ID: 1084943129

View in Genome Browser
Species Human (GRCh38)
Location 11:72625014-72625036
Sequence AGGGCTGTTGCCCCATGTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 172}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084943122_1084943129 1 Left 1084943122 11:72624990-72625012 CCACCCCAACTGGGCACAGTCGC 0: 1
1: 0
2: 0
3: 27
4: 161
Right 1084943129 11:72625014-72625036 AGGGCTGTTGCCCCATGTCACGG 0: 1
1: 0
2: 0
3: 14
4: 172
1084943114_1084943129 23 Left 1084943114 11:72624968-72624990 CCACAAGCTTGGCCCCTCGTCCC 0: 1
1: 0
2: 0
3: 19
4: 176
Right 1084943129 11:72625014-72625036 AGGGCTGTTGCCCCATGTCACGG 0: 1
1: 0
2: 0
3: 14
4: 172
1084943121_1084943129 2 Left 1084943121 11:72624989-72625011 CCCACCCCAACTGGGCACAGTCG 0: 1
1: 0
2: 0
3: 16
4: 122
Right 1084943129 11:72625014-72625036 AGGGCTGTTGCCCCATGTCACGG 0: 1
1: 0
2: 0
3: 14
4: 172
1084943113_1084943129 24 Left 1084943113 11:72624967-72624989 CCCACAAGCTTGGCCCCTCGTCC 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1084943129 11:72625014-72625036 AGGGCTGTTGCCCCATGTCACGG 0: 1
1: 0
2: 0
3: 14
4: 172
1084943115_1084943129 11 Left 1084943115 11:72624980-72625002 CCCCTCGTCCCCACCCCAACTGG 0: 1
1: 0
2: 2
3: 39
4: 372
Right 1084943129 11:72625014-72625036 AGGGCTGTTGCCCCATGTCACGG 0: 1
1: 0
2: 0
3: 14
4: 172
1084943126_1084943129 -4 Left 1084943126 11:72624995-72625017 CCAACTGGGCACAGTCGCCAGGG 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1084943129 11:72625014-72625036 AGGGCTGTTGCCCCATGTCACGG 0: 1
1: 0
2: 0
3: 14
4: 172
1084943120_1084943129 3 Left 1084943120 11:72624988-72625010 CCCCACCCCAACTGGGCACAGTC 0: 1
1: 0
2: 6
3: 35
4: 264
Right 1084943129 11:72625014-72625036 AGGGCTGTTGCCCCATGTCACGG 0: 1
1: 0
2: 0
3: 14
4: 172
1084943123_1084943129 -2 Left 1084943123 11:72624993-72625015 CCCCAACTGGGCACAGTCGCCAG 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1084943129 11:72625014-72625036 AGGGCTGTTGCCCCATGTCACGG 0: 1
1: 0
2: 0
3: 14
4: 172
1084943119_1084943129 9 Left 1084943119 11:72624982-72625004 CCTCGTCCCCACCCCAACTGGGC 0: 1
1: 0
2: 3
3: 42
4: 453
Right 1084943129 11:72625014-72625036 AGGGCTGTTGCCCCATGTCACGG 0: 1
1: 0
2: 0
3: 14
4: 172
1084943117_1084943129 10 Left 1084943117 11:72624981-72625003 CCCTCGTCCCCACCCCAACTGGG 0: 1
1: 0
2: 0
3: 24
4: 275
Right 1084943129 11:72625014-72625036 AGGGCTGTTGCCCCATGTCACGG 0: 1
1: 0
2: 0
3: 14
4: 172
1084943124_1084943129 -3 Left 1084943124 11:72624994-72625016 CCCAACTGGGCACAGTCGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1084943129 11:72625014-72625036 AGGGCTGTTGCCCCATGTCACGG 0: 1
1: 0
2: 0
3: 14
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084943129 Original CRISPR AGGGCTGTTGCCCCATGTCA CGG Intronic
900500369 1:3001574-3001596 AGGGCTGCTGCTCCAGGACAGGG - Intergenic
902090385 1:13898312-13898334 AGGGCTGTTGCCCCATCCCCTGG + Intergenic
902136729 1:14312886-14312908 AGGGCTGTGGTCTCATCTCAAGG - Intergenic
902925013 1:19690287-19690309 AGGGCAGCTGCCCCACGTGATGG + Intronic
904410200 1:30320490-30320512 AGGGATGATGCCCCTTCTCAGGG - Intergenic
904586909 1:31585734-31585756 AGGGCTGTGGGCAGATGTCAAGG - Exonic
905645995 1:39625596-39625618 GGGGCCGTGGCCCCATGTGATGG - Exonic
907524251 1:55044885-55044907 AGGCCTGTGGCGCCATGACAGGG + Intronic
907887348 1:58605807-58605829 AGGTTTGTTGCCTCATGCCAAGG + Intergenic
908913120 1:69096043-69096065 AGGGCTCTTGCCCCATACCTGGG + Intergenic
912662026 1:111540351-111540373 CTGGCTGCTGCCCCATGCCAAGG - Intronic
913284770 1:117216253-117216275 AGGGCAGCTGCCCCATGCAACGG - Intergenic
915247576 1:154567648-154567670 AGGGCTGTTCCTCCACGGCACGG - Intergenic
915273530 1:154772531-154772553 AGGGCTCTTGCCACATAGCAAGG - Intronic
916042787 1:160975741-160975763 AGGATTGTTGCCTCATGCCAAGG + Intergenic
917390447 1:174530442-174530464 AGTGCTGTTGCACAATCTCATGG + Intronic
919748327 1:201022155-201022177 AGGGCAGATGCCCCTTGCCACGG - Intronic
921101807 1:211934907-211934929 AGGGCTGTTGACACATGAGAGGG - Intergenic
922059617 1:222075517-222075539 AGGGCTGCTGCACCAAGTCTAGG - Intergenic
922643581 1:227261788-227261810 AGGACCCTTTCCCCATGTCAGGG + Intronic
1062890264 10:1054488-1054510 AGCATTGTTGCCCTATGTCAGGG + Intronic
1064880328 10:20044842-20044864 ATGGCTTGTGCCCAATGTCAAGG + Intronic
1067533869 10:47093965-47093987 AGTGCTGTTGCCCCAGGTGAAGG - Intergenic
1068051136 10:51950733-51950755 AGGGCAGCTGCTCCATGCCATGG - Intronic
1068974123 10:62989823-62989845 GGTGCTGTTTCCCCATCTCATGG - Intergenic
1075690855 10:124393181-124393203 AGGGCAGATGCCTCATGTGATGG - Intergenic
1076473495 10:130736399-130736421 AGGGGTGTTTCCCCATGGCGGGG - Intergenic
1077212145 11:1376017-1376039 CGGGCTGTCGCTCCAGGTCAGGG - Intergenic
1077262301 11:1629325-1629347 AGGGCTGAAGCCCCAGGTCCTGG + Intergenic
1077268121 11:1662030-1662052 CGGGCTGTTGCTGCATGCCAAGG + Intergenic
1077501683 11:2912327-2912349 AAGCCTGGTGCCCCATGGCAAGG + Intronic
1077541014 11:3146520-3146542 ACGGCTGTTGGACCCTGTCACGG + Intronic
1077545654 11:3168480-3168502 AGCGCTGTTCCCACATGTCCTGG - Intergenic
1079501384 11:21105153-21105175 AGGTTTGTTGCCTCATGCCAAGG + Intronic
1081363080 11:42203751-42203773 AGGATTGTTGCCTCATGCCAAGG - Intergenic
1081520137 11:43873518-43873540 AGGGATGTTGCCACAAGCCAAGG - Intergenic
1082751047 11:57018089-57018111 AGTGCTGTTTCCTCATGCCATGG - Intergenic
1084549545 11:69832919-69832941 AGGTCAGTTGCCCCATGGCCCGG - Intergenic
1084943129 11:72625014-72625036 AGGGCTGTTGCCCCATGTCACGG + Intronic
1085913587 11:80858087-80858109 AGGGCTGTGTCCTCATGTGATGG + Intergenic
1086934377 11:92728775-92728797 AGGGATGTGGCCACAAGTCAGGG - Intronic
1087093827 11:94301314-94301336 AGGGCTGGTGTGCCATGTTAAGG + Intergenic
1089206107 11:116764320-116764342 AGGGCTGTTCCCCAAAGTAAAGG - Intronic
1089505407 11:118958802-118958824 GGGGCTGGTGCCCCATGTGGAGG + Intergenic
1090404637 11:126469405-126469427 AGTGCTGTTGGCCTATGGCAGGG + Intronic
1099461044 12:82921559-82921581 AGGGCTACTGCTCCATCTCAAGG - Intronic
1100255629 12:92880177-92880199 AGGGATTTTGCCCCAGGTTATGG - Intronic
1101824983 12:108213183-108213205 AGGTCTGTTGCCCCATGAGATGG - Intronic
1103413490 12:120728991-120729013 AGTGCTGTTGCCTCTTCTCAGGG + Intronic
1103623178 12:122201006-122201028 AGGGCTGTGGGCCCAGGTCACGG + Intronic
1103852900 12:123944872-123944894 AGGGCAGTGGCCCCAGGACACGG + Intronic
1107014552 13:35697599-35697621 AAGGCTGTGGCCCCATGGTAAGG + Intergenic
1107566168 13:41606964-41606986 AGGCCTGTTGCCCTCTGTTATGG + Intronic
1108359667 13:49657609-49657631 CGGGCTGTTGGCCCACGCCAGGG + Intergenic
1109570658 13:64184332-64184354 AGGAGTGTTGGCCCCTGTCAAGG - Intergenic
1112220672 13:97486640-97486662 AGGGCTGTTTCCCCATGGACGGG - Intergenic
1112254405 13:97816390-97816412 AGGGTTGTGACCCCTTGTCATGG + Intergenic
1113346074 13:109479776-109479798 AGGGATGTTGCCCCAGGTGATGG - Intergenic
1114220918 14:20695703-20695725 ACGGCTTTTGGCCCATTTCAGGG - Intronic
1117993613 14:61458552-61458574 AGGGCAGTTGACCCAAGTCTAGG - Intronic
1118348949 14:64960023-64960045 AGGGCTGCTGCCTCAGGCCATGG - Intronic
1122023829 14:98860079-98860101 AGTACTGCTGCCCCATCTCATGG + Intergenic
1122256925 14:100485175-100485197 AGGCTTGCTGCCCCCTGTCATGG + Intronic
1122721681 14:103725854-103725876 AGGCCTGAAGCCCCATGGCAAGG - Intronic
1124127032 15:26945550-26945572 AGTGGAGTTGCCTCATGTCAGGG + Intronic
1126345726 15:47692050-47692072 TGGGCTCTTTTCCCATGTCAGGG - Intronic
1127652814 15:61025361-61025383 AGGGCTGTGGTCCCAGGTCCCGG + Intronic
1128308871 15:66617983-66618005 AGGGCGGTTGCCAACTGTCACGG + Intronic
1133386852 16:5376833-5376855 AGTGATGTTGCCCCATGGCAGGG + Intergenic
1134346344 16:13395227-13395249 ATGCCTGTTGCCACATGTCATGG + Intergenic
1138089264 16:54160900-54160922 AGGGCTGTGATCCCATCTCAAGG - Intergenic
1138629667 16:58283097-58283119 AGGGCTTTTGCTGAATGTCAAGG - Exonic
1141403373 16:83770399-83770421 AGAGCTGTGGCCCCCTGGCAGGG - Intronic
1141678688 16:85531360-85531382 AGGGCCGCTGACCCCTGTCATGG + Intergenic
1142621840 17:1170189-1170211 AGGGCTGTCTCCTCATATCACGG + Intronic
1144397853 17:14862706-14862728 AGGCCAGTTGCCCCATGTTTTGG - Intergenic
1144730146 17:17521333-17521355 AGGGCAGCTGCCCCATCTCTGGG - Intronic
1148726026 17:49790544-49790566 AGGACTGTGGCCCTATTTCAAGG - Intronic
1148783551 17:50134605-50134627 AGGGCTGCTGCCCCAGGCAATGG + Exonic
1149041754 17:52198421-52198443 AGGTTTGTTGCCTCATGCCAGGG + Intergenic
1151359549 17:73580430-73580452 AAGGCTGTTGCCCCCTCGCAGGG + Intronic
1151602547 17:75115156-75115178 AGGGGTGTTGCACCAAGTCATGG - Intronic
1152567053 17:81105037-81105059 AGGGGTCTTTCCCCATGGCAGGG + Intronic
1152759455 17:82100380-82100402 AAGGCTGTGGCCCCAGGGCAGGG - Intergenic
1154391036 18:13936438-13936460 AGAGCTTCTGCCCCATGCCAAGG + Intergenic
1158829135 18:61258787-61258809 AGAGCTTTTGCCCCAATTCAAGG + Intergenic
1160200380 18:76790983-76791005 AGGGCTCCAGCCTCATGTCATGG + Intergenic
1160600190 18:80006630-80006652 AGGTTTGTTGCCTCATGTCAAGG + Intronic
1162305698 19:9872106-9872128 AGGGACGTGGCCCCCTGTCACGG - Intronic
1163133872 19:15295054-15295076 TGGGCTGTTGCCCCCTTTTATGG - Intronic
1163913903 19:20221732-20221754 AGTGCTGTAGCCCAATGCCATGG - Intergenic
1165108326 19:33487312-33487334 AAGGCTGGGGCCCCATGTCAAGG + Intronic
1165393634 19:35551993-35552015 AGGGCAGATGCCCCATTTAAAGG + Intronic
1165824418 19:38697726-38697748 AGGGCTGTTCCCCGAGGGCAAGG - Intronic
1166296936 19:41893992-41894014 AGGGCTGTTACCCAATGCCCAGG - Intronic
925100185 2:1237765-1237787 GGTGCAGTTGCCCCATGTCCTGG + Intronic
927848554 2:26484747-26484769 AGAGCTGTGGCCCCAGGTCCCGG - Intronic
928392462 2:30919935-30919957 AAGGTTGTACCCCCATGTCAAGG - Intronic
929744424 2:44641362-44641384 AGGGATGTTTGCCCAAGTCAGGG - Intronic
936477353 2:112850805-112850827 ATGGCTGTTGCCCCATGCTGTGG + Intergenic
937982869 2:127625264-127625286 CGGGCTCTTGCCCCATCACAGGG - Intronic
938188985 2:129257254-129257276 ATAGCTTTTGCCCCAGGTCAAGG - Intergenic
938194336 2:129313912-129313934 AGAGCTGTTTCCCCTTGTCTTGG + Intergenic
940998249 2:160173454-160173476 AGGGCTGTTGCCTAAAGACAGGG + Intronic
942650096 2:178157588-178157610 AGCCCTGTTGCCCCAATTCAAGG + Intergenic
942792487 2:179776382-179776404 AGGCCTGTCACCCCATTTCAAGG - Intronic
945545483 2:211145100-211145122 AGGGCTGCTGCCCTATGTGATGG + Intergenic
947235698 2:227938565-227938587 AGGGCTGTGGCCCAAGTTCACGG + Intergenic
1169948587 20:11016018-11016040 AGGTTTGTTGTCCCATGCCAGGG - Intergenic
1172056616 20:32158647-32158669 AAGGCTGTTGTCCAATTTCAGGG - Intronic
1172867239 20:38109686-38109708 AGGGCTTCTGCCCCATGACCAGG + Intronic
1174701779 20:52616703-52616725 AGGGCTGTGGCCCCCAGCCAGGG - Intergenic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
1179182821 21:39060242-39060264 AGGGTTGCTGCCCCATTTAATGG + Intergenic
1180793752 22:18591904-18591926 GAGGCTGTTGCCCCAGCTCAGGG - Intergenic
1180843005 22:18967974-18967996 AGGGCTGGAGCCCCTGGTCAAGG - Intergenic
1181058463 22:20270754-20270776 AGGGCTGGAGCCCCTGGTCAAGG + Intronic
1181227988 22:21403416-21403438 GAGGCTGTTGCCCCAGCTCAGGG + Intergenic
1181250665 22:21531423-21531445 GAGGCTGTTGCCCCAGCTCAGGG - Intergenic
1182071022 22:27463797-27463819 AGGTCAGTTGCCCAAGGTCATGG + Intergenic
1182724916 22:32437034-32437056 AGGGCTGCTGACCTCTGTCAGGG - Intronic
1182737101 22:32538631-32538653 ATGGCTCTTTCCCAATGTCATGG + Intronic
951202700 3:19892496-19892518 GGTGCTGTTGCACCATGTCCAGG - Intronic
954192117 3:48970764-48970786 ACTGCTGTTGCTCCATGTGAGGG + Intronic
960842322 3:121972525-121972547 AGGTTTGTTGTCTCATGTCAAGG - Intergenic
961127211 3:124430583-124430605 AGAGCTGTTGCCTCCTCTCATGG - Intronic
961550242 3:127666734-127666756 AGGGCTTTTCCCCCTTGCCACGG + Intronic
962292027 3:134145393-134145415 AGGGCACTGGCCCCAGGTCAGGG + Intronic
964987806 3:162766136-162766158 AGGGAAGCTGCCCCATGTGAAGG - Intergenic
967944091 3:194788513-194788535 AGGGTTTTTGTCCCATCTCATGG + Intergenic
971969237 4:33600312-33600334 AGGTTTGTTGCCTCATGCCAAGG - Intergenic
978392511 4:108242013-108242035 TGGGCTGTTTCGCCATGTCCTGG - Intergenic
981911059 4:149982196-149982218 ATGCCTTTTGCCCCATGTCAAGG + Intergenic
981938841 4:150260604-150260626 AGGGCAGGTGCCCCATGACAAGG + Intergenic
982348170 4:154384740-154384762 AGGGATGTGGCCACAAGTCAAGG + Intronic
984636123 4:182111673-182111695 AGGCCAGTTTCCCCATTTCAAGG + Intergenic
991969804 5:72128774-72128796 AGGGCTGTAGGCACATGCCAAGG + Intronic
994406502 5:99352242-99352264 TGGGTTCTTGTCCCATGTCAAGG + Intergenic
995738494 5:115329079-115329101 AGTGCTGTAGCCCAATGCCACGG + Intergenic
997415973 5:133728985-133729007 AGAGCTGTTCCCCAAGGTCATGG - Intergenic
997589048 5:135061809-135061831 TGGGATGTTGACCCATGACATGG + Intronic
999696083 5:154190139-154190161 ACGGCTGTGGCCCCGTTTCATGG + Intronic
1004648720 6:17588134-17588156 AGGGCTTTGGTCCCATGTGAGGG - Intergenic
1005917214 6:30363658-30363680 AGTACTGTTGCCCCAAGTAAGGG - Intergenic
1010327500 6:74581872-74581894 AGGGCTTTTGCCTCATCACATGG + Intergenic
1013039408 6:106418730-106418752 AGGTTTGTTGCCTCATGCCAAGG + Intergenic
1016725879 6:147366549-147366571 AGTGATGTGGCCCAATGTCAAGG - Intronic
1017638548 6:156467332-156467354 AGGGCTGCAGCCCCAAGCCAAGG + Intergenic
1017971572 6:159316168-159316190 AGGGCGGCTGAACCATGTCACGG - Intergenic
1018021021 6:159762304-159762326 GGGGCTGTAGCACCAGGTCAGGG - Intronic
1021152978 7:17174847-17174869 AGGTCTTATGCACCATGTCAAGG - Intergenic
1021820990 7:24497353-24497375 AGGTTTGTTGCCTCATGCCAAGG - Intergenic
1022532415 7:31075360-31075382 AGGGCTTCTGTGCCATGTCAGGG - Intronic
1022638704 7:32161334-32161356 ACGGGTGTAGCCCAATGTCAAGG - Intronic
1023305821 7:38825871-38825893 AGGGCTGTTGCCCAGTGTTCTGG - Intronic
1024188119 7:46975656-46975678 TTGGCTGTTGTCCCAAGTCATGG + Intergenic
1028857066 7:95604622-95604644 AGGGCTGCTGACCCATTTCCTGG - Intergenic
1033140256 7:138820314-138820336 AGGCCTGTTTCCCCATCTGAAGG + Intronic
1034498837 7:151437375-151437397 AAGGCCGTTCCCCCAGGTCATGG - Intronic
1034596472 7:152198843-152198865 AAGTCTGTTGCCCTAGGTCATGG - Intronic
1037222737 8:16545105-16545127 AGGTTTGTTGCCTCATGCCAAGG + Intronic
1038746921 8:30262716-30262738 AGGTCAGCTGGCCCATGTCATGG + Intergenic
1039437560 8:37570483-37570505 AGGGCTGCTGACACATGACAGGG - Intergenic
1040027161 8:42792445-42792467 AGGTTTGTTGCCTCATGCCAAGG + Intronic
1041017026 8:53601115-53601137 AGGGCTGCAGCCTCATCTCAAGG + Intergenic
1043702793 8:83312484-83312506 AGAGCTCTTGCCCCATGTCCAGG + Intergenic
1048061694 8:130925536-130925558 AGGTCTGTTGCTGCCTGTCAAGG + Intronic
1053665202 9:40312598-40312620 AGGCCTTTTCCCCCATGTCTTGG + Intronic
1054376358 9:64452628-64452650 AGGCCTTTTCCCCCATGTCTTGG + Intergenic
1054519415 9:66063686-66063708 AGGCCTTTTCCCCCATGTCTTGG - Intergenic
1056820232 9:89836251-89836273 AGCGCTGTTCACCCATGTCTAGG + Intergenic
1057552576 9:96062930-96062952 AGGGCTGATGCGCCACCTCAGGG - Intergenic
1059392281 9:114006728-114006750 AGGGCTGTGGTCTCATCTCAAGG + Intronic
1059565013 9:115375514-115375536 ATGGCTTTTGCCCAATGTCTAGG + Intronic
1059975426 9:119711339-119711361 AGTGCTGCTACCCTATGTCAGGG + Intergenic
1061048091 9:128178240-128178262 AGGGCTGTCATCCCATTTCACGG + Intronic
1062584632 9:137243748-137243770 GGTGCTGTTGCCGAATGTCAGGG + Exonic
1185673197 X:1827543-1827565 AGTGATGCTGCCCCAAGTCAAGG + Intergenic
1186353718 X:8768068-8768090 AGGTTTGTTGCCTCATGCCAAGG + Intergenic
1188158982 X:26777578-26777600 AGGTTTGTTGCCTCATGCCAAGG + Intergenic
1189420328 X:40851534-40851556 AGGTTTGTTGCCCAATGTGAGGG + Intergenic
1191104379 X:56763564-56763586 AGGGCTACTGCCCCAGGACAAGG - Intergenic
1191106021 X:56772827-56772849 AGGGCTGCCGCCCCAGGACAAGG - Intergenic
1191107014 X:56778229-56778251 AGGGCTGCCGCCCCAGGACAAGG - Intergenic
1196135157 X:112200816-112200838 GGTGCTGCTGCCCCATGTAAAGG + Intergenic
1200072243 X:153535010-153535032 AGGGCTCTTGGCTGATGTCAAGG + Intronic
1201684901 Y:16690239-16690261 AGGTTTGTTGCCTCATGCCAAGG - Intergenic