAAGTGAAGGAGG - Intergenic
1059086710 9:111310889-111310911 GAGAGGGGGAGGAGGGAGGGAGG - Intergenic
1059309919 9:113381282-113381304 GAGAGAGAGAAGAGGGAGGGAGG - Intergenic
1059668458 9:116471598-116471620 TAAAGGGGGTGGAGGGAGGGGGG + Intronic
1059764043 9:117366548-117366570 CAGAGGAGTTAGAGAGAGGGGGG - Intronic
1059821926 9:117983138-117983160 GAGAGAGGGGGGAGGGAGGGAGG + Intergenic
1059866331 9:118518650-118518672 AAGAGAGGGTAGGGGTAGGGTGG - Intergenic
1059990636 9:119862055-119862077 CAGTGTGGGTAGAGGCAGCTGGG - Intergenic
1060191316 9:121594899-121594921 CTGACTGGGTAGAGATAGGGAGG + Intronic
1060301227 9:122375656-122375678 GAGAGTGGGAGGAGGGAGTGTGG + Intronic
1060351603 9:122866375-122866397 GACCGTGGGGAGAGGGAGGGGGG - Intronic
1060395313 9:123312444-123312466 GAGGGAGGGGAGAGGGAGGGAGG + Intergenic
1060967976 9:127722223-127722245 AGGTGTGGGTGGAGGGAGGGAGG - Intronic
1061182670 9:129034300-129034322 CAGAGTGGCTAAAGGGAGTCGGG - Intergenic
1061281686 9:129601350-129601372 CAGAGGGGGAAGAAGGAGAGAGG + Intergenic
1061287670 9:129633368-129633390 CAGAGAGGGAACATGGAGGGAGG - Intronic
1061369140 9:130188004-130188026 CAAAGTGGGGAGATGGGGGGTGG + Intronic
1061450655 9:130665307-130665329 GGGAGGGGGTGGAGGGAGGGCGG + Intronic
1061625567 9:131838936-131838958 CAGGGTGTGGAGAGGGAGAGGGG + Intergenic
1061804680 9:133131351-133131373 CAGGGTGAGTACAGGGAGGTAGG - Intronic
1061806973 9:133142139-133142161 CAGAGTGGGGAGATGGGGAGGGG + Intronic
1061881782 9:133572454-133572476 GAGAGTGGGAAGGGGCAGGGAGG + Intronic
1061911776 9:133728836-133728858 ATGAGTGGCTAGAGGGAGGGAGG + Intronic
1061954641 9:133955420-133955442 GAGAGTGGGGAGAAGCAGGGGGG - Intronic
1062143988 9:134978884-134978906 GAGGGAGGATAGAGGGAGGGAGG + Intergenic
1062192718 9:135256086-135256108 AAGAGGGGGCAGCGGGAGGGGGG - Intergenic
1062215301 9:135385894-135385916 CAGGGTGGGCACGGGGAGGGTGG - Intergenic
1062542910 9:137049423-137049445 CAGACTGGGGTGAGGGAGGTGGG - Intronic
1062629312 9:137456600-137456622 CAGGGCGGGTGGGGGGAGGGTGG + Intronic
1062697947 9:137884959-137884981 CAAAGTGGGAGGAGGGGGGGGGG - Intronic
1185599286 X:1327857-1327879 CACGGTGGGTGGAGGGTGGGGGG + Intergenic
1185918915 X:4067246-4067268 GAGAGAGGGGGGAGGGAGGGAGG - Intergenic
1186250450 X:7660331-7660353 CAGTGGTGGGAGAGGGAGGGTGG + Intergenic
1186530777 X:10293095-10293117 CAGTGTGGGAAGAGGGTGAGAGG + Intergenic
1186636066 X:11406255-11406277 CAGAGTGGGTACTGGGATGGGGG + Intronic
1186722662 X:12322391-12322413 CAGAGTGGATATATGGAGAGGGG + Intronic
1186730713 X:12406514-12406536 CAGAGTGGTTGGAGGGAGAGAGG - Intronic
1187752311 X:22479869-22479891 GAATTTGGGTAGAGGGAGGGAGG + Intergenic
1188004855 X:25010226-25010248 AACAGAGGGAAGAGGGAGGGAGG - Intronic
1188590865 X:31833334-31833356 GAGAGAGTGGAGAGGGAGGGAGG + Intronic
1188955537 X:36431596-36431618 GTGTGTGGGTAGAGGGAGGGAGG + Intergenic
1189023838 X:37370797-37370819 CAGAGTGGGTACCAGGAGTGGGG - Intronic
1189122313 X:38407870-38407892 GAGTGAGGGTAGAGGCAGGGAGG + Intronic
1189667351 X:43370952-43370974 CAGAGAGTGGGGAGGGAGGGAGG + Intergenic
1190792853 X:53716153-53716175 CTGAGTGGGTAGAGGTGGGGAGG - Intergenic
1190888985 X:54552610-54552632 CAGGGCGGGTTGGGGGAGGGTGG + Intronic
1190914523 X:54800698-54800720 CAGAGTTGCTAGAGTGATGGAGG - Intergenic
1191101608 X:56735566-56735588 CCGGGTGGGTGGAGGGAGGCTGG - Intergenic
1191129168 X:56989956-56989978 CAGGGTGGGTGAGGGGAGGGGGG - Intronic
1191933352 X:66398915-66398937 ATGAGAGGGTAGAGGGTGGGAGG - Intergenic
1192182534 X:68925293-68925315 CAGGGTGGGTGGGGGGAGGGGGG - Intergenic
1192495840 X:71616286-71616308 CAGAGCCGGCAGAGGGAGGGAGG + Exonic
1192668428 X:73112635-73112657 CACACTGGGTAGGGGGAGAGGGG - Intergenic
1192916126 X:75652741-75652763 GAGAGTGAGTAGAAGCAGGGTGG - Intergenic
1193119069 X:77804895-77804917 GTGAGAGGGTAGAAGGAGGGAGG - Intergenic
1195063624 X:101219724-101219746 GAGAGGGGGAAGAGGGAGAGAGG - Intergenic
1195429887 X:104777211-104777233 ACCAGTGGGTAGGGGGAGGGTGG - Intronic
1195831627 X:109065723-109065745 GAGAGTGGGTGGTGGGAGGAAGG + Intergenic
1196025952 X:111041586-111041608 CACAGGGGGTACAGTGAGGGAGG - Intronic
1196738390 X:119001215-119001237 GAGAGAGGAGAGAGGGAGGGAGG + Intronic
1196812535 X:119640148-119640170 AAGACTGGATAGTGGGAGGGTGG - Intronic
1196858150 X:120002437-120002459 CAGAGTGGGCAAAGTGAGTGGGG - Intergenic
1197054859 X:122105302-122105324 CAGAGTGGGTGGGGGGACTGGGG + Intergenic
1197393329 X:125895533-125895555 CAGGGTGGGTAGAGAAAGGTAGG + Intergenic
1197492881 X:127140294-127140316 CCTGGTGGGTAGTGGGAGGGGGG - Intergenic
1197800590 X:130343674-130343696 CAGACTGGGCAATGGGAGGGAGG + Intronic
1197812228 X:130455509-130455531 CAAAGGGGGCAGGGGGAGGGGGG - Intergenic
1197847949 X:130823723-130823745 CAGAGAGGGAAGAGGGAGTGAGG - Intronic
1197892337 X:131279556-131279578 CGGAGTGGGGAGGGGGCGGGGGG - Intronic
1199613246 X:149635176-149635198 CTGAGAGAGAAGAGGGAGGGAGG + Intergenic
1199716338 X:150509567-150509589 CAGAGTATGTAGAAGGAGGGAGG - Intronic
1200136805 X:153879205-153879227 CAGAGTGAGAAGAGGCAGGGGGG + Intronic
1200169251 X:154060539-154060561 AGGGGTGGGGAGAGGGAGGGAGG + Intronic
1201144719 Y:11057975-11057997 ATGAGTGGATGGAGGGAGGGAGG + Intergenic