ID: 1084942465

View in Genome Browser
Species Human (GRCh38)
Location 11:72620316-72620338
Sequence AGGGGCCTTCTCCTGGGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 350}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084942465_1084942479 23 Left 1084942465 11:72620316-72620338 CCAAGGCCCAGGAGAAGGCCCCT 0: 1
1: 0
2: 4
3: 46
4: 350
Right 1084942479 11:72620362-72620384 CAGAGCTGGGATGCAGAGCTAGG 0: 1
1: 0
2: 13
3: 133
4: 928
1084942465_1084942477 10 Left 1084942465 11:72620316-72620338 CCAAGGCCCAGGAGAAGGCCCCT 0: 1
1: 0
2: 4
3: 46
4: 350
Right 1084942477 11:72620349-72620371 AAGGGGGACTGACCAGAGCTGGG 0: 1
1: 0
2: 1
3: 26
4: 218
1084942465_1084942468 -9 Left 1084942465 11:72620316-72620338 CCAAGGCCCAGGAGAAGGCCCCT 0: 1
1: 0
2: 4
3: 46
4: 350
Right 1084942468 11:72620330-72620352 AAGGCCCCTCAGAAGCCACAAGG 0: 1
1: 1
2: 1
3: 23
4: 244
1084942465_1084942470 -7 Left 1084942465 11:72620316-72620338 CCAAGGCCCAGGAGAAGGCCCCT 0: 1
1: 0
2: 4
3: 46
4: 350
Right 1084942470 11:72620332-72620354 GGCCCCTCAGAAGCCACAAGGGG 0: 1
1: 0
2: 1
3: 18
4: 228
1084942465_1084942476 9 Left 1084942465 11:72620316-72620338 CCAAGGCCCAGGAGAAGGCCCCT 0: 1
1: 0
2: 4
3: 46
4: 350
Right 1084942476 11:72620348-72620370 CAAGGGGGACTGACCAGAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 180
1084942465_1084942469 -8 Left 1084942465 11:72620316-72620338 CCAAGGCCCAGGAGAAGGCCCCT 0: 1
1: 0
2: 4
3: 46
4: 350
Right 1084942469 11:72620331-72620353 AGGCCCCTCAGAAGCCACAAGGG 0: 1
1: 0
2: 0
3: 23
4: 190
1084942465_1084942471 -6 Left 1084942465 11:72620316-72620338 CCAAGGCCCAGGAGAAGGCCCCT 0: 1
1: 0
2: 4
3: 46
4: 350
Right 1084942471 11:72620333-72620355 GCCCCTCAGAAGCCACAAGGGGG 0: 1
1: 0
2: 2
3: 16
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084942465 Original CRISPR AGGGGCCTTCTCCTGGGCCT TGG (reversed) Intronic
900176297 1:1292908-1292930 AGGCACCTTCTCCTGGTACTCGG - Exonic
902241055 1:15089518-15089540 GGGGCCCCTCTCCTGGGGCTTGG - Intronic
902379029 1:16043984-16044006 TGGGATCTTCTTCTGGGCCTGGG + Intronic
902522047 1:17024469-17024491 AGGGCCCTTCTGCTGAGCCCAGG - Intronic
902827821 1:18989154-18989176 AGGGGCCTTCTAATGGGCCCCGG - Intergenic
903224683 1:21887866-21887888 AGGGTCCTACACCTGGGTCTTGG - Intronic
904613779 1:31739038-31739060 TTAGGCCTTCCCCTGGGCCTTGG - Intronic
905629620 1:39511362-39511384 AGGTGCCTTCCCCTTGGCCCGGG + Exonic
905668139 1:39774828-39774850 AGGTGCCTTCCCCTTGGCCCGGG - Exonic
907557692 1:55359069-55359091 ACGGCCCTTCTCTTGGGACTTGG + Intergenic
907927418 1:58967479-58967501 AGGGGCATGCTCCTGAGGCTGGG + Intergenic
908169088 1:61487222-61487244 TGGGGCCTGCCCCTGGGCCTGGG - Intergenic
909571727 1:77120309-77120331 TGGGACTATCTCCTGGGCCTGGG - Intronic
912490696 1:110061103-110061125 AGGGGCTTTCTCTTTGTCCTTGG + Intronic
912508413 1:110172255-110172277 AGGGGGCTGCTCCTGGGCATTGG + Intronic
912551177 1:110486401-110486423 AGGAGCCTACACCTGGGTCTTGG + Intergenic
915457602 1:156051144-156051166 GGGGGCCCTCTCCGGGGGCTGGG - Exonic
918289444 1:183092623-183092645 AGGGGCCTTCTAGAGCGCCTGGG + Intronic
919854487 1:201696009-201696031 AGCGGCTTGCTCCTGGGCATCGG + Intronic
921325775 1:213985324-213985346 TGCGGCATTCTCCTGGGTCTCGG - Intronic
921363658 1:214353721-214353743 ATGGGCCATCTCCTGGGACATGG - Exonic
922467396 1:225853608-225853630 AGGTGCCATCCCCTGGGCCCAGG - Exonic
923031098 1:230249573-230249595 AAGCCCCTTTTCCTGGGCCTGGG - Intronic
924246462 1:242090613-242090635 AGGGGCCGGATCCTGGGTCTGGG - Intronic
1063017944 10:2096744-2096766 TGGGGCTTTCTCCTGAACCTTGG - Intergenic
1063378835 10:5571631-5571653 AGGGGCCTGGCGCTGGGCCTGGG - Intergenic
1065544660 10:26807387-26807409 AGGAGGCTTCACCTGAGCCTAGG + Intronic
1067269069 10:44773915-44773937 AGGCGCCTTCCCCAGGCCCTCGG + Intergenic
1067720354 10:48723355-48723377 AGGGGCCTGATCCTGGGTCTGGG + Intronic
1067944765 10:50682773-50682795 AGCAGCTTTCTCCTGGGACTGGG + Intergenic
1068705683 10:60072880-60072902 GGGTGCCTTCTCCTCGGCCTTGG + Exonic
1068856427 10:61802535-61802557 AGTGTCCTTCTCCAGGGCCGAGG - Intergenic
1069419781 10:68236781-68236803 GGGGGCCTTGTCCCAGGCCTCGG + Intergenic
1069660976 10:70123348-70123370 AAGGGCCCTCTGCAGGGCCTGGG - Intronic
1070161450 10:73868955-73868977 AGGGGCCTCGTTCTGGGCCTCGG - Intronic
1070880061 10:79847775-79847797 AGCAGCTTTCTCCTGGGACTGGG + Intronic
1071633173 10:87231865-87231887 AGCAGCTTTCTCCTGGGACTGGG + Intronic
1071646622 10:87364083-87364105 AGCAGCTTTCTCCTGGGACTGGG + Intronic
1072277588 10:93838234-93838256 AGGGCCCTTGTCCTGGACCCTGG + Intergenic
1072286534 10:93921095-93921117 AGGATCCTTCACGTGGGCCTGGG + Intronic
1073138725 10:101233968-101233990 AGCGGCCTCCTCCCAGGCCTGGG + Intergenic
1073435230 10:103512280-103512302 AGGGGCTTTCTCTTGGGAGTGGG + Intronic
1074379845 10:112970403-112970425 AGGACCCTCCTCCAGGGCCTGGG + Intronic
1074668719 10:115762152-115762174 AAGAGCCTTCTGCTGGGGCTGGG - Intronic
1074956908 10:118399962-118399984 AGGTGCCTTATCATGGCCCTAGG + Intergenic
1075683441 10:124348284-124348306 GGAGGCCTTGCCCTGGGCCTGGG - Intergenic
1075702654 10:124479197-124479219 AGGGGCCTTCTGCAGGGTCCTGG - Intronic
1075709188 10:124521601-124521623 GGTGGCCTTGTCCTGGGCCCAGG + Intronic
1075800812 10:125152194-125152216 AGGGGGCTTCACCTGGGGCTCGG + Intronic
1076348951 10:129801681-129801703 AGGGGCCTGGTCCTGCCCCTGGG + Intergenic
1076404740 10:130204079-130204101 CGAGGACTTCCCCTGGGCCTGGG + Intergenic
1076473681 10:130737652-130737674 TGGGGCCTTCTCCTTGGCAGTGG - Intergenic
1076589695 10:131574633-131574655 AGGGCACATCTGCTGGGCCTCGG + Intergenic
1076794966 10:132794011-132794033 AGGAGCCTGCTCCGGCGCCTTGG + Intergenic
1076903988 10:133353224-133353246 AAAGGCCATGTCCTGGGCCTGGG - Intergenic
1076904251 10:133354468-133354490 AGGGGCTTCCCCCAGGGCCTGGG - Intergenic
1077032173 11:473518-473540 AGGGACCTTCTCCTGGCCACTGG + Intronic
1077151637 11:1075479-1075501 TCGGGCCCTCTGCTGGGCCTTGG - Intergenic
1077288457 11:1778015-1778037 AGGGGCCCTCCCCTGGCCCCAGG + Intergenic
1077375161 11:2202288-2202310 AGGCTCCTTCACCTGGCCCTGGG + Intergenic
1077424106 11:2466423-2466445 GGGGGTCCCCTCCTGGGCCTGGG + Intronic
1078153183 11:8776327-8776349 GGGGACCTTGGCCTGGGCCTTGG - Intronic
1078514749 11:12012107-12012129 AGGGGGCCACTGCTGGGCCTTGG - Intergenic
1078727267 11:13942851-13942873 ATGGCCCTTCTCATGGGCCAGGG - Intergenic
1079110456 11:17602366-17602388 ATGGGCCTTACCATGGGCCTTGG - Exonic
1079249783 11:18779034-18779056 AGGCTCCTTCTCATGGGGCTGGG + Intronic
1080458155 11:32433455-32433477 AGAGCCCTTCTCCCGAGCCTTGG + Intronic
1081814320 11:45929996-45930018 AGGTGCATTTTCCAGGGCCTGGG - Intronic
1082162418 11:48900299-48900321 CGGGCCCTTCTCCTGCACCTTGG + Intergenic
1084119163 11:67058957-67058979 AGGTGCCTTCCCCTGGGCCTGGG - Intronic
1084657458 11:70527723-70527745 AGGGGCCTTCTCCATGACCTCGG - Intronic
1084942465 11:72620316-72620338 AGGGGCCTTCTCCTGGGCCTTGG - Intronic
1085290425 11:75395309-75395331 ATGGACTTTCTCCTGGGACTAGG + Intergenic
1085743837 11:79098340-79098362 AGGGCCCTTCTCCTGACCCCTGG + Intronic
1086813078 11:91335178-91335200 AAGGGCCTTCCCCTGTGACTTGG - Intergenic
1089282299 11:117382849-117382871 AGGGCCCAGCTCCTCGGCCTGGG - Exonic
1090078312 11:123593431-123593453 AGGGGGCTTCTCTCTGGCCTTGG + Intronic
1091611215 12:2011341-2011363 AGGAGCCTTGTCCTGGGACATGG + Intronic
1091843478 12:3637020-3637042 AGGGGCCTATTCCGAGGCCTGGG + Intronic
1095977100 12:47947253-47947275 AGAGTCTTTCTCCTTGGCCTGGG + Intergenic
1096586896 12:52628747-52628769 AGGGGCTTTCTTCTGGGGCCTGG + Intergenic
1096656501 12:53095947-53095969 AGGGTCTTTCTCCTGGACTTCGG - Intergenic
1096817763 12:54212419-54212441 ATGGACCTTCTCTTGGTCCTAGG - Intergenic
1097107505 12:56634362-56634384 AGGACTCTCCTCCTGGGCCTAGG - Intronic
1101424479 12:104576644-104576666 TGCAGCCTTCTCCTGGGCTTTGG - Intronic
1101645760 12:106629571-106629593 AGGAGCCATCACCTGAGCCTGGG - Intronic
1102008824 12:109605917-109605939 CGGGGGCTTCTCATGGGTCTGGG - Intergenic
1102823510 12:115927357-115927379 TGGGCCCTTTTCCTGGGCCAGGG - Intergenic
1102956316 12:117061373-117061395 AGGTGCCTTCCCCAGGGCCCAGG + Intronic
1104049109 12:125184640-125184662 AGGGGGCTTGGCCTGGGCATGGG + Intergenic
1104105950 12:125659432-125659454 AGGGGCTTTGTACTGGGCCCAGG + Exonic
1104852422 12:131883592-131883614 AGGAGCCTGCTCCAGGGCCAAGG - Intergenic
1105014666 12:132778980-132779002 TGGGGCCTGCTGCTGGGCCGTGG - Intronic
1107402779 13:40085716-40085738 AGGGGCAATCTCTTGGTCCTGGG + Intergenic
1107460028 13:40593114-40593136 TGGGGCCATCACCTGAGCCTGGG - Intronic
1108519500 13:51233657-51233679 AGGGGCCTTCTCCTGAAAGTAGG - Intronic
1110887197 13:80654934-80654956 AGGAGCGTTCTCCTGGGCGTCGG - Intergenic
1112508357 13:99988910-99988932 AGGAGCCTGGGCCTGGGCCTGGG + Intergenic
1113095974 13:106664013-106664035 CAGGCCCTTCTCCTGGGCATGGG - Intergenic
1113925533 13:113939593-113939615 AGCCGCCTCCTCCTGGGCTTTGG + Intergenic
1118592210 14:67410246-67410268 GGAGGCCTTCTCCTGTTCCTGGG - Intronic
1119214355 14:72857030-72857052 AGGGACCTCCTCCAGGCCCTTGG - Intronic
1121382170 14:93482218-93482240 AGAGGCCATCTGCTGGGGCTTGG + Intronic
1121413203 14:93762055-93762077 AGGGGCCTTGCCCTGGGCCAGGG + Intronic
1121846040 14:97173238-97173260 AGGCCTCTCCTCCTGGGCCTGGG - Intergenic
1122111044 14:99502872-99502894 GGGGTCCTTCTGCTGGGGCTGGG - Exonic
1122183926 14:99975006-99975028 GGGGACCTACTCCTTGGCCTTGG + Intronic
1122270507 14:100566824-100566846 CAGGGCCATCTCCTGGGCCATGG - Intronic
1122295300 14:100702121-100702143 GGGGTCCTTCTCCTGGGGCAGGG + Intergenic
1122903093 14:104790008-104790030 AGGCTCCTTCTCCTGCTCCTTGG - Intronic
1123182009 14:106480231-106480253 AAGGGCCTTCTCGCGGGCGTCGG + Intergenic
1202904547 14_GL000194v1_random:60645-60667 AGAGGCCTTCCCCTTGGCTTAGG - Intergenic
1202944896 14_KI270726v1_random:16499-16521 AAGGGCCTTCTCGCGGGCGTCGG - Intergenic
1124165222 15:27320125-27320147 AGAAGCCTTCTCCCAGGCCTTGG + Intronic
1124609871 15:31201063-31201085 GGGGTGCTTGTCCTGGGCCTCGG + Intergenic
1124652252 15:31482770-31482792 ACCCGCCTTCTCCTAGGCCTCGG + Exonic
1127473912 15:59314498-59314520 AGAGGCCTTCTCCTGTGACCAGG - Intronic
1127905720 15:63374333-63374355 GAGGGCTTTCACCTGGGCCTTGG - Intronic
1128016894 15:64355891-64355913 GGGGGCCCTTTCCTGGGCGTGGG - Intronic
1128283516 15:66417005-66417027 AAGGGCCTGCTCCTCAGCCTTGG - Intronic
1128842336 15:70860207-70860229 AGCGGCCTCCTCCAGGGCCCTGG - Intronic
1129454673 15:75670361-75670383 TGGGGCCTTCACCTGGGCTTTGG + Intergenic
1130649798 15:85756072-85756094 AGGGGCCTTGCTCTGGCCCTGGG - Intergenic
1130964233 15:88685414-88685436 AGGGGCCTGGACCTGGGCCTTGG + Intergenic
1131226553 15:90628900-90628922 AGGGTCCTTTCCCTGGGTCTGGG + Intronic
1131462745 15:92630176-92630198 AGAGGCTTCCTCCTGGGCTTGGG - Intronic
1132573343 16:653565-653587 AGGGGCCCTTGCCTGGGCCGAGG - Exonic
1132665225 16:1078427-1078449 AGGGGCCGCCCGCTGGGCCTCGG + Intergenic
1132854283 16:2037890-2037912 TCGAGCCTTCTCCTTGGCCTCGG - Exonic
1132878402 16:2150250-2150272 AGGGACCATATCCTGTGCCTTGG + Intronic
1133000166 16:2846486-2846508 AGGGACTTTCTCCTATGCCTGGG - Intergenic
1133277118 16:4645751-4645773 AGTGGCCTTGTCTGGGGCCTCGG + Intronic
1134032601 16:11004474-11004496 TGAGCCCTCCTCCTGGGCCTTGG + Intronic
1134266007 16:12693123-12693145 AGGTGCCTTCTCCAGGTCTTCGG - Intronic
1134746149 16:16590298-16590320 AGAGGCCGCCTCCTGGGACTGGG + Intergenic
1134999331 16:18763402-18763424 AGAGGCCGCCTCCTGGGACTGGG - Intergenic
1135691368 16:24540057-24540079 GGGGGCCTGGGCCTGGGCCTGGG + Intronic
1136142645 16:28297402-28297424 AGGGGCCTGCTGCTGGCCCCTGG - Intronic
1136179209 16:28539271-28539293 CGAGGGCTTCACCTGGGCCTGGG + Intergenic
1136394889 16:29987387-29987409 ATGGGTGTTCCCCTGGGCCTTGG + Exonic
1136577996 16:31135495-31135517 GGGGCCCTTGTCCTGGGCCATGG - Exonic
1136933361 16:34437341-34437363 GGGAGGCTTCTCCTTGGCCTTGG - Intergenic
1136971211 16:34974473-34974495 GGGAGGCTTCTCCTTGGCCTTGG + Intergenic
1137548785 16:49422398-49422420 TGGAGCCTTCACCTGGGTCTTGG + Intergenic
1138554105 16:57762196-57762218 AGACGCCTTCTCCTGCACCTCGG + Exonic
1141630323 16:85284141-85284163 CCGGGCCTTCTCCTGGGCCGGGG - Intergenic
1142228071 16:88887061-88887083 AGTGGCCTGCTGCTGGGCCCTGG - Intronic
1142753968 17:2004653-2004675 AGGGGACTTCTCCCTGGCCCTGG + Intronic
1143394180 17:6578990-6579012 CCAGGCCTTCTCCTGTGCCTGGG - Exonic
1143784802 17:9248218-9248240 AGAGCCCTTGTCCTGGGCCCTGG + Intergenic
1144640208 17:16932685-16932707 AGGAGCCTACTCCTGGTCCAGGG - Intronic
1144662726 17:17081689-17081711 CGGGGACTTCTGCTGGGGCTGGG + Intronic
1145058312 17:19717138-19717160 AGGGGCCTGGGCCTGGGCCTGGG + Intronic
1146004381 17:29151624-29151646 AGGGGCTTTCTCCCAGGCCTGGG - Intronic
1146223944 17:31049906-31049928 TGGGGCCTCCTGCTGGGCTTGGG + Intergenic
1146341381 17:32022234-32022256 TGGGGCCTCCTGCTGGGCTTGGG - Exonic
1146659083 17:34652742-34652764 AGGGGCCTTATGCTGGTGCTGGG - Intergenic
1146794835 17:35773680-35773702 TGGGGGCTTCTCCTGGGCAGAGG - Intronic
1147232516 17:39029661-39029683 TGGGGCCTCCTGCTGGGCTTTGG - Intergenic
1147265325 17:39231259-39231281 GGGGGCCTTCTCCAGCCCCTGGG - Intergenic
1147721860 17:42544323-42544345 TGGGGCCTCCTCCCAGGCCTGGG - Exonic
1147911581 17:43859203-43859225 AGGGTCTTTCTCCTGAGTCTGGG - Intronic
1147922307 17:43925450-43925472 TGGGGCCTCCTGCTGGGCTTGGG + Intergenic
1149966627 17:61170911-61170933 AGTGGCTCTTTCCTGGGCCTTGG - Intronic
1150141823 17:62736752-62736774 AGCGGCCTTCTGCTGGGCAAAGG - Exonic
1150280259 17:63925956-63925978 AGAGGCCTCCTACTAGGCCTTGG + Intergenic
1151187036 17:72372073-72372095 AGTGGCTTTCTCCTGGGGCTGGG + Intergenic
1151539938 17:74759684-74759706 AGGGGCTCTCTCCAGGGCATCGG - Intronic
1152019210 17:77771718-77771740 AGGGGCCCTCTCAGGGGCCTGGG + Intergenic
1152070267 17:78130814-78130836 AGGGGACTCCTCCAGGGACTTGG + Exonic
1152813138 17:82391667-82391689 ATGGGCCTTCTGCTGGGTCGAGG - Intronic
1152880032 17:82809232-82809254 CGGGGCCATCTCCAGGGACTTGG + Intronic
1152944600 17:83192126-83192148 AGGGGGCTCCTTCTTGGCCTGGG - Intergenic
1153931908 18:9886652-9886674 AAAGGCCTTCTCTTTGGCCTGGG - Exonic
1154129532 18:11724810-11724832 CTTGGCCTGCTCCTGGGCCTTGG - Intronic
1154344819 18:13532882-13532904 AGGGGCCCTGTCCTGGGCAGGGG + Intronic
1155272983 18:24158744-24158766 AGGGCCCATCTTCTGGGACTTGG + Intronic
1156001129 18:32385445-32385467 AGGGGACAGCTGCTGGGCCTAGG - Intronic
1157497524 18:48166937-48166959 AGAGGCCTCTTCCTGGGGCTGGG - Intronic
1158820035 18:61148763-61148785 AGGGGCATTCACATGGGCTTTGG + Intergenic
1159819682 18:73124414-73124436 AGGAGCCTTCTCCTGGTACATGG + Intergenic
1159897678 18:74012354-74012376 AGAGGCCTGGGCCTGGGCCTGGG + Intergenic
1159954246 18:74508109-74508131 CGTGGCCTTCTCGTGGGCCTGGG - Intronic
1161042449 19:2117233-2117255 TGGAACCTTCTTCTGGGCCTTGG + Exonic
1161456795 19:4373670-4373692 AGGGGCAGTCCCTTGGGCCTGGG + Intronic
1161795103 19:6381816-6381838 CGGCGCCTTCTTCTTGGCCTTGG + Exonic
1161899713 19:7109437-7109459 TGGAGCTTCCTCCTGGGCCTTGG - Intergenic
1162420056 19:10561063-10561085 GTCGGCCTCCTCCTGGGCCTGGG + Exonic
1162806549 19:13140428-13140450 GGGGGCCAGCTCCTGGGCCTGGG + Exonic
1162875268 19:13616746-13616768 AAGGGCCTTTTCCTCTGCCTTGG - Intronic
1162959633 19:14118142-14118164 CGGGGCCGCCTCCTGAGCCTCGG - Intergenic
1163400166 19:17087287-17087309 AGGGACTTTCTCCAGGGCGTGGG + Intronic
1164444841 19:28308174-28308196 AGGTGCCTCCACCTGGCCCTTGG + Intergenic
1164835900 19:31354888-31354910 AGGGGGCTTCTCTTGGCCCAAGG + Intergenic
1166195287 19:41201904-41201926 AGGTGCCTTATCCTGAGCCATGG + Intronic
1166741490 19:45117404-45117426 GGGGGCCTTGTCCTGGGCTGAGG + Intronic
1166741917 19:45119709-45119731 AGTGGTCTGATCCTGGGCCTGGG - Intronic
1166862920 19:45820045-45820067 AGGCCCTTTCTCCTGGGCCAAGG + Intronic
1167386743 19:49168114-49168136 GGGGGCTGTCTCCTGGGCCTCGG + Intronic
1168268237 19:55234965-55234987 AAGGTCCTGCTCCTGGGTCTGGG + Intronic
1168311506 19:55463293-55463315 AGGGGTCTCCTCCTGGGCCCAGG - Intergenic
924961162 2:35747-35769 AGGGGTCCCCTTCTGGGCCTTGG + Intergenic
925717373 2:6796761-6796783 AGGGGCCTTCTCTTATGCCTGGG + Intergenic
927454423 2:23237415-23237437 AGAGGTCCTCTCCTGGGCCGAGG - Intergenic
927505978 2:23615162-23615184 CCAGGCCTTCTCCTGGGCTTCGG + Intronic
927510164 2:23639380-23639402 AGGGGGCTTCTGCAGGCCCTGGG - Intronic
928435315 2:31251127-31251149 AGTGGCCTGCACCTGGGCCAAGG - Intronic
928445855 2:31332835-31332857 AAGGGCAGGCTCCTGGGCCTGGG + Intergenic
928674406 2:33636259-33636281 AGGGGCCTCTTCCTGGACCTAGG + Intergenic
929480348 2:42300665-42300687 AGAGGCCTTCTGCTGTGCCAAGG - Intronic
930717712 2:54608408-54608430 ATGGGCCTTGGCCTGAGCCTTGG + Intronic
930724283 2:54667430-54667452 AGGGGTCTGTTGCTGGGCCTGGG + Intronic
931239677 2:60441034-60441056 AGGGGGCTGCTCCTGGGGATTGG + Intergenic
931766738 2:65463559-65463581 GGTGGCCTTCTGCTGGGCTTGGG + Intergenic
932477013 2:72012769-72012791 GAGGGCCTCCTCCTGGCCCTAGG - Intergenic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
934662406 2:96150183-96150205 ATGGGCCTGGGCCTGGGCCTGGG + Intergenic
934887516 2:98037941-98037963 AGGGGGCCTCTCCTGGGGTTTGG - Intergenic
935500253 2:103830665-103830687 AGGGGCCTCCTCCAAGGCCCAGG - Intergenic
937292971 2:120793174-120793196 AGGGGGCTTCTCCGGGCCCTGGG + Intronic
937850102 2:126624298-126624320 ATGGGCTTTCTCCTTGGCCAGGG - Intergenic
937862145 2:126719502-126719524 AGGGGCCTTCTGCTGAGCCATGG + Intergenic
937977909 2:127592983-127593005 CGCGGCCTTCCCCTCGGCCTTGG + Intronic
941710905 2:168712170-168712192 AGGGGCCTCCTCCTTCCCCTTGG + Intronic
941892524 2:170596704-170596726 AAGGGCCTTCTCTAGGCCCTGGG - Intronic
946354903 2:219178404-219178426 ATGGGCCTGAGCCTGGGCCTGGG + Exonic
947156307 2:227165039-227165061 AGGGGGCTTGTCCAGTGCCTAGG + Intronic
947220212 2:227784473-227784495 AGGGGCCTACTGCTGAGCCCAGG + Intergenic
947595586 2:231409690-231409712 CTGGGCCTCCACCTGGGCCTGGG - Intergenic
947621629 2:231594512-231594534 AGGAGCCTTCCCAGGGGCCTAGG + Intergenic
948561548 2:238857061-238857083 GGGGGCCATCTGCTGTGCCTGGG + Intronic
948667447 2:239545534-239545556 AGGTGGCTTCTCCTGGGGCTGGG - Intergenic
948839542 2:240642298-240642320 TGGGGCCCTCACCTGGCCCTGGG + Intergenic
1169218679 20:3807998-3808020 AGGAGCCTGGGCCTGGGCCTGGG + Intergenic
1169307754 20:4507736-4507758 TGGGGTCATCTCCTTGGCCTTGG + Intergenic
1170058986 20:12239743-12239765 ATGGGGTTTCTCCTGGGCCTTGG - Intergenic
1171356151 20:24547096-24547118 TGGGGCCTTCTCATTGTCCTGGG + Intronic
1171401251 20:24874123-24874145 AGGGTCCTTCTCAAAGGCCTGGG - Intergenic
1171750346 20:29043173-29043195 AGAGGTCTTCTCTAGGGCCTCGG + Intergenic
1171816769 20:29792646-29792668 AGGGGACTCCTCCTGGTCCCTGG - Intergenic
1172162559 20:32878811-32878833 AGGAGCCTCTTCCTGGGCCTTGG + Intronic
1172227807 20:33316911-33316933 CTGGGCCTTCCCCTGGGCCTGGG - Intergenic
1172895319 20:38295979-38296001 CGGGGCCTGACCCTGGGCCTGGG - Intronic
1172991499 20:39040319-39040341 AGGGGCCTCCCCATGGGCCCAGG - Intergenic
1173327342 20:42046124-42046146 ACTGGCCTTTTCCTGGGGCTGGG + Intergenic
1173727323 20:45306961-45306983 ACGGGGCGTCTCCGGGGCCTCGG - Intronic
1174484518 20:50852789-50852811 AGGGGCCTGCATCTGGGCCTTGG + Intronic
1174976744 20:55344424-55344446 AGGCGCTTTCTCCTGGGGCGGGG + Intergenic
1175897755 20:62346852-62346874 CGGGGCCCTCTCATGGGCCAGGG + Intronic
1176623917 21:9075412-9075434 AGAGGCCTTCTCCTTGGCTTAGG - Intergenic
1179585220 21:42370294-42370316 AGGGGTCTGCTCTGGGGCCTGGG - Intergenic
1180320238 22:11313254-11313276 AGGGGACTCCTCCTGGTCCCTGG - Intergenic
1180407088 22:12566070-12566092 AGAGGTCTTCTCTAGGGCCTCGG + Intergenic
1182309344 22:29393613-29393635 AAGGAGTTTCTCCTGGGCCTGGG - Intronic
1182431416 22:30301168-30301190 AGTGGGCTCCTCCTGGGCTTGGG + Intronic
1182515653 22:30857344-30857366 AGGTGCCCTCCCCTGGGCCTCGG - Intronic
1183038916 22:35161654-35161676 AGGGGCCTGCACGAGGGCCTTGG + Intergenic
1183215201 22:36474882-36474904 TGGGGGCTTCCTCTGGGCCTTGG - Intronic
1183300008 22:37054245-37054267 TGGGGCCTGCTCCTGAGCCTAGG - Intronic
1184556703 22:45237074-45237096 TTGGGCCTTCTCCTGGGCCCTGG - Intronic
1184723250 22:46328305-46328327 GGGGGGCTTCTCCTAGGCCTAGG - Intronic
1184864285 22:47193723-47193745 AGGGGCCGTGTCCTGGGCAGGGG + Intergenic
1185085270 22:48737518-48737540 CGGGGTCTTCTCCTGGGGCTGGG + Intronic
949317186 3:2769906-2769928 AGAGGCCATCTCTTGGGCCTTGG + Intronic
950097175 3:10337117-10337139 AGGGGCCATCTCCTGGACCTTGG + Intronic
950965714 3:17144361-17144383 AGGGGCTTTCCCCGTGGCCTGGG + Intergenic
950968263 3:17161557-17161579 ATTGGCCATCTCCTGAGCCTGGG - Intronic
951189314 3:19749775-19749797 AGGGGAGTTCTCCCGGGCCCAGG + Intergenic
951708936 3:25570394-25570416 AGAGGCCATCCCCTGGGCCAAGG + Intronic
952820126 3:37479455-37479477 AGTGGCCTTGTCCAGGGCCTTGG + Intronic
953045631 3:39291926-39291948 AAGGGCTTTCTCCTGGCTCTAGG + Intergenic
953678066 3:45018723-45018745 ACGGGCCTTCCTCTGGGCCAGGG - Intronic
954383944 3:50234731-50234753 AGGGGCCTTCCCTTTGGGCTGGG + Intronic
957915406 3:86682400-86682422 ACAGGTCTACTCCTGGGCCTTGG + Intergenic
959974012 3:112437643-112437665 AGGGGGCTTCTCCAAGGCCCTGG + Intergenic
961623060 3:128239849-128239871 TGGAGCCTTCTCCTGTGACTGGG + Intronic
962275263 3:134008561-134008583 AGGGGTCTGTTCCTGAGCCTGGG - Intronic
962739548 3:138353028-138353050 AGGGGGCTCCTTCTGGGTCTAGG - Intronic
962803220 3:138908121-138908143 AGGGAAGTCCTCCTGGGCCTGGG - Intergenic
963732541 3:148987223-148987245 GGGGGCCCTCTCCAGGGACTGGG - Intergenic
966314042 3:178625316-178625338 GGGGTCCAGCTCCTGGGCCTGGG - Intronic
967778235 3:193406833-193406855 TTCTGCCTTCTCCTGGGCCTTGG - Intronic
968443592 4:636793-636815 AGGGGCCTCCTCCTGGCCCCAGG + Intronic
968619641 4:1598090-1598112 AGTGGCCTTCGGCTGGGCCTGGG - Intergenic
969373452 4:6748320-6748342 AGGGGCCCTCAGCTGGACCTTGG - Intergenic
970159017 4:13170632-13170654 AGGGATCTTTTCCTGGGGCTGGG + Intergenic
970440945 4:16080796-16080818 AGAAGCTTTCTTCTGGGCCTGGG + Intronic
977468231 4:97408790-97408812 ATGGACTTTCTCCTGGGCCAGGG - Intronic
984393174 4:179164955-179164977 TTGAGCATTCTCCTGGGCCTTGG + Intergenic
985552847 5:542050-542072 AAGGGGCTTCTCCCGGACCTTGG - Intergenic
985563238 5:602422-602444 AGCGGCCGTCTCCTGCGTCTTGG + Intergenic
986163291 5:5250576-5250598 AGGGTCCTGCTCCTGGGCCTGGG - Intronic
986597889 5:9442299-9442321 AGGCGACTTCACCTGAGCCTTGG - Intronic
986840301 5:11688705-11688727 AGGGCCCTTCTCCTGGGTGGTGG - Intronic
990579639 5:57155802-57155824 AAGGACTTTCTCTTGGGCCTTGG + Intergenic
992974535 5:82100490-82100512 AGGGGCCAACTACTGGGCCATGG - Intronic
993025147 5:82636944-82636966 AGGGGCCCTCTACAGGGCTTGGG - Intergenic
993246668 5:85460131-85460153 AGGGGGCGTCTCCTGTGCCCAGG + Intergenic
995869342 5:116727880-116727902 AGTGGGCTTCTCCTGGGTTTGGG + Intergenic
997586597 5:135047283-135047305 TGGGGGCTCCCCCTGGGCCTTGG + Intronic
998072338 5:139207794-139207816 AGGGCCCTTCTCCAGGGCAGGGG + Intronic
998368958 5:141649186-141649208 AGCCGCCTTCTCCTGTGCCAAGG + Exonic
999244346 5:150145637-150145659 AGGGGCTGTCTCATGGGCATTGG - Intronic
999258044 5:150220703-150220725 AAGAGCCTGCCCCTGGGCCTGGG + Intronic
999274090 5:150317394-150317416 AGGGCCCTTCCCCTGTACCTTGG + Intronic
999711547 5:154322667-154322689 AGGTTCCCTCTTCTGGGCCTGGG + Intronic
1001564537 5:172690900-172690922 ACCGGGGTTCTCCTGGGCCTTGG - Exonic
1001589771 5:172857432-172857454 AGGAGACTTCTCTTGAGCCTGGG + Intronic
1002012028 5:176290995-176291017 ACTGACCTTCTCCTAGGCCTAGG - Intronic
1002093003 5:176815765-176815787 AGGGGCCCCTGCCTGGGCCTGGG - Intronic
1002160777 5:177312746-177312768 AATGGCCTTTTCCGGGGCCTTGG + Intronic
1002215736 5:177631304-177631326 ACTGACCTTCTCCTAGGCCTAGG + Intergenic
1002564156 5:180100541-180100563 AGGGGCCTGCTGGTGGGCCAAGG + Intergenic
1003426602 6:6002189-6002211 GGGGGCCTGGTCCTAGGCCTGGG + Intronic
1003926430 6:10881987-10882009 CGGGGCCTTGTCCTTGGCCGCGG + Intronic
1004647870 6:17580594-17580616 AGGCGCCGCCTCCTCGGCCTTGG + Intergenic
1006024468 6:31138370-31138392 AGGCTCCTCCTCCTGGGGCTGGG - Intronic
1006166387 6:32068084-32068106 AGAGGCCTACTCTTGGGGCTGGG + Intronic
1006183208 6:32166307-32166329 AGGAGCCTTCTGCTGGGGGTGGG + Intronic
1006385600 6:33729111-33729133 AGGGGTGTTCTCCTGGACATTGG + Intronic
1006429694 6:33988148-33988170 AAGCTCCTTCTCCTGGTCCTGGG + Intergenic
1006582873 6:35086807-35086829 AGGGGCCTGCTCTTTGGCCGAGG + Intronic
1006778688 6:36616977-36616999 GGGGGCCATCTCCAGGGGCTCGG + Intergenic
1007051624 6:38836735-38836757 AGGTGCCTTATATTGGGCCTTGG + Intronic
1007211416 6:40195934-40195956 AGGTGTGTTCTCCTCGGCCTGGG + Intergenic
1007703002 6:43775203-43775225 AGGAGCCCTTTCCTTGGCCTAGG + Intronic
1007730266 6:43941266-43941288 AGGGCCCTTCTCCTGGGATCTGG + Intergenic
1009312334 6:62170395-62170417 AGGGGGCTCCTCCAAGGCCTGGG + Intronic
1013554009 6:111237752-111237774 TGTGGCCTTCTCCTTGGCCCTGG - Intergenic
1016416982 6:143843388-143843410 AGCGGCCTTCAGCTGGACCTTGG + Exonic
1017075563 6:150614559-150614581 AGGGGCCTTCCCCTCTGTCTTGG - Intronic
1017130313 6:151102964-151102986 TGGGGGCTTCACCTGAGCCTGGG - Intergenic
1018000300 6:159572775-159572797 AGGCTCCTTCTCCAGGGCCCTGG - Intergenic
1018085438 6:160297600-160297622 AGGGGCCTTACGCTGGGCATGGG - Intergenic
1019336497 7:485328-485350 ATGGGCTTTCTCCTGGGACAGGG - Intergenic
1019483356 7:1276310-1276332 CGGGGCCTGGGCCTGGGCCTGGG + Intergenic
1019577744 7:1745675-1745697 ACGGATCTCCTCCTGGGCCTTGG - Exonic
1019739019 7:2663632-2663654 AGGGCCTCTCTCCTGGCCCTAGG - Exonic
1020035532 7:4960794-4960816 AAGGGCCTTCTCTTGGATCTGGG - Intergenic
1020488691 7:8751257-8751279 ATGGGCCTTCTCTTGGCCCTGGG - Exonic
1021689019 7:23214317-23214339 AGGGGGCCTCTCCTGTTCCTGGG + Intergenic
1022141888 7:27499915-27499937 AGGGGCCTTGTGCTGGGCTCTGG + Intergenic
1023904568 7:44513194-44513216 CAGTGCCTCCTCCTGGGCCTGGG - Exonic
1026440633 7:70440627-70440649 AGGGCCCTTCTCCTGGACACAGG + Intronic
1029499777 7:100921686-100921708 AGGGGCTATGTCATGGGCCTTGG - Intergenic
1029610229 7:101622749-101622771 ATGGGCCTGGGCCTGGGCCTGGG - Intronic
1031928655 7:127662737-127662759 AGGGCCCAGCACCTGGGCCTTGG + Intronic
1032193931 7:129779357-129779379 AGGGGCCAGCTCCGGGGCCCCGG + Intergenic
1032405971 7:131655743-131655765 AGGGGGCTTCACCTGAGCCAAGG + Intergenic
1032995369 7:137440100-137440122 TGGAGCCATCTCCTGGGCCCAGG - Intronic
1034429773 7:151035460-151035482 AGGGGCCAAGACCTGGGCCTTGG + Intronic
1034446645 7:151117156-151117178 AGGGGACTCCTCCTGGACATAGG - Exonic
1034680627 7:152925293-152925315 ATGGGGCTTGCCCTGGGCCTGGG + Intergenic
1034752771 7:153586492-153586514 AGGGGACACCTCCTGGGACTCGG - Intergenic
1037762195 8:21748957-21748979 GGGGGCCTTGACCTGAGCCTTGG - Intronic
1038326927 8:26578756-26578778 TGGAGCCTTCTCCGGGTCCTTGG + Intronic
1038450293 8:27634874-27634896 AGTGGCCATTTCCAGGGCCTGGG + Intronic
1038854935 8:31320879-31320901 AGGGGGCTTATCCTGGGTGTGGG + Intergenic
1039556930 8:38483222-38483244 GGGGGCTTTGTCCTGGGACTGGG + Intergenic
1039560742 8:38510574-38510596 AGTGGCCTTCACCGGGGCCTCGG - Intergenic
1039586994 8:38715044-38715066 GGGGCCCCTGTCCTGGGCCTGGG + Intergenic
1040550954 8:48437221-48437243 GGGGGCCTTCTCCTGGGCTTGGG + Intergenic
1041441051 8:57897386-57897408 AGAGTCCTTGTCCTGGGCTTTGG - Intergenic
1042642424 8:70951119-70951141 AGGCCCTTTCTCCTGAGCCTGGG - Intergenic
1042661523 8:71159899-71159921 AGGGGCCTGAGCATGGGCCTGGG - Intergenic
1049152156 8:141041904-141041926 AGCGGCCTTTTTGTGGGCCTGGG - Intergenic
1049257960 8:141623926-141623948 AGAGGCCTTGTCCTGGGCGCTGG - Intergenic
1050092483 9:2029060-2029082 CAGGGCCTTCGCCGGGGCCTGGG + Exonic
1052489724 9:29149979-29150001 AGGGGGCTTCCCCAAGGCCTAGG + Intergenic
1052840682 9:33289288-33289310 GGGGCCCAGCTCCTGGGCCTAGG + Intergenic
1053004380 9:34594310-34594332 GGGGGCCATGTCCTGGGCCTCGG - Intergenic
1053721431 9:40950862-40950884 AGAGGTCTTCTCTAGGGCCTCGG + Intergenic
1054344566 9:63901306-63901328 AGAGGTCTTCTCTAGGGCCTCGG - Intergenic
1056459980 9:86800181-86800203 GGTGGCCTTGTCCTGGGACTTGG + Intergenic
1056594945 9:87999965-87999987 ATGTGCCATCTCCTGGGCCCAGG + Intergenic
1056963581 9:91147501-91147523 AGGGGCCTTTGCCTGGGGTTAGG - Intergenic
1057186163 9:93058660-93058682 CGGGGCCTGGGCCTGGGCCTGGG - Intergenic
1057878057 9:98772640-98772662 AGGGGCCTCATTCTGGGCCCTGG - Intronic
1058475944 9:105333209-105333231 AGGGCCTTGCTGCTGGGCCTAGG - Intronic
1059754089 9:117276250-117276272 ACTTGCCTTCTCCTGAGCCTTGG - Intronic
1060209884 9:121703162-121703184 AGGGACCCTCACCTGGACCTGGG + Intronic
1061327878 9:129875127-129875149 TGGAGCCTTCTCCAGGGCCCTGG + Intronic
1061647448 9:132016662-132016684 AGGGGCCTCCTCCTGGCTCAAGG + Intronic
1061922825 9:133791411-133791433 AGGGGGCGTCTCCTGCCCCTGGG + Intronic
1062077137 9:134595525-134595547 AGGGGCTTGCTCCTGGAGCTAGG + Intergenic
1062208925 9:135352801-135352823 GGGGCCCTTCTCCTGGGACAAGG + Intergenic
1062385335 9:136307119-136307141 GGAGGGCTTCTCCTGGGCCCTGG - Intergenic
1062439510 9:136563436-136563458 GGGGGCCCACTGCTGGGCCTAGG - Intergenic
1203747102 Un_GL000218v1:45840-45862 AGAGGCCTTCTCCTTGGCTTAGG - Intergenic
1203368458 Un_KI270442v1:279008-279030 AGGGGACTCCTCCTGGTCCCTGG - Intergenic
1188192517 X:27189537-27189559 TGGGGCATTTTCCAGGGCCTTGG - Intergenic
1189176094 X:38958991-38959013 TGGGGCCGTGTCCTGGGCCATGG - Intergenic
1190428173 X:50352110-50352132 AGGAGCTTTCTCCTTGGACTGGG - Intergenic
1193928483 X:87521687-87521709 AGGGTACTTCTCCTGTGCCAAGG + Intronic
1198214638 X:134545198-134545220 AGGGGCCCACTCCTGGCCCCGGG + Intergenic
1198274879 X:135090810-135090832 TGGGGCCTTCTCCTTGGACATGG - Intergenic
1199073861 X:143508916-143508938 AAGGTCCTTCACATGGGCCTAGG + Exonic
1199795565 X:151192097-151192119 CGGGGTCTTGTCCTAGGCCTGGG - Intergenic
1200913035 Y:8547758-8547780 AGGGTCATTCTCCTGGGACTGGG - Intergenic
1201160421 Y:11160835-11160857 AGAGGCCTTCTCCTTGGCTTAGG - Intergenic
1201891609 Y:18948802-18948824 ATGGACTTTCTCCTGGGCCAGGG + Intergenic