ID: 1084944288

View in Genome Browser
Species Human (GRCh38)
Location 11:72630560-72630582
Sequence CTGGGGTTGTGGAGGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1572
Summary {0: 1, 1: 2, 2: 10, 3: 114, 4: 1445}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084944288 Original CRISPR CTGGGGTTGTGGAGGGGGCA TGG Intronic
900090845 1:919811-919833 CCCGGGTTGTGGAGGGGACCGGG - Intergenic
900141639 1:1141379-1141401 ATGGGGTTGTGGACGGGGCGGGG - Intergenic
900141661 1:1141438-1141460 ATGGGGTTGTGGACGGGGCGGGG - Intergenic
900141680 1:1141479-1141501 GTGGGGATGTGGTGGGGGCGGGG - Intergenic
900191772 1:1355147-1355169 CCGGGGCTGCGGAGGGGGCGCGG + Exonic
900428093 1:2589614-2589636 CGGGGGCTGTGGAGGATGCAGGG - Exonic
900438205 1:2641239-2641261 AAGGGGGTGTGGAGAGGGCAGGG + Intronic
900501609 1:3008362-3008384 ATGAGATTGTGGAGGGGTCAGGG + Intergenic
900726129 1:4217501-4217523 CTGAGATTGAGGAGTGGGCAGGG - Intergenic
900790002 1:4673605-4673627 TTGGAGGTGTGGAGGGAGCAGGG + Intronic
900808993 1:4786947-4786969 ATGGCTTTGTGGAAGGGGCAGGG - Exonic
900990384 1:6095871-6095893 GGGGGGATGTGGTGGGGGCAGGG - Intronic
901061688 1:6474664-6474686 CTGGGGCTGTGGGTGGGGCGGGG - Intronic
901193547 1:7426659-7426681 CAGGGGTTGGGGCGGGGGAAAGG + Intronic
901266390 1:7914079-7914101 CTGGGATTGAGGAGAGGGGAAGG - Intergenic
901370608 1:8794456-8794478 CTGTGATTGTTGAGGTGGCAGGG + Intronic
901842165 1:11960623-11960645 CTGGGGTTGGGGATGGGGAAGGG - Intronic
902510387 1:16963676-16963698 CCGGGGAGGTGGAGGGGGCAGGG - Intronic
902551159 1:17220343-17220365 CAGAGGTTGTGGAGGGGGTCTGG + Intronic
902622698 1:17659622-17659644 CTGGTGGTGTGGAGGGTCCAGGG + Intronic
902701967 1:18178752-18178774 CTGGGGTGGGGTAGGGGGAAGGG - Intronic
902782859 1:18716016-18716038 CTGGGGCTGAGGTGGGAGCAGGG - Intronic
902783057 1:18716853-18716875 CGGGGGTGGGGGAGAGGGCAAGG - Intronic
902838232 1:19060133-19060155 GTGGAGTTGGGGTGGGGGCATGG - Intergenic
903072064 1:20731557-20731579 CTGGGGTGGTGGAGGCGGCATGG + Intronic
903363246 1:22790378-22790400 CTGGGGTTGGGGAGGGAACAGGG - Intronic
903510807 1:23873661-23873683 ATAGGGGTGTGGAGGAGGCAAGG + Exonic
903686328 1:25134963-25134985 ATGGGGATGGGGAGGGGGCTTGG - Intergenic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
903931299 1:26863981-26864003 GTGGGGGACTGGAGGGGGCAGGG - Exonic
903946455 1:26966952-26966974 CTGGGGCTGTGGAGGAGCCGTGG + Intergenic
904051358 1:27641294-27641316 CTGGGGTTGGGGGAGGGGCGTGG - Intergenic
904329528 1:29749195-29749217 CTGTGTTTGTGGTGGGGGCAGGG - Intergenic
904495786 1:30885909-30885931 CCTGGGTTGAGGAGGGGGCCTGG - Intronic
904533154 1:31182144-31182166 CTGGGGGTCTGGAGGCGGCGAGG + Intronic
904835217 1:33331316-33331338 CTGGGGAAATGGAGGGGGCTGGG + Intronic
904922535 1:34020272-34020294 CTTGGGAAGTGGAGGGGACAGGG - Intronic
904952679 1:34256607-34256629 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
904985798 1:34547434-34547456 CTTGGGTAGGGGAAGGGGCAGGG + Intergenic
905028954 1:34868797-34868819 CGGGGGTGGGGGCGGGGGCAGGG + Exonic
905040983 1:34958077-34958099 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
905127421 1:35725509-35725531 GTGGGGTGGGGGAGAGGGCATGG - Intronic
905240299 1:36576775-36576797 CTGGGGTCGGGGAGGGAGGAGGG + Intergenic
905322854 1:37130171-37130193 CTGGGGTGGGGGAAGGGGGATGG - Intergenic
905405937 1:37732423-37732445 CTGGGGCTGTGGATATGGCAGGG - Intronic
905519898 1:38589606-38589628 CTGGGGGAGTGGAGGGTGTAGGG - Intergenic
905827117 1:41034233-41034255 CTCGGGTTGGGGTGGGGGGAGGG + Intronic
905832657 1:41084976-41084998 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
905876634 1:41435802-41435824 CTGGGAATGGGGAGGGGGCCTGG - Intergenic
905893943 1:41533359-41533381 CTGTGGTGGTGGAAGGGGCTAGG - Intronic
906273795 1:44501207-44501229 CTGGGGGTGGGGAGTGGGAAGGG + Intronic
906511244 1:46411493-46411515 ATGGGGTTGTGAAGGGTCCACGG + Intronic
906523291 1:46479625-46479647 CTGGGGTCCTGGGGGGGGCTAGG + Intergenic
906525391 1:46490496-46490518 CGGGGGCTGGGGAGGGGGCGCGG + Intergenic
906609374 1:47191119-47191141 CTGGGGTGGGGGGTGGGGCAAGG - Intergenic
906911679 1:49958693-49958715 GTGGGGTTGGGGAGGGGGGAGGG + Intronic
907030468 1:51166161-51166183 CTGAGGGTGTGGAGGGGGTGGGG - Intergenic
907663450 1:56414496-56414518 ATGGGGCAGTGGAGGGGGGATGG - Intergenic
908678004 1:66627889-66627911 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
908681329 1:66665114-66665136 GTGGGGTGGTGGATGGGGGAGGG - Intronic
908752554 1:67438409-67438431 CTAGGGCTGTGGAGGGGCCATGG + Intergenic
908765465 1:67550894-67550916 GTGGGGTGGGGGAGGGGGAAGGG + Intergenic
909073476 1:71025049-71025071 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
909170438 1:72286489-72286511 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
909455024 1:75840518-75840540 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
909756062 1:79227467-79227489 CCTGGGTTGGAGAGGGGGCAGGG - Intergenic
910250074 1:85187865-85187887 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
910315108 1:85873680-85873702 GTGGGGTAGGGGAGGGGGAAGGG + Intronic
910745965 1:90575283-90575305 CAGGGGGTGGGGAGGGGGAAGGG + Intergenic
910840683 1:91558432-91558454 CTAGGATTGGGGAGGGGGAAGGG - Intergenic
910864712 1:91777570-91777592 CTGGGGTTGGGGCTGGGGCTGGG - Intronic
910878232 1:91898135-91898157 CTGGGGTTGAGGGGAGTGCAAGG - Intronic
911155040 1:94628526-94628548 CTGGGGTAGGGGCAGGGGCAGGG + Intergenic
911290503 1:96051718-96051740 GTGGGGTGGGGGAGGGGGAAAGG - Intergenic
911493689 1:98602476-98602498 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
911744503 1:101425622-101425644 GTGGGGTGGAGGAGGGGGGAGGG - Intergenic
912155838 1:106918372-106918394 TTGGGGTAGGGGAGGAGGCAGGG - Intergenic
912232851 1:107815875-107815897 GGCGGGGTGTGGAGGGGGCATGG + Intronic
912383767 1:109261280-109261302 CTGGGGGTGGGGAGTGGGCCTGG + Intronic
912495667 1:110089695-110089717 GGGGGGTTGTGGCTGGGGCAAGG - Intergenic
912562459 1:110560589-110560611 GTGGGCTTCTGGAGGGCGCATGG + Intergenic
912682498 1:111738455-111738477 CTGGGCTTGGGGAGTGCGCAGGG - Intronic
912755941 1:112325016-112325038 CTGGGGTTGTGGACAGAGCTTGG - Intergenic
912870834 1:113303925-113303947 CAGGGTTTGGGGAGGGGGAAAGG + Intergenic
913164053 1:116168976-116168998 GTGGAGTAGTGGAGGGGGGACGG - Intergenic
913718489 1:121565172-121565194 GGGGGGTTGGGCAGGGGGCAGGG - Intergenic
914196097 1:145448839-145448861 CTGGGAGGGTGGTGGGGGCAGGG - Intergenic
914783424 1:150806659-150806681 CTGGGGTCCTGGAGGGGGCATGG - Intronic
914899340 1:151703510-151703532 CTGGGGGAGGGGAGGGGGCTGGG + Intronic
915031940 1:152887064-152887086 CTGGGGTGGGGCAAGGGGCAGGG - Intergenic
915054189 1:153110585-153110607 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
915147957 1:153806490-153806512 CTGGGGAAGGGGAGGGGGTAGGG - Exonic
915297369 1:154930682-154930704 GTGGGGTGGTGGTGGGGGGATGG - Intronic
915341155 1:155177464-155177486 CTGGGCTGCAGGAGGGGGCAGGG + Intronic
915436561 1:155911185-155911207 CTGGGGGTGGGGAGGGGGTTCGG - Intronic
915707495 1:157860617-157860639 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
915841735 1:159218633-159218655 CTGGGGTTTGGGAGGGGGCTCGG - Intergenic
915913486 1:159928421-159928443 CTGGGGCTGTGGTAGGGGCTGGG - Exonic
916413512 1:164571300-164571322 CTGGGTTTTTTTAGGGGGCAAGG - Intronic
916624850 1:166544404-166544426 CTGGGGTTGGGAATGAGGCAGGG - Intergenic
916937104 1:169640506-169640528 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
917385071 1:174463511-174463533 GTGGGGTGGGGGAGGGGGAAGGG + Intronic
917581837 1:176386708-176386730 CTGGGGTTGAGGTGGGGGTAGGG + Intergenic
917581954 1:176388021-176388043 GTGGGGTAGGGGAGGGGGAAGGG - Intergenic
917733765 1:177901800-177901822 CTGGGGTTGGGTAGTGGGGAGGG - Intergenic
917956213 1:180101669-180101691 ATGTGTGTGTGGAGGGGGCAGGG - Intronic
918108895 1:181438411-181438433 CTGGAATTGTGGATGGGGAATGG + Intronic
918215575 1:182390479-182390501 CTGGGGTGAGTGAGGGGGCAGGG - Exonic
918245731 1:182657505-182657527 CTGGGCTTGGGGAGGGAGCAGGG - Intronic
918402067 1:184173516-184173538 CTGGCATGGTGGAGGAGGCAGGG - Intergenic
918898883 1:190386080-190386102 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
919130533 1:193445120-193445142 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
919177453 1:194036331-194036353 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
919207673 1:194437789-194437811 CTGGGGTGGAGGTGGGGGGAAGG - Intergenic
919510304 1:198454644-198454666 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
919944389 1:202308993-202309015 GTGGGATTGCTGAGGGGGCAGGG - Intronic
920176471 1:204104860-204104882 CTGTCGTTGTGGAGGGAGGAAGG + Intronic
920210741 1:204326497-204326519 CTTGGGTTTGGGAGGTGGCATGG - Intronic
920539806 1:206769765-206769787 TTGGGGTTGGGGAGTGGGCATGG + Intronic
920548218 1:206836425-206836447 CTGGGGTGGAGGTGGGGGCATGG + Intronic
920719050 1:208369914-208369936 TAGGGGTTGGGGATGGGGCAGGG + Intergenic
920840482 1:209549794-209549816 CTGGGATTCTGTAGGGGGCTTGG - Intergenic
920992208 1:210950360-210950382 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
922565182 1:226597008-226597030 CTGGGGGTGGGGAGTGGCCAGGG + Intronic
922686155 1:227640112-227640134 CTGAGGATGTGAAGGGGGAAAGG + Intronic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
922872802 1:228916826-228916848 CTAGGGAGGTGGAGGGGGCCAGG + Intergenic
922978004 1:229801152-229801174 CTGGGGTTGTGGGCTGGGCATGG + Intergenic
923418693 1:233790939-233790961 CTGGGGTGGGGGTGGGGGTATGG - Intergenic
923684090 1:236142257-236142279 CCGGGGATGGGGAGGGGGCCGGG + Intergenic
924129818 1:240895429-240895451 ATGGGGTGGAGGAGGGGGGAGGG - Intronic
924617301 1:245622808-245622830 CTGGGATTGAGGCGGGGGGAAGG + Intronic
924795769 1:247291261-247291283 CTGGGGTGATGGAGGGGTGAGGG - Intergenic
1062800837 10:379192-379214 CAGGGGTTGTGGGGGGGGGGGGG - Intronic
1062820663 10:532261-532283 CGGGGGTGGAGGTGGGGGCAGGG - Intronic
1062866770 10:862457-862479 GTGGGGTGGGGGAGGGGACAGGG + Intronic
1063424706 10:5942140-5942162 CTGGGCTGGTGTGGGGGGCAGGG + Intronic
1063567408 10:7182716-7182738 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1063576518 10:7266526-7266548 GTGGGGAGCTGGAGGGGGCACGG + Intronic
1064375874 10:14795210-14795232 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1064794722 10:18998433-18998455 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1064828965 10:19440485-19440507 GTGGGGTTGTTGCGGGGGGAGGG - Intronic
1064876554 10:20001467-20001489 GTGTGCGTGTGGAGGGGGCAAGG + Intronic
1064906151 10:20348025-20348047 GTGTGGTGGGGGAGGGGGCAGGG - Intergenic
1065864043 10:29898172-29898194 CTGGGGTTGGTGTGGGGTCAGGG + Intergenic
1065965420 10:30766630-30766652 CTGGCGCTGGGGAGGGGACAGGG - Intergenic
1066012752 10:31209617-31209639 CTGGGGCGGGGGCGGGGGCAGGG - Intergenic
1066021581 10:31309211-31309233 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1066431614 10:35357178-35357200 CTGGGGCTGGGGCAGGGGCAGGG - Intronic
1066431617 10:35357184-35357206 CTGGGGCTGGGGCTGGGGCAGGG - Intronic
1067060620 10:43076420-43076442 CTGGGGTAGTAGAGAGGGTAGGG - Intergenic
1067067590 10:43112519-43112541 CAGGGGATGTGGTGTGGGCAGGG + Intronic
1067103833 10:43351652-43351674 TGGGGGGTGTGGAGGGGGCCTGG - Intergenic
1067166042 10:43867373-43867395 CAGGGGCTGGGGCGGGGGCAAGG + Intergenic
1067569908 10:47363927-47363949 CATGGATTGTGGATGGGGCAAGG + Intergenic
1067683592 10:48454821-48454843 CTTGGGTGGGGGAGGGGCCAGGG - Intronic
1067683605 10:48454853-48454875 TTGGGGGTGTGGTGGGGGCCTGG - Intronic
1067703547 10:48590415-48590437 CCTCGGTTGTGGTGGGGGCAAGG + Intronic
1068078231 10:52285106-52285128 CTGGGGTTGTAAGAGGGGCAGGG - Intronic
1068314212 10:55320365-55320387 CAGTGGTGGTGGTGGGGGCATGG - Intronic
1068332586 10:55590312-55590334 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1068390836 10:56394882-56394904 CTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1068394323 10:56442218-56442240 GTGGGGTGGTGGAGGGGGGAGGG - Intergenic
1068568863 10:58606412-58606434 CTGGGGTGGGGGAGGGGGGAGGG + Intronic
1068780463 10:60914188-60914210 TTTTGGGTGTGGAGGGGGCAGGG + Intronic
1068877017 10:62007910-62007932 CTGGGCTTGTGGAAGAGGGATGG - Intronic
1069146305 10:64896115-64896137 CTGCTCTTGTGGAGGTGGCAGGG + Intergenic
1069515521 10:69073822-69073844 CTGGGGTGGTGGGTGGGGGATGG + Intergenic
1069631003 10:69897021-69897043 CTTGGGGTGGGGTGGGGGCAGGG + Intronic
1069746334 10:70717274-70717296 GTGGGGTTGTGGAGAGAGGAGGG + Intronic
1069750817 10:70744008-70744030 CCGGGGTGGCGGTGGGGGCAGGG + Intronic
1069751173 10:70745879-70745901 CTGGGGTCATGGAGGTGGCAGGG + Intronic
1069772678 10:70909659-70909681 ATGGGGTAGTGGAGGGGGATGGG - Intergenic
1070050700 10:72886846-72886868 CTGAAGTTGTGGAGGTGGGAGGG - Exonic
1070826089 10:79391370-79391392 CTGGCATTGTGGAAGGGGCATGG + Intronic
1070923982 10:80205878-80205900 CGGTGGTGGTGGAGGGGGGAAGG + Intergenic
1071044075 10:81352072-81352094 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1071293002 10:84200925-84200947 CTGGGGATGTGGAGGGCTGAGGG - Intronic
1071517731 10:86310190-86310212 CTGGGCTTGGGGATGGGGCCAGG - Intronic
1072007001 10:91260809-91260831 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1072871704 10:99126752-99126774 CTGCTGTGGTGGAGGTGGCAGGG - Intronic
1073116910 10:101096462-101096484 AGGGGGTTGTGGAGGGGTGAAGG - Intronic
1073193728 10:101670854-101670876 CTGGGCTTGTGGGGAGGGGAAGG + Intronic
1073205182 10:101765325-101765347 CTGGGGTTGAGTGGGGGGTAAGG + Intergenic
1073335518 10:102705098-102705120 CTGGAGCTGGGGAGGGGGAATGG - Intronic
1073353662 10:102837022-102837044 AGGGGGTGGTGAAGGGGGCAGGG + Intronic
1073700913 10:105925683-105925705 CTGTGCTGGTGGAGGTGGCAGGG - Intergenic
1074040008 10:109779204-109779226 CCGGGGTGGCGGCGGGGGCAGGG - Intergenic
1074408400 10:113201336-113201358 CTGGGGTTCAGGATGGGGTAGGG - Intergenic
1074725422 10:116303356-116303378 GTGGGGTTGGGGGAGGGGCAGGG - Intergenic
1075010543 10:118866120-118866142 AGGGGGTGGTGGAGGAGGCAGGG - Intergenic
1075170550 10:120109729-120109751 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1075427874 10:122355974-122355996 CTGGGGTTGTGCAGGCAGGATGG + Intergenic
1075430317 10:122374843-122374865 CAGGGGTGGTGGACGGGGCCAGG + Intronic
1075553236 10:123409575-123409597 CTGGAGTTGGGGAGGGGGGTTGG - Intergenic
1075727316 10:124617211-124617233 CTGGGGTTGCGGAGCAGGCAGGG - Exonic
1075743653 10:124711300-124711322 CAGGGGTTGGGGATGGGGCGTGG + Intronic
1075889183 10:125930858-125930880 GTAAGGGTGTGGAGGGGGCAAGG - Intronic
1076088893 10:127661653-127661675 GTGGGGTTGGGGAAGGGGGAGGG - Intergenic
1076125275 10:127969309-127969331 CTCGGGACGTGGAGAGGGCAGGG + Intronic
1076312539 10:129518561-129518583 CTGGGGAGGGGGAGGGGGAAGGG - Intronic
1076319766 10:129569270-129569292 CTGAGGTCGTGGTGGGGGCGGGG + Intronic
1076390413 10:130096688-130096710 CTGGGGCTTTTCAGGGGGCAGGG + Intergenic
1076760971 10:132605489-132605511 CTGGGGATGGGGAGGGGACAGGG + Intronic
1077037462 11:502358-502380 CAGGGGTGGGGCAGGGGGCAGGG + Exonic
1077108718 11:852922-852944 CTGGGCCTGTGGGGAGGGCATGG + Intronic
1077162123 11:1118581-1118603 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1077246889 11:1544040-1544062 CTAGAGCTGGGGAGGGGGCAGGG - Intergenic
1077439500 11:2561472-2561494 CTGGGCCTGTGGAAAGGGCATGG - Intronic
1077473474 11:2775661-2775683 CTGGGGTGGTGGGGGGTGGAAGG + Intronic
1077633146 11:3824501-3824523 CTGGGGTTGGGGCTGGGGCTTGG + Intronic
1077751455 11:4974952-4974974 CAGGGGTTGAGGTGGGGGGAGGG + Intronic
1077892737 11:6431244-6431266 CTGGGGTTGCGGAAGGGCCTTGG + Exonic
1077964236 11:7110679-7110701 CTGCTCTTGTGGAGGTGGCAGGG + Intergenic
1078133738 11:8635432-8635454 CTGGGGTTGGGCAGGGTGGAGGG - Intronic
1078159413 11:8827958-8827980 CTGGAGGTGGGGAGGGGGAACGG + Intronic
1078309520 11:10226471-10226493 GTGGGGTTGGGGAGGGGGGAGGG - Intronic
1078447686 11:11416885-11416907 CTGGGGGAGGGGATGGGGCAGGG - Intronic
1078475028 11:11622349-11622371 CTGGTTTTGTGGAGGGGGTGGGG + Intergenic
1079572813 11:21965657-21965679 CTGGGTTGGAGGAAGGGGCAGGG - Intergenic
1079765511 11:24387564-24387586 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1079787637 11:24694920-24694942 GGGGGGCTGTGTAGGGGGCAAGG + Intronic
1079862629 11:25693117-25693139 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1080194475 11:29592712-29592734 TTGGGGTGGTGGATGGGGGAAGG + Intergenic
1080540302 11:33258029-33258051 CTGGGGATGCGGATGGGGCACGG - Intronic
1080746365 11:35111818-35111840 ATGTGGTGGTGGAGTGGGCAGGG - Intergenic
1081668765 11:44931809-44931831 CTGGGGTTGTGGGGGAGGGGTGG + Exonic
1081693223 11:45092348-45092370 CTGGGGTCCTGGAGGAGTCAGGG - Intergenic
1081717230 11:45259077-45259099 CAGGGATTTTGCAGGGGGCAAGG - Intronic
1082101562 11:48177043-48177065 CTGGGGTTGTGGATGGGACATGG + Intergenic
1082559589 11:54602851-54602873 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1082566804 11:54690487-54690509 GTGGGGTGGGGGAGGGGGGAAGG - Intergenic
1082581623 11:54876835-54876857 CTATGGTTGTGGAGGGGGGAGGG + Intergenic
1082667921 11:55997519-55997541 GTGGGGTTGGGGAGAGGGGAGGG - Intergenic
1082771473 11:57211004-57211026 CAGGGAATGTGGAGGGGGAAGGG - Intergenic
1082811782 11:57482901-57482923 CGGGGCTTGGGGAGGGGGCTGGG - Intergenic
1082956075 11:58871425-58871447 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1083069742 11:59965140-59965162 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1083511440 11:63212666-63212688 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1083638375 11:64132428-64132450 CTGGGGGTGGGGCGGGGGGAGGG + Intronic
1083746748 11:64741357-64741379 CTGGCCTGGAGGAGGGGGCAGGG - Intronic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1084018653 11:66403482-66403504 CTTGTGTTCTGAAGGGGGCATGG - Intergenic
1084030199 11:66476472-66476494 CTGGGGGAGTGAAGGGGCCAGGG + Exonic
1084213751 11:67635686-67635708 GTGGGGCGGGGGAGGGGGCAGGG + Intronic
1084325461 11:68397413-68397435 CTGGGGTTCGGGAGAGGGCTGGG - Intronic
1084403084 11:68956138-68956160 CTGGGGGTGGGGTGGGGGCAGGG + Intergenic
1084403101 11:68956168-68956190 CTGGGGGTGGGGTGGGGGCAGGG + Intergenic
1084403233 11:68956696-68956718 CTGGGGTGATGGAGGAGGCTAGG - Intergenic
1084478714 11:69404125-69404147 CTGGGCTTGTGGGGGGGCCTCGG - Intergenic
1084660607 11:70544403-70544425 CTGGGGTTTGGAGGGGGGCAAGG + Intronic
1084789530 11:71464575-71464597 CTGGGGTTTTGGGCTGGGCACGG + Intronic
1084814922 11:71640146-71640168 AGGGGCTTGTGGTGGGGGCAGGG + Intergenic
1084889223 11:72228559-72228581 GTGGGGTTGAGAAGGGGGGATGG - Intronic
1084944288 11:72630560-72630582 CTGGGGTTGTGGAGGGGGCATGG + Intronic
1084992999 11:72946395-72946417 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1085013757 11:73159305-73159327 GTGGGGGTGTGGGGTGGGCAGGG - Intergenic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085243919 11:75082301-75082323 CTGGGGTGGGGGAGTGGGGAGGG + Intergenic
1085256231 11:75175120-75175142 CTGGGGATGGGGAGTGGGGAGGG + Intronic
1085277153 11:75307561-75307583 CTGGTGTGATGGAGGAGGCATGG - Intronic
1085299685 11:75450789-75450811 CTGGGGGTGTGGAGGGGGGTGGG - Intronic
1085607048 11:77910442-77910464 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1085815150 11:79729164-79729186 ATGGGATTGTGGAGTGAGCACGG + Intergenic
1086188680 11:84051623-84051645 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1086365568 11:86106414-86106436 GTGGGGTGGGGGAGGGGGAAGGG + Intergenic
1086628973 11:88992866-88992888 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1088078707 11:105883418-105883440 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1088912132 11:114199528-114199550 TTGGGGATGTGGAGGCAGCATGG + Intronic
1089479429 11:118792230-118792252 CTGGGGGTGAGGCGGGGGCAGGG + Intergenic
1089808468 11:121112974-121112996 CTGTGGGTGGGGAGGGCGCAGGG + Intronic
1089832144 11:121338243-121338265 CTGGGGTCTTGGAGCAGGCAGGG - Intergenic
1090005520 11:122998943-122998965 CTGCTGTTGTGGTGGGAGCAGGG - Intergenic
1090558090 11:127898582-127898604 CTTGGGTGGTGGATGGGGCCGGG + Intergenic
1090663049 11:128895378-128895400 CTGGGGTTGGGGGGGGGGTGGGG - Intronic
1091208855 11:133839530-133839552 GTGGGGTAGGGGAGGGGGGAGGG + Intergenic
1091227476 11:133966214-133966236 CTGGGGCAGTGGTGGGGGCGGGG + Intergenic
1091409562 12:230139-230161 CAGGGCTCGTGGAGTGGGCAGGG - Intronic
1091663454 12:2401237-2401259 CTGGGCCTGGGCAGGGGGCAGGG - Intronic
1091773946 12:3172211-3172233 CTGGGGTGGGGGCGGGGGAAGGG - Intronic
1092063526 12:5570344-5570366 CTGGGGTTGGGCAGGGGTTAGGG + Intronic
1092879316 12:12875706-12875728 CTGGGGGCCTGGAGGGGGTAGGG - Intergenic
1092961257 12:13598619-13598641 TTGGGGTGGTGGAGGGGGTGGGG - Intronic
1093112667 12:15170332-15170354 CTGGGTGTGTGTAGGGGGAAGGG + Intronic
1093130595 12:15387360-15387382 CCGGGGTTGGGGAGGGGGGTGGG + Intronic
1093569996 12:20655797-20655819 TTGGGGTTGAGAAGGGAGCAAGG + Intronic
1094398582 12:30036219-30036241 TTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1094491682 12:30964596-30964618 CTGGGGTTAGGAAGTGGGCAGGG - Intronic
1094555725 12:31497866-31497888 GAGGGGCAGTGGAGGGGGCAGGG + Intronic
1094807154 12:34105686-34105708 CTGGGCTTGTGGCCGGGACAAGG + Intergenic
1094843565 12:34351832-34351854 GTGGGGTGGGGGAGGGGGCAGGG + Intergenic
1095339150 12:41067616-41067638 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1095417381 12:41991404-41991426 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1095511843 12:42959557-42959579 CCAGGGTGGTGGAAGGGGCAAGG - Intergenic
1095883291 12:47162112-47162134 GTGGGGTGGTGGGGGGGGGAAGG + Intronic
1096073791 12:48789568-48789590 CTGGGGCTGGGGCAGGGGCAGGG - Intergenic
1096073861 12:48789808-48789830 GGGGGGTTGTGGGGGCGGCAGGG - Intergenic
1096156666 12:49345149-49345171 CTGGGCTGGGGGAGGGGGCGTGG + Intergenic
1096196474 12:49651940-49651962 TGGGGGAGGTGGAGGGGGCAAGG + Exonic
1096227669 12:49877027-49877049 GTAGGGTTGTGGAGTGGGGAGGG - Intronic
1096257977 12:50074315-50074337 CTGGGGTTGGGGCTGGGGCTGGG + Intronic
1096358884 12:50966503-50966525 CTGAGGGTGTGGAGGTGGGAAGG - Intronic
1096371942 12:51076138-51076160 CTGGGACTCTGGTGGGGGCAGGG + Intronic
1096432597 12:51559728-51559750 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1096466371 12:51849150-51849172 CTGGGGTTGGGGTGGGGGTCGGG + Intergenic
1096551379 12:52375569-52375591 CAAGGGTTGTGGAGGGGGGAGGG - Intergenic
1096574802 12:52545990-52546012 ATGGGGTTTTGCAGGGAGCAGGG + Intronic
1096589565 12:52648654-52648676 CTTGGGTTGGGGAGGGGGATAGG + Intronic
1096602322 12:52738180-52738202 CGGGGGGTGGGGAGGGGGGAGGG + Intergenic
1096610385 12:52797127-52797149 CTGGGGTTTGTGAGGGGGCATGG - Intergenic
1097040262 12:56152286-56152308 CTCGGGAGGTGGAGGGGGCGGGG - Exonic
1097040342 12:56152593-56152615 CTGGGGCTGGGGAGGGGGCGGGG - Exonic
1097050716 12:56221642-56221664 CTGGGGTTCAGGAGGAGGGATGG - Intronic
1097067025 12:56328180-56328202 CTGAGGTTGTTGCGGGGGCAGGG - Intronic
1097472804 12:60016764-60016786 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1098396950 12:70029060-70029082 ATGGGGTTAGGGAGGTGGCAGGG + Intergenic
1098890979 12:76010586-76010608 CTGGGGCTGAGGAGAGGGCTTGG + Intergenic
1098893203 12:76030734-76030756 CTGGGGTTGTGATTGGGGCTGGG + Exonic
1099144212 12:79018343-79018365 GTGGGGTAGGGGAGGGGGGAGGG + Intronic
1099668562 12:85660826-85660848 CTGAGTTTTTGGAGGGGCCAGGG + Intergenic
1099795998 12:87399901-87399923 GTGGGGTGGGGGAGGGGGAAGGG + Intergenic
1099937906 12:89149877-89149899 CTGTTGTTGGGTAGGGGGCAGGG + Intergenic
1099944102 12:89224551-89224573 CTGAGAATGTGGTGGGGGCAGGG - Intergenic
1100259001 12:92914125-92914147 CTGAGGGTGTGGTGGGGGTAGGG - Intronic
1100266231 12:92978891-92978913 GTGGGGGTGGGGTGGGGGCAGGG - Intergenic
1100388926 12:94130046-94130068 GTGGGGTTGGGGAGGGAGGAGGG - Intergenic
1101587903 12:106101137-106101159 CTGGGGGCGTGGTGGGGGCAAGG - Intronic
1101719917 12:107342261-107342283 AGGGGGTGGTGGAAGGGGCATGG + Intronic
1102047611 12:109839817-109839839 GCGGGGTTGGGGAGGGGTCATGG - Intergenic
1102247223 12:111362996-111363018 CTGGGGCTGGGGCTGGGGCAGGG + Exonic
1102309010 12:111829302-111829324 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1102505371 12:113381241-113381263 GTGGGGATGTGGGGGGGGCGGGG - Intronic
1102535349 12:113576779-113576801 CAGGGGGCGTGGTGGGGGCAGGG + Intergenic
1102561032 12:113762507-113762529 CCGGGGTTGTGGCGGGGGAGGGG - Intergenic
1103419247 12:120766863-120766885 CTGGGGTTGAGGAGGACGTACGG + Intronic
1103602089 12:122060637-122060659 CTGGGGGTGGGGTGGGGTCATGG + Exonic
1103703125 12:122858279-122858301 CTGGGGATGGGAAGGAGGCAGGG - Intronic
1103747138 12:123132674-123132696 CAGGGGTTGGGGAGGGGAGATGG - Intronic
1103917846 12:124385186-124385208 CTGTGCTTGTGGAGGAGGGAAGG + Intronic
1103972674 12:124681912-124681934 CAGGGGCTTTGGAGGGAGCAGGG - Intergenic
1104053296 12:125210631-125210653 CAGGGGAGGTGGAGGGGACAGGG + Intronic
1104067589 12:125318255-125318277 CTGTGGTTGGGGAGGGACCACGG + Intronic
1104468603 12:129009951-129009973 CTGGGGCAGAGGAGGGGGTAAGG + Intergenic
1104685207 12:130780465-130780487 CTGTGGTTCTGCATGGGGCAGGG - Intergenic
1104712282 12:130995278-130995300 CTGGGGTTGTTGGGTGGGGATGG + Intronic
1104843319 12:131834763-131834785 ATGGGGTGGTGGTGGTGGCAAGG - Intronic
1105214764 13:18277719-18277741 CTGGGGGTGGGGCGGGGGGAGGG + Intergenic
1105223707 13:18408378-18408400 CTCAGGTTGAGGAGGGGCCAGGG + Intergenic
1105239520 13:18597683-18597705 CGCAGGTTGTGGAGGGGCCAGGG - Intergenic
1105448518 13:20477458-20477480 TTGGGGTTGGAGAGCGGGCATGG + Intronic
1105682682 13:22745271-22745293 CTAGGGTTGTGGCCGGGGCAGGG + Intergenic
1105686881 13:22792912-22792934 CTCGGGATGTGGAGGGAGAAAGG + Intergenic
1105852439 13:24347820-24347842 TTGGGGGGGTGGAGGGGGGAGGG + Intergenic
1106351707 13:28936990-28937012 CTGGGGTTGTGGAGGAAATAGGG + Intronic
1106361155 13:29031797-29031819 CTGGGATAGTGGTGGGGGAAGGG - Intronic
1106468153 13:30031183-30031205 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1107760623 13:43674567-43674589 CAGGGGTTGTGGGGGAGGGAAGG + Intronic
1107802580 13:44123209-44123231 GTGGGGTTGGGGAGGGCGGAGGG - Intergenic
1107958643 13:45540527-45540549 CTGGAGTGGTGGTGGTGGCAGGG + Intronic
1107978937 13:45715908-45715930 CTGGGGTTGGGGAGAGCACAGGG - Intergenic
1107986455 13:45780621-45780643 CTGGGATAGTTGAGGGAGCAGGG - Exonic
1108171041 13:47742185-47742207 CTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1108457206 13:50628520-50628542 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
1108707340 13:53001534-53001556 CTAGGTTAATGGAGGGGGCAGGG + Intergenic
1109308051 13:60662168-60662190 CTGGGGGGGTGGGGGTGGCAGGG - Intergenic
1109529568 13:63624045-63624067 ATGGGGTTGTGGTGGTGGGAAGG + Intergenic
1109668047 13:65564944-65564966 GTGGGGTGGGGGAGGGGGAAAGG + Intergenic
1109772935 13:67000331-67000353 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1109867497 13:68284407-68284429 CTTGGGGTGGGGAGGGGGGAGGG + Intergenic
1110056209 13:70976002-70976024 CTTGGGTTGTAGATGGGGCTTGG - Intergenic
1110459039 13:75723971-75723993 CTCTTGTTGTGGAAGGGGCAAGG + Intronic
1110662963 13:78080015-78080037 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1110671971 13:78191267-78191289 GTGGTGCAGTGGAGGGGGCATGG - Intergenic
1110735319 13:78929125-78929147 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1110897674 13:80775915-80775937 GTGGGGTGGGGGAGGGGGGAAGG - Intergenic
1111436467 13:88216249-88216271 CTGGTGTTTTAGAGGGAGCATGG + Intergenic
1111580803 13:90220658-90220680 GTGGGGGTGGGGAGGGGGGAGGG + Intergenic
1112100612 13:96184733-96184755 CTGAGGCTGGGGTGGGGGCAGGG - Intronic
1112151730 13:96772066-96772088 CTGGGTTTGTGATGGGGCCAGGG + Intronic
1112448714 13:99490406-99490428 GGGGGGTTGGGGAGGGGGCAGGG + Intergenic
1112664585 13:101554742-101554764 CTGGGGTGGGGCAGGGGACAGGG + Intronic
1113059170 13:106302601-106302623 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1113264186 13:108598995-108599017 CTGGGGATGGGGTGGGGGGAGGG - Intronic
1113590531 13:111496249-111496271 GTGGGGTGGGGGAGGGGGGAAGG - Intergenic
1113769447 13:112898907-112898929 ATGGGGTGGTGGTGGGTGCAGGG - Intronic
1113788637 13:113015949-113015971 TTGGGGTTGTGAAAGGGGCGGGG - Intronic
1113830301 13:113290536-113290558 CTGGGGTTGGGCTGGGGCCATGG - Intergenic
1114004052 14:18292968-18292990 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1114064891 14:19052753-19052775 CGCAGGTTGTGGAGGGGCCAGGG - Intergenic
1114097370 14:19347249-19347271 CGCAGGTTGTGGAGGGGCCAGGG + Intergenic
1114559771 14:23581093-23581115 CTTGGGTGGTGGATGGGACAGGG - Intergenic
1114597041 14:23921650-23921672 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1114613942 14:24058629-24058651 CAGGGGTTGGGGTGGGGGTAGGG - Intronic
1114777333 14:25498659-25498681 CTGGGGTGGGGGAGGGGGGATGG + Intergenic
1115475073 14:33805714-33805736 CTGGGGCTGAGGAGGTGGCAGGG - Intergenic
1115528739 14:34306280-34306302 CTGGGGTGGGGGCGGGGGCGGGG + Intronic
1115659395 14:35477120-35477142 CTGGGGTTGTAGAGAGGAAAGGG - Intergenic
1116205863 14:41865230-41865252 ATGGAGTTGGGGATGGGGCATGG - Intronic
1116234341 14:42258493-42258515 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1116471582 14:45291810-45291832 CTGGGGTGCTGGAGGGGAAATGG + Intergenic
1117374060 14:55104739-55104761 CTGGGGCTGTGGATTTGGCAAGG + Intergenic
1117406130 14:55405880-55405902 GTGGGGTGGCGGGGGGGGCAGGG + Intronic
1118096759 14:62546153-62546175 GTGGGGGTGGGGAGGGGGGAGGG - Intergenic
1118104532 14:62642548-62642570 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1118326676 14:64786102-64786124 CTGGGGTAGGGGTGGGGGCAAGG - Intronic
1118578888 14:67273264-67273286 GTGGGGTTGGGGAGGTGGGAGGG - Intronic
1118878446 14:69805016-69805038 CTTAGATGGTGGAGGGGGCAAGG - Intergenic
1118883515 14:69848605-69848627 CTAGGGGTGTGGAGGGGGTTTGG + Intergenic
1119391520 14:74294383-74294405 GTGGGGTTGTGAGGTGGGCAGGG - Intronic
1119548983 14:75494340-75494362 TTGGGGGTGGGGATGGGGCAAGG + Intergenic
1119704667 14:76776305-76776327 CTGGGGCGGGGGAGGGGGCGAGG - Intronic
1120023644 14:79557312-79557334 CTAGGTTTTTGCAGGGGGCAGGG - Intronic
1120586934 14:86323087-86323109 CTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1120620058 14:86752246-86752268 ATGAGGTTTTGGAGGGGCCAAGG - Intergenic
1120704995 14:87736547-87736569 CAGGGGGTGTGGTGGGGGGAAGG - Intergenic
1120733962 14:88033086-88033108 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1120916467 14:89714958-89714980 CTCATGTGGTGGAGGGGGCAAGG + Intergenic
1120968628 14:90189627-90189649 CTGGGGTTGGGGAGGAGGTCAGG + Intergenic
1121085416 14:91142543-91142565 CTGGGGCTTAGGTGGGGGCAGGG - Intronic
1121092800 14:91194498-91194520 CTGAGGTTAGGGAGGGGGGATGG + Intronic
1121359796 14:93246116-93246138 GGGAGGTGGTGGAGGGGGCAAGG + Exonic
1121449471 14:93998252-93998274 CTGGGGCTGGGGCTGGGGCAGGG - Intergenic
1121573395 14:94964294-94964316 CTGGGGTGGGGGCAGGGGCAAGG - Intergenic
1121667361 14:95683637-95683659 ATGTGGTGGTGGTGGGGGCAGGG - Intergenic
1121855025 14:97260174-97260196 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1122136333 14:99635081-99635103 GTGGGTTTGGGGTGGGGGCAGGG + Intergenic
1122142661 14:99672150-99672172 CTGGGGGCATGGAGTGGGCAGGG + Intronic
1122217338 14:100212997-100213019 TTGGGGTGGCAGAGGGGGCAGGG + Intergenic
1122338189 14:101007444-101007466 GTGGGGTTTTGCAGGGAGCAGGG - Intergenic
1122631621 14:103109856-103109878 CTGTGCTGGGGGAGGGGGCAGGG - Intronic
1122853416 14:104548630-104548652 CTGGGGCTGGGGTGGGGGCAGGG - Intronic
1122853464 14:104548744-104548766 CTGGGGCAGGGGTGGGGGCAGGG - Intronic
1122853482 14:104548786-104548808 CTGGGGCGGGGGTGGGGGCAGGG - Intronic
1122853502 14:104548828-104548850 CTGGGGCGGGGGTGGGGGCAGGG - Intronic
1122900699 14:104781236-104781258 CAGGGGTTAGGGAGGGGGCCAGG + Intronic
1123047998 14:105527742-105527764 CTGGGGCTGTGGAGGGGGTGAGG + Intronic
1202875568 14_GL000225v1_random:205655-205677 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1202878046 14_KI270722v1_random:26873-26895 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1123491726 15:20786401-20786423 CGCAGGTTGTGGAGGGGCCAGGG + Intergenic
1123548228 15:21355495-21355517 CGCAGGTTGTGGAGGGGCCAGGG + Intergenic
1123979019 15:25582183-25582205 CTCGGATTGAGAAGGGGGCAAGG + Intergenic
1124071999 15:26403964-26403986 CTGGGCTTGTGGGTGGTGCAAGG + Intergenic
1124554372 15:30711305-30711327 CTGGGCTTGTGAAGGGTGGAGGG + Intronic
1124676874 15:31694372-31694394 CTGGGCTTGTGAAGGGTGGAGGG - Intronic
1124886277 15:33689221-33689243 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1125060105 15:35409187-35409209 CTGGGGTTGGGAGGGAGGCAGGG + Intronic
1125473764 15:40030109-40030131 GGGGGGTGGTGGAAGGGGCAGGG - Intronic
1125535959 15:40441281-40441303 CCGGGGTCGAGGAGGGGGAAGGG + Intronic
1125756856 15:42070529-42070551 CTGGGGTGGTGCAGGGGCCTTGG - Intronic
1126143354 15:45455175-45455197 CTGGGGGTGGGGAGGAGGCAGGG - Intergenic
1126863548 15:52912557-52912579 CTGGTGTTGGGGAGGTGGAATGG + Intergenic
1127221255 15:56883960-56883982 GTGGGATTGGGGAGGGTGCAGGG - Intronic
1127492415 15:59477714-59477736 ATAGGGTTCTGGAAGGGGCAAGG - Intronic
1127658417 15:61077214-61077236 CAGGGGGTGTGGTGGGGGCAAGG + Intronic
1127828987 15:62733166-62733188 ATGGAGCTGTGGAGAGGGCAGGG + Intronic
1128217413 15:65944142-65944164 CTGGGGGTTAGGAGGTGGCAGGG + Intronic
1128227057 15:66009336-66009358 ATGGGGGTGGGGAGGGTGCAGGG + Intronic
1128234187 15:66056262-66056284 GAGGGGCTGTAGAGGGGGCAGGG + Intronic
1128257562 15:66209744-66209766 CTGGGGTTTAGGAAGGGGTAAGG + Intronic
1128354116 15:66912635-66912657 ATGGGGATGTGCAGGGGCCAGGG - Intergenic
1128448451 15:67785635-67785657 CTGGAGGTGTGGAGGCAGCAGGG + Intronic
1128523418 15:68390547-68390569 CTGGGGCTGTGGGGGAGGCCAGG - Intronic
1128566082 15:68701043-68701065 GTGGGGGTGTGCAGGAGGCAGGG - Intronic
1128705960 15:69837618-69837640 CTGGGATGCTGGAGGGGTCAGGG + Intergenic
1128869082 15:71138648-71138670 TTGGCCTTGTGGAGGGGGGAGGG - Intronic
1129013380 15:72443220-72443242 ATGGGGTGGGGGAGGGGGGAGGG + Intergenic
1129150193 15:73683804-73683826 CTGGGGTGGGGCTGGGGGCAGGG + Intergenic
1129160103 15:73742635-73742657 CTGGGCTTGGGCAGGCGGCAGGG + Intronic
1129325025 15:74795245-74795267 CTGGGGGTGTGAAGTAGGCACGG - Intronic
1129394227 15:75235538-75235560 CAGAGGCTGGGGAGGGGGCAGGG - Intergenic
1129792356 15:78349835-78349857 CTGGGCTGGGGGAGGGGGGAAGG - Intergenic
1130093491 15:80839878-80839900 CTAGGGTTGTTGTGAGGGCAAGG - Intronic
1130184617 15:81668622-81668644 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1130257320 15:82331867-82331889 CTAGGGCTGGGGAGGGGACAGGG - Intergenic
1130862543 15:87903918-87903940 CTGAGGTTGTGGAGAGGGTCTGG - Intronic
1131022354 15:89109458-89109480 CTGGGTTTGGGGTGGGGGTAGGG + Intronic
1131056096 15:89376030-89376052 CTGGGGTAATGGAGAGGACAAGG - Intergenic
1131090672 15:89622695-89622717 CTGGGGAGGTGGAGCGGGGAGGG - Intronic
1131121136 15:89824011-89824033 CTGGTTCTGTGGAGGGGGCTGGG - Intergenic
1131121200 15:89824273-89824295 CAGAGGTTGTGGTGAGGGCAGGG - Intergenic
1131285516 15:91053781-91053803 CTGGGGTTAGGGAGGGGTGAAGG - Intergenic
1131373463 15:91903920-91903942 GTGTGCTTGTGGAGAGGGCAGGG + Intronic
1131832869 15:96365581-96365603 GTGGGGTGGGGGCGGGGGCAGGG - Intergenic
1131884642 15:96898707-96898729 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1132072848 15:98794929-98794951 CTGGGGTTGGGGAGGTGTCAAGG - Intronic
1132296633 15:100739915-100739937 CAAGGGTTAAGGAGGGGGCAGGG - Intergenic
1132301490 15:100779023-100779045 GTGGGGGTGGGGAGGAGGCAGGG - Intergenic
1202956560 15_KI270727v1_random:82725-82747 CGCAGGTTGTGGAGGGGCCAGGG + Intergenic
1132727544 16:1345481-1345503 CTGGGGTTGAGGGGGAGGCTGGG - Intronic
1132727557 16:1345508-1345530 CTGGGGTTGCGGAGGAGGCCGGG - Intronic
1132727577 16:1345562-1345584 CTGGGGTTGCTGAGGAGGCTGGG - Intronic
1132727582 16:1345580-1345602 CTGGGGTTGCGGGGGAGGCTGGG - Intronic
1132727590 16:1345598-1345620 CTGGGGTTGCTGAGGAGGCTGGG - Intronic
1132727595 16:1345616-1345638 CTGGGGTTGTGGGGGAGGCTGGG - Intronic
1132727608 16:1345643-1345665 CTGGGGTTGCGGAGGAGGCCGGG - Intronic
1132727614 16:1345661-1345683 CGGGGGTTGTGGGGGAGGCTGGG - Intronic
1132738073 16:1397296-1397318 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738157 16:1397557-1397579 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738186 16:1397644-1397666 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738215 16:1397731-1397753 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738244 16:1397818-1397840 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132808827 16:1788060-1788082 CGGGGGTTGCAGAGGGGGCGAGG + Intronic
1132896177 16:2230400-2230422 CTGGGGTTGGGGGTGCGGCAGGG + Intronic
1133215247 16:4288358-4288380 TTGGGGTGGTGGCGGGGGCAGGG + Intergenic
1133630497 16:7615711-7615733 CTTGGGTGGTGGTGGGGGCGGGG + Intronic
1133768486 16:8854347-8854369 CTGGGGTGGTGGTGGTGGGAAGG - Exonic
1133770120 16:8862933-8862955 CTTGGGGTGTTGAGGGGGCTTGG - Intronic
1134219014 16:12338775-12338797 CTGGGGGTGGGGATGGGGTAGGG - Intronic
1134414240 16:14029989-14030011 CTGGGCATGGGGAGGGGGGAGGG + Intergenic
1134792685 16:17004387-17004409 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1136026959 16:27474731-27474753 CTGGGGTGGCAGAGGGCGCACGG + Intronic
1136073956 16:27805227-27805249 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136073985 16:27805292-27805314 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136073999 16:27805324-27805346 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074013 16:27805356-27805378 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074027 16:27805388-27805410 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074071 16:27805486-27805508 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074085 16:27805518-27805540 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074099 16:27805550-27805572 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074128 16:27805615-27805637 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074142 16:27805647-27805669 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074171 16:27805712-27805734 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074185 16:27805744-27805766 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136173373 16:28501946-28501968 CTGGGGTGGTGGAGGGTGGCCGG + Intronic
1136349985 16:29700559-29700581 TTGGGGTTGGGGTGGGGGCGGGG + Intergenic
1136398090 16:30003977-30003999 CTGGGGTGGTGTGGGGGCCAGGG - Intronic
1136428478 16:30184149-30184171 CTGTGGTGGGGGAGGAGGCAGGG + Intronic
1136499757 16:30664445-30664467 CAGGGGTGGGGGTGGGGGCAGGG - Exonic
1136543758 16:30943863-30943885 GGGCTGTTGTGGAGGGGGCATGG - Intronic
1136579550 16:31143237-31143259 CAGGGGGTGTGGGGGGGGCGGGG - Intronic
1137451471 16:48578325-48578347 CTAGGGCTGGTGAGGGGGCAAGG - Intronic
1137491673 16:48938163-48938185 CTGGGCTTGAGGAGGCAGCAAGG - Intergenic
1137628913 16:49928339-49928361 GTGGGGATGTGGAGGGCCCAAGG - Intergenic
1137639699 16:50017817-50017839 CTGGGGAGGTGGTGGGGGGATGG - Intergenic
1138203078 16:55104527-55104549 AAGGGCTTGTGGAGGGTGCAAGG + Intergenic
1138446365 16:57066649-57066671 CTGGTGTTGGGGAGGGGGCAGGG + Intronic
1138624542 16:58238708-58238730 CTTGGGATATGGAGGGGGCAGGG - Intronic
1138788140 16:59870385-59870407 GTGGGGTGGGGGAGGGGGAAGGG - Intergenic
1138892397 16:61160394-61160416 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1139272847 16:65699823-65699845 GTGGGATGGGGGAGGGGGCAGGG - Intergenic
1139337858 16:66245660-66245682 GTGGGGGTGAGGAGGGAGCAAGG - Intergenic
1139365412 16:66429435-66429457 CTGGGATCCTGGAGGTGGCAAGG + Intronic
1139428592 16:66898918-66898940 ATGGGGTTGAAGAGTGGGCAGGG - Intergenic
1139851065 16:69951821-69951843 CTGGGGTTGGGGTGGCGGGAGGG - Intronic
1139880045 16:70174733-70174755 CTGGGGTTGGGGTGGCGGGAGGG - Intronic
1139960381 16:70714137-70714159 CGGGGGTCGGGGAGGGGGCTGGG + Intronic
1140149340 16:72345987-72346009 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1140340743 16:74157477-74157499 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1140372466 16:74420784-74420806 CTGGGGTTGGGGTGGCGGGAGGG + Intronic
1140749145 16:78007680-78007702 CTGGGGAGGTGGAGGTTGCAGGG - Intergenic
1140892245 16:79295085-79295107 TGGGGGTGGGGGAGGGGGCAGGG + Intergenic
1141512135 16:84519356-84519378 CTGGGGTTGGGGTGGGGGAGAGG - Intronic
1141576085 16:84964246-84964268 GTGGGGTTGACGAGAGGGCATGG + Intergenic
1141636682 16:85317645-85317667 CGGGGGCTGTGCAGGGCGCATGG - Intergenic
1141997938 16:87647121-87647143 CTGGGGTTTTGGGGGGCCCAGGG + Intronic
1142073599 16:88104635-88104657 CTGGGGTGGTGCAGGCTGCATGG - Intronic
1142233156 16:88909200-88909222 CTGGGGCTGTGGTGCAGGCAGGG + Intronic
1142614112 17:1125138-1125160 CTGGGTTTGGGGAGGGGTGACGG - Intronic
1142748738 17:1974712-1974734 GTGGGGGTGGGGAGGGGGGAGGG + Intronic
1142888705 17:2929300-2929322 AAGAGGCTGTGGAGGGGGCAGGG + Intronic
1142894395 17:2964502-2964524 CTGGGATAGGGGACGGGGCAGGG + Intronic
1143119879 17:4599931-4599953 CTCCAGCTGTGGAGGGGGCAGGG + Intronic
1143176651 17:4959485-4959507 CTGGGGCAGGGCAGGGGGCAGGG - Exonic
1143293255 17:5849698-5849720 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1143430903 17:6883511-6883533 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1143544406 17:7588018-7588040 CTGGGGTGGGGGAAGGGGGACGG + Exonic
1143583299 17:7838693-7838715 CTGCGGTTGTGCTGGGGGGAGGG - Intergenic
1143619650 17:8073576-8073598 CTGGGTTTGAGGTTGGGGCATGG + Intronic
1143901947 17:10181069-10181091 CGGGGGTGGCGGTGGGGGCACGG + Intronic
1144102495 17:11954222-11954244 ATGGGGTTGTTGATGGGGAAGGG + Intronic
1144490399 17:15704125-15704147 CTGGGGTCGGGGAGGGTACAGGG - Intronic
1144910568 17:18677844-18677866 CTGGGGTCGGGGAGGGTACAGGG + Intronic
1145375229 17:22341003-22341025 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1145794050 17:27645395-27645417 CTGGGCTCATGGAGGAGGCAGGG + Intronic
1145808851 17:27752930-27752952 CTGGGCTCATGGAGGAGGCAGGG + Intergenic
1145814347 17:27784836-27784858 CTGGGGGTGTGAACGGGGAATGG - Intronic
1145830132 17:27909440-27909462 ATGGGGCTGTGGAGAGGGCAGGG - Intergenic
1145990643 17:29077507-29077529 CTGGCTTTGGGGTGGGGGCATGG - Exonic
1146127451 17:30240035-30240057 ATGGGGTTGTGGAAGCAGCAGGG - Intergenic
1146196007 17:30813748-30813770 CTGGGTGTGGGGAGGGGGGAGGG - Intronic
1146366482 17:32232993-32233015 CTGGGGTGGGGGTGGGGGAAGGG - Intronic
1146431588 17:32801398-32801420 CTGGGCTGGTGGTGGGGCCAGGG + Intronic
1146440890 17:32893725-32893747 TTGGGGGTGGGGTGGGGGCATGG + Intergenic
1146650185 17:34601778-34601800 CTGGGGTTTTGGGGTGGGGAAGG - Intronic
1146658688 17:34650261-34650283 CAGGGGTTGGGGGCGGGGCAGGG + Intergenic
1146913235 17:36661321-36661343 CTGATGATGGGGAGGGGGCAGGG + Intergenic
1146942265 17:36851646-36851668 CAGGGGGTGGGGATGGGGCAGGG - Intergenic
1147035940 17:37680771-37680793 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1147038405 17:37699034-37699056 CGGGGGTTGGGGTGTGGGCAGGG - Intronic
1147110227 17:38256689-38256711 CTGGGGCTGGGGCCGGGGCAGGG - Intergenic
1147576128 17:41600077-41600099 CTGGGTTTGGGGTGGGGGCAGGG - Intergenic
1147578036 17:41613726-41613748 CTGGGAGTGTGGGGGGCGCAGGG - Intronic
1147614905 17:41822042-41822064 CTGGGGTCCTGGTGGGGGCTGGG - Intronic
1147625531 17:41897472-41897494 ATGGGGGTGTGGACTGGGCAGGG - Intronic
1147656874 17:42096172-42096194 CAGGGGCTGTGGATGGAGCAAGG - Intergenic
1147708033 17:42441552-42441574 CTGGGGTGTTGGGGGTGGCAGGG - Intergenic
1147842468 17:43381728-43381750 GTGGGGCTGGGCAGGGGGCAGGG - Intergenic
1147881392 17:43656387-43656409 CAGGGGTAGTGGAGGGGACCTGG + Intronic
1147885741 17:43683301-43683323 CTGGGGTTGTGGGCAGGCCAGGG - Intergenic
1147976571 17:44251368-44251390 CTGGGGTGGTAGAGGGTGCTGGG - Intronic
1148053837 17:44781921-44781943 CTGGGGTGCTGGAGGCGGGAAGG + Intergenic
1148419279 17:47531730-47531752 CTGGGGCTGGGGCCGGGGCAGGG + Intronic
1148442938 17:47721144-47721166 CTGGAGGGGTGGAGGGGGAAGGG + Intergenic
1148749975 17:49940087-49940109 CTGGGAGTAGGGAGGGGGCAGGG + Intergenic
1148829603 17:50422756-50422778 TTGGGGGTGTGGTGGGGGAATGG - Intergenic
1148943598 17:51238078-51238100 CTGGGGATGGGGTGGGGGCCAGG + Intronic
1149170831 17:53809358-53809380 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1149654029 17:58300997-58301019 CTGGGGTTGTGGAGGAAGATGGG - Intergenic
1150007670 17:61479683-61479705 CTGGGGTTGGGGAGGAGGGAAGG + Intronic
1150074219 17:62179031-62179053 CTGTGGTATTGGCGGGGGCAAGG - Intergenic
1150123043 17:62619109-62619131 CTGGGGATGGAGAGAGGGCACGG + Intergenic
1150160527 17:62894105-62894127 CTCAGGTTGGGGAGGGGCCAGGG + Intergenic
1150422378 17:65049692-65049714 CTGGGGAAAGGGAGGGGGCATGG + Intronic
1150947568 17:69765300-69765322 CTGGGGGAGGGGAGGGGGAAGGG - Intergenic
1151175207 17:72282433-72282455 CTGGGGATGTGGAGGGTGTGCGG - Intergenic
1151177636 17:72301807-72301829 CTGGGGTCAGGGTGGGGGCAGGG + Intergenic
1151438684 17:74114463-74114485 CTGGGGAGGGGGTGGGGGCAGGG + Intergenic
1151536587 17:74742309-74742331 CTGGAGTTGGGGAGGGAGGATGG + Intronic
1151575841 17:74952224-74952246 CGGGGGTTGTGGGCGGGGCCGGG - Intronic
1151660657 17:75516442-75516464 CTGGGGCGGTGCAGGGGGCGGGG + Intronic
1151696354 17:75720102-75720124 CTTGGGGTGTGGAGAGGTCAAGG + Intergenic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1151946684 17:77323518-77323540 CCGGGGTCCTGGAGGGGGCTTGG + Intronic
1151972787 17:77467438-77467460 CTGGGGTTGGGGAGTGGGCGGGG + Intronic
1152111529 17:78359921-78359943 CCGGGGGTGCGCAGGGGGCAGGG - Exonic
1152190260 17:78883806-78883828 CTGGGGTTGGGGAGGGCGGCAGG - Intronic
1152250944 17:79212259-79212281 CTGGGGCTGGGGCTGGGGCAGGG + Intronic
1152279789 17:79378608-79378630 CTGGGGCTGTGTGGGGGGCCCGG + Intronic
1152306607 17:79524631-79524653 CTGGGAGTGTGGAGCAGGCACGG + Intergenic
1152315490 17:79578107-79578129 CTGGGGTAGTGGTGGAGGGAAGG + Intergenic
1152391513 17:80006501-80006523 CGGGGGATGGGGATGGGGCAAGG + Intronic
1152580941 17:81165454-81165476 CGGGGGATGTGGGGGGAGCAGGG - Intronic
1152599201 17:81253036-81253058 CTGGGGGTGCGGATGGGGAAGGG - Intronic
1152942930 17:83181956-83181978 CTGGGGGGGTGCAGGGGGGATGG + Intergenic
1153210548 18:2758796-2758818 CAGGGGATGGGGTGGGGGCAGGG - Intronic
1153342590 18:3990483-3990505 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1153583640 18:6599823-6599845 CTGGGGCGGGGGAGGGGGTAGGG - Intergenic
1153769080 18:8401033-8401055 CTGGGGGTGGGGAGAGGGGATGG - Intronic
1154173060 18:12064315-12064337 CTGGGGTTGGGGAGAGGGAGAGG - Intergenic
1154297930 18:13166280-13166302 CTGCTGTGGTGGAGGTGGCAGGG - Intergenic
1154326636 18:13395755-13395777 CTGGCGTGGGGGTGGGGGCATGG + Intronic
1154449274 18:14460938-14460960 CGCAGGTTGTGGAGGGGCCAGGG + Intergenic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1154529597 18:15330695-15330717 CTCAGGTTGAGGAGGGGCCAGGG - Intergenic
1155168236 18:23248107-23248129 CTGCGGCTCTGGAGGGGGCAAGG - Intronic
1155248770 18:23936379-23936401 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1155312011 18:24533125-24533147 CTGGGGTTGGGGTGGGAGTAGGG + Intergenic
1155342870 18:24830610-24830632 TTGGGGGTGTGAAGGGGGCTTGG - Intergenic
1155469487 18:26176111-26176133 CTGGGGTGGGTGATGGGGCAAGG + Intronic
1156262547 18:35458877-35458899 GTGGGTTTGGGGAGGAGGCATGG - Intronic
1157018618 18:43750689-43750711 GTGGGGTGGGGGAGGGGGAAAGG + Intergenic
1157222513 18:45838009-45838031 CTGGGGTAGAGGAGAGGGCTGGG - Intronic
1157294301 18:46431514-46431536 CTGGGGCTGTGGAGGGTGCAGGG + Intronic
1157566258 18:48680944-48680966 CAGTGGTGGTGGAGGGGGCGGGG + Intronic
1157727445 18:49975773-49975795 CTGGGGGTGGGGCGGGGGCCTGG - Intronic
1158190225 18:54819762-54819784 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1158312206 18:56170971-56170993 CTGGGGTTGGGGAGGGGGAAAGG + Intergenic
1158331547 18:56368212-56368234 CTGGGCTGTTGGCGGGGGCATGG - Intergenic
1158435795 18:57435226-57435248 CAGTGGCTGTGGAGGGGGCGGGG - Intergenic
1158906054 18:62012910-62012932 CTGTGGTTATGGAGAGAGCAGGG - Intergenic
1159295589 18:66482740-66482762 GTGGGGTTGGGGAGTGGGGAGGG + Intergenic
1160148747 18:76384250-76384272 TGGGGGCCGTGGAGGGGGCACGG - Intronic
1160148772 18:76384311-76384333 TGGGGGTGGTGGAGGGGGTATGG - Intronic
1160768710 19:821172-821194 CTGGGGGCCTGGAGGGGGCGGGG - Intronic
1160830848 19:1104342-1104364 CTGGGGTCGGGGAAGGGGAAGGG + Intronic
1160831203 19:1105585-1105607 CTGGGAGTGTGCAGGGGGCCCGG + Intronic
1160896365 19:1403968-1403990 CAGGGGCTGGGGAGGGGACAGGG + Intergenic
1160981303 19:1817815-1817837 CGGGGGCTGTGGAGTGGGCCTGG - Intronic
1161055378 19:2188332-2188354 CTGGGGCTGGGGTGGGAGCAGGG + Intronic
1161147048 19:2685171-2685193 CAGGGGCTGGGGAGGGGGCTGGG + Intronic
1161202614 19:3024449-3024471 CAGGGGTTGGGGAGGGGACGGGG - Intronic
1161236447 19:3200763-3200785 CTGGGGCTGGGGAGGGGACCAGG - Intronic
1161271310 19:3390854-3390876 CAGGGGCTGGGGAGGGGGCTGGG + Intronic
1161285669 19:3467208-3467230 CTGGGGTGGGGGGGGGGGCCTGG - Intronic
1161453065 19:4357431-4357453 ATGGGGCTGTGGGGGGAGCAAGG + Intronic
1161607413 19:5222627-5222649 CTGGGGTGGGGGTGGGCGCAAGG + Intronic
1161694575 19:5758986-5759008 ATGGGGTGTTGGAGGGGACATGG - Intronic
1161741207 19:6022126-6022148 CAGGGGTTGTGGGAGGCGCAGGG + Intronic
1161749496 19:6084518-6084540 CAGGGGCTGGGGAGGGGGTAGGG - Intronic
1161779613 19:6282744-6282766 CAGGGGGTGTGGTGGGGGGAGGG + Intergenic
1161928963 19:7323408-7323430 CAGGGGCTGGGGAGGGGGGATGG - Intergenic
1161981694 19:7633375-7633397 CTGGGGGTGGGGTGGGGGCAGGG + Intronic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162303884 19:9859800-9859822 CTGGGATTGGGGTGGGGGGAAGG - Intronic
1162344539 19:10111622-10111644 CTGGGGATGGGGCTGGGGCAGGG + Exonic
1162913392 19:13861930-13861952 CCGGGGGTGTGTAGGGGGGAGGG + Intergenic
1162927012 19:13935871-13935893 CTGGGGAAGTGGTGGGGCCAAGG - Intronic
1162979245 19:14228019-14228041 CTGGCGCGGTGGAGGGGGCGTGG + Intergenic
1163029850 19:14537086-14537108 CTGAGGAGGAGGAGGGGGCAGGG + Intronic
1163093828 19:15041298-15041320 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1163233061 19:16016704-16016726 CTGGGGATGCAGATGGGGCAGGG - Intergenic
1163270843 19:16252554-16252576 CTGGGGCTGTGAGGAGGGCACGG + Intergenic
1163401278 19:17094488-17094510 TTGGGGATGTGGAGTGGGGAGGG - Intronic
1163423472 19:17227983-17228005 CTGGCTTTGGGGTGGGGGCAGGG - Exonic
1163510620 19:17733134-17733156 CTGGGGCTGGGGAGGGGCCGAGG - Intronic
1163514859 19:17756659-17756681 CTGGGGGTGTGTGGGGTGCATGG - Intronic
1163655740 19:18543726-18543748 CTGGGGCTGGGGCGGGGGCTGGG + Intronic
1163758423 19:19120402-19120424 CGGGGCCTGGGGAGGGGGCAGGG - Intronic
1163817445 19:19475483-19475505 CTGGGGCAGTGGAGGGGGGGGGG - Intronic
1163820216 19:19492173-19492195 CAGGGGATGTGGAGGATGCAGGG + Intronic
1164327310 19:24207299-24207321 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1164421074 19:28093324-28093346 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1164496403 19:28767910-28767932 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1164517057 19:28945445-28945467 CAGGGGCTGTGGATGGGCCAGGG - Intergenic
1164713732 19:30376837-30376859 CTGGGGGTGGGGTCGGGGCAGGG - Intronic
1164767350 19:30781960-30781982 GTGGGGTTGGGGGGGGGGCCTGG + Intergenic
1164999702 19:32751098-32751120 CGGGGGGTGGGGAGGGGGGAGGG - Intronic
1165064659 19:33221869-33221891 CTTGGGTTGTGGATCCGGCAAGG + Intronic
1165091552 19:33390756-33390778 CTGGGGATGAGGAGGCTGCAGGG + Intronic
1165163480 19:33832748-33832770 CTTCCGCTGTGGAGGGGGCATGG - Intergenic
1165255688 19:34576290-34576312 ATGGGATTGAGGAGGGGGCATGG + Intergenic
1165256542 19:34579925-34579947 CTGGGGCTGAGGATGGGGCTGGG + Intergenic
1165282615 19:34810038-34810060 CGGGGGTGGTGGAGGGGAGAAGG - Intergenic
1165420852 19:35721231-35721253 CAGGGGGTGGGGAGGGGGCCGGG - Exonic
1165600184 19:37048858-37048880 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1165806359 19:38583526-38583548 GTGGGGGTGGGGAGGGAGCATGG - Intronic
1165927481 19:39335916-39335938 CTGGGGTTGGGGCTGGGGCTTGG - Intronic
1165939088 19:39406534-39406556 CTGGGGCGGAGGTGGGGGCAGGG - Intergenic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166228870 19:41414026-41414048 CTGGGGGTGTAGAGGGGACCGGG - Intronic
1166240855 19:41492359-41492381 GTGGGGTGGGGGAGGGGGGAAGG + Intergenic
1166344006 19:42154105-42154127 CTGGACTTGTGGTGGGGGGAGGG - Intronic
1166535131 19:43568765-43568787 CAGGAGTTGGGGAGGGAGCAGGG + Intronic
1166746030 19:45142280-45142302 CTGGGGACGGGGAGGGGGCACGG - Intronic
1166855447 19:45780843-45780865 CTGGGGCGGGGGAGGGGGCCAGG - Intronic
1167050616 19:47075676-47075698 CTGGGGGTGCTGAGGAGGCAGGG - Intronic
1167242260 19:48351407-48351429 CTGGGGATGGGGACGGGGCGGGG - Intronic
1167293848 19:48638195-48638217 CGGGGGGTGTGCAGGGGGCGTGG + Intronic
1167358314 19:49017122-49017144 TCGGGGTTGTGGGGGCGGCAAGG + Intergenic
1167359807 19:49024012-49024034 TCGGGGTTGTGGGGGCGGCAAGG + Exonic
1167363751 19:49044147-49044169 TCGGGGTTGTGGGGGCGGCAAGG - Exonic
1167364746 19:49048780-49048802 TCGGGGTTGTGGGGGCGGCAAGG + Exonic
1167514576 19:49915674-49915696 CTGGGGTTGAGAAAGGGGCTGGG + Intronic
1167659191 19:50786037-50786059 CTGGGGCTGGGCAGAGGGCAGGG - Intergenic
1167698202 19:51027149-51027171 CTGGGGCTGTGGAGAGGGAGTGG - Intronic
1167995561 19:53399226-53399248 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1168300315 19:55401329-55401351 CTGGGGTCGGGGAGGGTACAGGG - Exonic
1168707655 19:58479121-58479143 ATGGGGCTGTGGAGGGAGCCTGG - Intronic
1168713299 19:58513705-58513727 CTGGGGTGGTGGTGGGGGCTGGG - Exonic
1202672633 1_KI270710v1_random:6056-6078 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
925309488 2:2872336-2872358 CTGGGGAAGGGGAGGGGACAAGG - Intergenic
925654440 2:6130247-6130269 CAGGGGTTGTGGGCAGGGCAGGG + Intergenic
926095250 2:10077214-10077236 CTGGGGTTGTGCTGGGGGAGGGG - Intronic
926130909 2:10302756-10302778 CAGGGGGCGTGGAGGGGGCGGGG + Intergenic
926186125 2:10692287-10692309 CTTGGGTGGGGGATGGGGCATGG - Intergenic
926323033 2:11762254-11762276 CTGGGGTGCTAGAGAGGGCATGG - Intronic
926703504 2:15819891-15819913 CTGGGGCTGTGGGAGGGGCAAGG + Intergenic
926751045 2:16198799-16198821 CTGGGGTAATGGGGGAGGCATGG + Intergenic
926751262 2:16200394-16200416 CGGGGATGGTGGCGGGGGCAGGG - Intergenic
926776190 2:16425602-16425624 CTGGGGCTGTAGAAGGGGTAGGG - Intergenic
927108427 2:19847121-19847143 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
927145677 2:20164213-20164235 CCAGGGTTGTGGGGAGGGCAGGG - Intergenic
927153476 2:20208930-20208952 CTGTGGGTGGGGAAGGGGCAAGG - Intronic
927284454 2:21341901-21341923 TTGGGGTGGGGGAGGGGGGAGGG + Intergenic
927553577 2:24017961-24017983 CAGGGCTGGGGGAGGGGGCATGG - Intronic
927705348 2:25293283-25293305 CTGGGAGAGGGGAGGGGGCAGGG - Intronic
927787301 2:25982573-25982595 CTGGGGTGGGGCAGGGGGCGGGG + Intronic
927810097 2:26175792-26175814 CTGGGGCAGTGGAGAGGGCCCGG - Intronic
927823017 2:26285677-26285699 CTGGGGGTGGGGAGTGGGGAGGG + Intronic
927876887 2:26663008-26663030 ATGGGGTTGGGGAGTGTGCAGGG - Intergenic
927894699 2:26774272-26774294 CGAGGGCTGTGGAGGGAGCAAGG + Exonic
927904998 2:26849259-26849281 CTGGGTTTGAGGAGGGAGGACGG + Intronic
927917793 2:26947828-26947850 CAGGGGTGGTGGAGGGGGCTGGG + Exonic
928179070 2:29055010-29055032 GTGGGGTGGGGGAGGGGGGAGGG - Exonic
928332784 2:30370220-30370242 CTGGGGTGGGGCAGGGGACAGGG + Intergenic
928485600 2:31728454-31728476 CTGGGGTTGTGGGAGGGGTGGGG - Intergenic
928598495 2:32880293-32880315 ATGGGGTGGGGGAGGGGGGAGGG + Intergenic
928949984 2:36805903-36805925 CTGGGGCTGTGGAAGGAGCAAGG - Intronic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929589135 2:43133931-43133953 CTGGGGTAGGGAAGGCGGCAGGG + Intergenic
929794430 2:45047997-45048019 CAGGGGTCTTGGATGGGGCAGGG + Intergenic
930248376 2:49008168-49008190 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
930497466 2:52165009-52165031 GTGGGGTTGTGGGGGGTGGAAGG - Intergenic
930534554 2:52630139-52630161 CTGGGGGTGGGGCGGGGACAGGG - Intergenic
930607815 2:53510539-53510561 CTGGGGCTGTGGAGCTGGCTGGG - Intergenic
930774540 2:55159273-55159295 CAGTGGAAGTGGAGGGGGCAAGG - Intergenic
930870094 2:56161944-56161966 GTGGGGTTGGGGAGTGGGGAGGG - Intergenic
930999336 2:57761919-57761941 CTGGCTTTGTGGCAGGGGCATGG - Intergenic
932784881 2:74591513-74591535 CTGTGGTGGGGGAGGGAGCAGGG + Intronic
932788644 2:74632518-74632540 CTGGGGTTGAGGGGAGGGCAAGG - Intronic
933512718 2:83261743-83261765 CTGGGGGTGTGGTGGTGGCGGGG + Intergenic
933529614 2:83490082-83490104 CTGGGGTTGGGGGAGGGGGAGGG + Intergenic
933850016 2:86358574-86358596 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
933899519 2:86839668-86839690 ATGGGGTTGGGCTGGGGGCAGGG - Intronic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
934926415 2:98384767-98384789 CTGGGGCTGGGGTGTGGGCAAGG + Intronic
934959607 2:98659382-98659404 CTGGGGTCCTTGAAGGGGCAAGG - Intronic
935220096 2:101004694-101004716 CCGGGGTTGTGGCGGGGGTGGGG + Intronic
935345039 2:102100032-102100054 CAGGGGTTGGGGAGGGAGCTGGG - Intronic
935781041 2:106509558-106509580 ATGGGGTTGGGCTGGGGGCAGGG + Intergenic
935903598 2:107818742-107818764 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
935989484 2:108706123-108706145 CTGGGGTTGTGGTGGACACAGGG + Intergenic
936069736 2:109358051-109358073 CAGGGGTGGTGGAGGAGGGAGGG - Intronic
936104322 2:109612289-109612311 CTGGGGTTAAGAAGGAGGCAGGG + Intronic
936228892 2:110682223-110682245 GTGGGGTGGGGGTGGGGGCAAGG + Intergenic
936388085 2:112048175-112048197 CTTGGGAGGTGGAGGGGACAGGG + Intergenic
936506071 2:113108401-113108423 GTGGGGTGGGGGAGGGGGGACGG - Intronic
937291661 2:120785619-120785641 CTGGGCTTGGGGCAGGGGCAGGG - Intronic
937375350 2:121332471-121332493 ATGGGGTGGTGGAGAAGGCAGGG + Intergenic
937979667 2:127607540-127607562 CTTGGCTTGTGGCGGGGGCGGGG - Intronic
937986376 2:127639951-127639973 CTGGGGATATGGTGGGGACAAGG - Intronic
937988078 2:127647599-127647621 CTGGGGGTGGGAAGGGGCCAAGG - Intronic
938204732 2:129410750-129410772 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
938340127 2:130530350-130530372 CTGGGGTTCTGAAGGGGTCCAGG - Intergenic
938349709 2:130590398-130590420 CTGGGGTTCTGAAGGGGTCCAGG + Intergenic
938487142 2:131723206-131723228 ATGGGGAAGTGGACGGGGCAAGG + Intronic
938528693 2:132162137-132162159 CTCAGGTTGAGGAGGGGACAGGG - Intronic
939146769 2:138425043-138425065 CTGGGGGTGAGGGGAGGGCAAGG + Intergenic
939216940 2:139250648-139250670 CAGGGGGTGTGGTGGGGGGAGGG + Intergenic
939461288 2:142499119-142499141 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
939485431 2:142806417-142806439 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
939639029 2:144617205-144617227 CAGGGGGTGTGGTGGGGGGAGGG - Intergenic
939849949 2:147292459-147292481 TTTGGGGTGTGGAGGTGGCAGGG - Intergenic
940580198 2:155570377-155570399 ATGGGGTGGGGGAGGGGGAAGGG - Intergenic
940627229 2:156190383-156190405 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
940792035 2:158039156-158039178 CTGGGGAAGTGAAGGGGGCCTGG + Intronic
941197228 2:162467906-162467928 CTCAGGTGGTGGAAGGGGCAAGG + Intronic
942077064 2:172365686-172365708 CTGGGGGTGTGGAAAAGGCAGGG + Intergenic
942858863 2:180585761-180585783 CTGGGGTTGGGGAAGGGGGGAGG - Intergenic
943000986 2:182328626-182328648 CTGAGATTGTGGAAGGGGTACGG + Intronic
943009582 2:182430956-182430978 GTGGGGTCGGGGAGGGGGGAGGG + Intronic
943354240 2:186831874-186831896 GTGGGGTGGGGGAGGGGGAAGGG + Intronic
943358141 2:186884283-186884305 GTGGGGATGGGGAGAGGGCAAGG + Intergenic
943377569 2:187098852-187098874 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
944155613 2:196604270-196604292 CTGGGGCAGTGGAAGGGGCATGG - Intergenic
944294857 2:198050406-198050428 CTGGGGTTGTGGGGAGGGCAGGG + Intronic
944329592 2:198449950-198449972 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
944397529 2:199286026-199286048 CTTGGGTTTTGGAGGAAGCATGG + Intronic
944621172 2:201517311-201517333 CAGGGGTTGGGGAGGGGAAATGG - Intronic
944866783 2:203870432-203870454 CTGGGGGTGTGGAGAGGGGAAGG + Intronic
945311818 2:208322837-208322859 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
945417970 2:209598589-209598611 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
946328516 2:218997143-218997165 CTGTGGATGTGGAGGGGGTAGGG - Intergenic
946591804 2:221257673-221257695 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
947018054 2:225643585-225643607 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
947363431 2:229369564-229369586 CTGTGGTGGTGGAGGAGGGAAGG + Intronic
947398638 2:229711847-229711869 CTGGGGTGGTGGGGAGGGGAGGG - Intronic
947456247 2:230256522-230256544 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
947722875 2:232380117-232380139 CTGTGCATGAGGAGGGGGCACGG + Intronic
948356816 2:237384761-237384783 GTGGGTTAGTGGTGGGGGCAGGG - Intronic
948540236 2:238686082-238686104 ATGGGGCTGTGGAGGGAGAAAGG - Intergenic
948564247 2:238873484-238873506 CTGGGGGTTGGGAGTGGGCAGGG + Intronic
948572880 2:238928289-238928311 CTGGGAATGTGGAGGGAGCAGGG + Intergenic
948753579 2:240145952-240145974 CTGGGGTTGTGGGGGGCCCTTGG + Intergenic
948786458 2:240355403-240355425 CTGAGGTTGAGGAAGGGACAGGG - Intergenic
948877711 2:240839047-240839069 CTGGGCTTGTGCATGGAGCAGGG - Intergenic
949062514 2:241969486-241969508 CTGGGGTTGATGACGGGGCGTGG + Intergenic
949062636 2:241969982-241970004 GTGGGGTTGATGATGGGGCATGG + Intergenic
949062744 2:241970385-241970407 GTGGGGTTGATGACGGGGCATGG + Intergenic
1168876367 20:1174808-1174830 CTGCGGTGGTGGTGGGGGTAAGG - Intronic
1168935526 20:1662023-1662045 CAGGGGTTGTGCAGGGGACTGGG - Intergenic
1169265657 20:4165851-4165873 CTCTGGTTGCTGAGGGGGCATGG + Intronic
1169266104 20:4168125-4168147 GGGGGGGTGGGGAGGGGGCATGG + Intronic
1169390788 20:5189253-5189275 CTAGTATTTTGGAGGGGGCAGGG - Intronic
1169392234 20:5199547-5199569 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1169498186 20:6134485-6134507 TGAGGGGTGTGGAGGGGGCAGGG - Intergenic
1169629902 20:7619167-7619189 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1169702749 20:8466323-8466345 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1170112224 20:12818162-12818184 GTGGGGTTGGGGAGGAGGGAGGG - Intergenic
1170179326 20:13511747-13511769 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1170180200 20:13521631-13521653 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1170425257 20:16228936-16228958 GTGGGGTTGGGGAGGGGAAATGG - Intergenic
1170539141 20:17370791-17370813 CTGCAGTTATGGAGGAGGCAGGG - Intronic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1171123496 20:22584082-22584104 CTGGGGTTGTGGGGCGGGGTGGG + Intronic
1171287852 20:23956872-23956894 CTGGAGCAGAGGAGGGGGCAGGG - Intergenic
1171736154 20:28788456-28788478 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1171772680 20:29336453-29336475 GTGGGGTGGGGGAGGGGGGAAGG + Intergenic
1172008754 20:31834327-31834349 GTGGGGAGGTGGCGGGGGCATGG - Exonic
1172020191 20:31908568-31908590 CTGGGGGTGGGGTGGGGGCGGGG - Intronic
1172044565 20:32071267-32071289 CTGGTGGGGTGGAGGGGCCAAGG + Intronic
1172450567 20:35019858-35019880 CTGGTGTTGGGGAGATGGCAAGG - Intronic
1172624058 20:36337350-36337372 TGGGGGTGGTGGAGGGGGCAAGG + Intronic
1172663784 20:36585387-36585409 CGGGGGTGGTGGAGGTTGCAGGG + Intronic
1172883589 20:38217185-38217207 CTGGGGCTATGGTGGGGACAGGG - Intronic
1173025729 20:39305798-39305820 CTGGGGTACTGGAGGTGGCGTGG - Intergenic
1173031242 20:39362538-39362560 CTTGGGGTGGGGTGGGGGCAGGG + Intergenic
1173161036 20:40652878-40652900 CTGGGGATGTGCAGGGGGCAGGG - Intergenic
1173171799 20:40731770-40731792 GTGGGGTGGGGGAGGGGGGACGG + Intergenic
1173528254 20:43749370-43749392 CTGGGGGAGAGGAGGGGACATGG - Intergenic
1174087191 20:48017857-48017879 CTGGGCTTATGGAGGGGACTGGG + Intergenic
1174390612 20:50216443-50216465 CTCGGGTGGGGGTGGGGGCAAGG + Intergenic
1174553604 20:51378695-51378717 CGGGGGTGGTGGAGGTGGGATGG + Intergenic
1174715992 20:52759326-52759348 GTGGGGTGGTGGAGTGGGCATGG - Intergenic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1175200465 20:57273338-57273360 CTGGGGAGCTGGAGAGGGCATGG + Intergenic
1175409197 20:58754829-58754851 CTGGGGTTGTGGGGGAGGGGGGG + Intergenic
1175504390 20:59471204-59471226 CTGTCGTGTTGGAGGGGGCACGG + Intergenic
1175744108 20:61441869-61441891 GTTGGGTTGTGCAGGTGGCACGG + Intronic
1175844639 20:62051996-62052018 TTGTGGTTGTGGAGGTGACATGG - Intronic
1175946330 20:62560746-62560768 CTGGGGTTGAGGGGGGAGGAGGG + Intronic
1176029154 20:63002720-63002742 CTGGGGCTGTGGCTGGGGCCTGG - Intergenic
1176123295 20:63463900-63463922 CTGGGGGTGTGGCAGGGGCTGGG - Intronic
1176137530 20:63530701-63530723 CTGGGGTCGTGGCCGGGGCGTGG - Intronic
1176179815 20:63744393-63744415 TTGGGGGCGGGGAGGGGGCAGGG - Exonic
1176211126 20:63922385-63922407 CCTGGGTGGTGGAGGGTGCATGG + Intronic
1176215426 20:63945504-63945526 CTGGGGTTGGGGTTGGGGTAGGG + Intronic
1176271880 20:64239634-64239656 CTGGGGTGGGGGAAGAGGCAGGG - Intronic
1176274611 20:64256717-64256739 CTGGGGTGGCGCAGGGAGCAAGG - Intronic
1176298735 21:5088511-5088533 CTGGGGTGGTGAAGGGGAGAGGG - Intergenic
1176384921 21:6134512-6134534 CTGGGGTGGTGCAGGGGGTTCGG + Intergenic
1176446899 21:6829441-6829463 CGCAGGTTGTGGAGGGGCCAGGG - Intergenic
1176825070 21:13694467-13694489 CGCAGGTTGTGGAGGGGCCAGGG - Intergenic
1177132985 21:17279800-17279822 CTGGGGGTGTGGGGGGGGGGGGG + Intergenic
1177449960 21:21253492-21253514 CTCGCATTGTGGAAGGGGCAAGG - Intronic
1177478709 21:21657869-21657891 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1178855940 21:36250477-36250499 CTGGGGTTCCTGAGGCGGCATGG + Intronic
1178915874 21:36705400-36705422 CTGGGGTAGGGGAGGGGAGAGGG - Intronic
1178942166 21:36915121-36915143 CTGGGCTTCTTGTGGGGGCAGGG + Intronic
1179484844 21:41703631-41703653 CAGGGCTTGGGGAGGGGGAATGG + Intergenic
1179522375 21:41953742-41953764 CTGGGGGCGTGGAGGGGGCGCGG + Exonic
1179657274 21:42853158-42853180 CCCGGGTAGAGGAGGGGGCAAGG - Intronic
1179738551 21:43403740-43403762 CTGGGGTGGTGCAGGGGGTTCGG - Intergenic
1179858291 21:44173438-44173460 CTGGGGTGGTGAAGGGGAGAGGG + Intergenic
1179880996 21:44293299-44293321 CTGGGGCTGTGGGGGGAGCGTGG + Intronic
1179950646 21:44707238-44707260 TTGGTGTTGCGGTGGGGGCAGGG - Intronic
1180041240 21:45281395-45281417 CAGAGGTTGTGGAGGGAGCTAGG - Intronic
1180082031 21:45491381-45491403 GTGGGGGTGTGGGGGGGGCTCGG - Intronic
1180189575 21:46155970-46155992 CTGGGGCTGTGGAGGGCGAGAGG + Intergenic
1180389833 22:12218498-12218520 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1180416107 22:12715982-12716004 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1180428566 22:15223767-15223789 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1180483380 22:15775373-15775395 CGCAGGTTGTGGAGGGGCCAGGG - Intergenic
1180698342 22:17768449-17768471 CTGGGCTTCTGGGTGGGGCATGG + Intronic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1180982076 22:19883269-19883291 CAGGGGTGGTGGAGCAGGCAGGG + Intronic
1181031422 22:20150302-20150324 CTGGGGCTGGGGCAGGGGCAGGG + Intronic
1181031442 22:20150345-20150367 CTGGGGCTGGGGCAGGGGCAGGG + Intronic
1181084208 22:20431885-20431907 CTGGGGCGGGGGAGGGGGCGGGG - Intronic
1181141177 22:20806042-20806064 CAGGGGTGGTGGGGAGGGCAGGG + Intronic
1181259592 22:21587831-21587853 CTGGGGTTGAGTTTGGGGCATGG + Intronic
1181485602 22:23229820-23229842 CTGTGCTGGTGAAGGGGGCAGGG + Intronic
1181511912 22:23393100-23393122 CTGGGGCTGGGGCTGGGGCAGGG - Intergenic
1181531884 22:23521787-23521809 CTCGGGTGGTGGTGGGGGGAGGG - Intergenic
1181634261 22:24167094-24167116 CTGTGGTGGTGGCGGGGGCGGGG - Exonic
1181634830 22:24169686-24169708 CTGGGCCAGTGGAGGAGGCAGGG - Intronic
1181960712 22:26619816-26619838 CTGGGGCTTTAGGGGGGGCACGG - Intergenic
1181967413 22:26666793-26666815 CTGGGCCTGGGGAGGGGGCCTGG + Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182122369 22:27796453-27796475 CTGGGGGTGTGGGGGCGGCTGGG + Intronic
1182250287 22:28994567-28994589 CTGGGGTGGGGTATGGGGCAAGG + Intronic
1182352684 22:29707641-29707663 GTGGGGTTGGGACGGGGGCAAGG + Intergenic
1182424957 22:30266919-30266941 GTGGGGATGGGGAGGGGGGAGGG + Intergenic
1182695054 22:32192863-32192885 CTGGTCTTGGGAAGGGGGCAGGG + Intronic
1182716300 22:32358461-32358483 CTGGTCTTGGGAAGGGGGCAGGG - Intronic
1182778242 22:32847068-32847090 CGGGGGGTGTGGGAGGGGCAAGG - Intronic
1182974648 22:34611750-34611772 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1182997007 22:34822772-34822794 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1183341471 22:37284116-37284138 CCGGGGCTATGGAGAGGGCAGGG + Intronic
1183352988 22:37344069-37344091 GTGGGGTTGGGCAGGGGGCATGG - Intergenic
1183353027 22:37344164-37344186 GTGGGGTTGGGCACGGGGCATGG - Intergenic
1183404422 22:37623496-37623518 CGTGGGCTGTGGAGTGGGCAGGG - Intronic
1183414793 22:37676037-37676059 TTGGGGTGGAGGAGGGGGAAAGG - Intronic
1183485176 22:38084530-38084552 CTGGGAATGTGGGGGGGGGAGGG + Intergenic
1183673573 22:39287495-39287517 CTGGAGCTGTGGAGGCAGCATGG - Intergenic
1183702192 22:39457149-39457171 AGGGGGTTGCGGAGGGGGCGGGG + Intergenic
1184214490 22:43057737-43057759 CTGGGCTCCTGGAGTGGGCAGGG + Intronic
1184471474 22:44698557-44698579 CTGGGTCTGAGGAGGGGGCTGGG - Intronic
1184683328 22:46084832-46084854 CTGGGGTGGTGGAGAGCCCATGG - Intronic
1185137626 22:49081583-49081605 CTGGGACTGTGTGGGGGGCAGGG + Intergenic
1185166137 22:49263469-49263491 CAGGGGTGGTGGAGGGGACGGGG - Intergenic
1185192597 22:49448033-49448055 CAGGGGTTGCGGACAGGGCAGGG + Intronic
1185280050 22:49966153-49966175 CTGGGGGGCTGGAGGGGGCCAGG - Intergenic
1185336909 22:50274867-50274889 GTGGGGAGGTGGAGGGGGCTGGG - Intergenic
949492625 3:4604299-4604321 GTGGAGTTGTGGAGGTGGAAGGG + Intronic
949514921 3:4798920-4798942 CTGGGGGTAGGGATGGGGCAAGG + Intronic
949597324 3:5561873-5561895 CTGGGGGTGGGGAGTAGGCAGGG + Intergenic
949683906 3:6546749-6546771 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
949694966 3:6683761-6683783 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
950042817 3:9931133-9931155 CTAGGGGTGGGGCGGGGGCAAGG - Intronic
950059896 3:10061969-10061991 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
950396293 3:12736701-12736723 ATGGGGTGGTGCAGGGGGCAGGG - Intronic
950398164 3:12750003-12750025 CCGGGGTAGTGGAGGGAGGAGGG + Intronic
950525328 3:13519620-13519642 CTGGGGCTGGGGCGGGGCCAGGG + Intergenic
950792080 3:15480113-15480135 CTGGGGTTGCAGTGGGGGCCTGG - Intronic
951134755 3:19092407-19092429 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
952150756 3:30587870-30587892 CAAGGGTTAAGGAGGGGGCAAGG - Intergenic
952469051 3:33625191-33625213 ATGGGGTGGGGGAGGGGGGAGGG + Intronic
952767560 3:36968150-36968172 ATGGGGTAGGGGAGGGGGGAGGG - Intergenic
952770857 3:36999002-36999024 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
952787682 3:37172054-37172076 TTGGGCTTGTGGAAGGGGAAAGG - Intronic
952841259 3:37647628-37647650 CAGGGGTCGGGGAGGGGGTAGGG - Intronic
953210856 3:40873787-40873809 CTGGGTTTGCAGAGGGAGCAAGG - Intergenic
953534762 3:43769375-43769397 CTGGGATTGTGCAAGTGGCAGGG - Intergenic
953735333 3:45489431-45489453 CTGGGGTGGGGGTGGGGGCCAGG - Intronic
953864545 3:46572970-46572992 ATGGGGTTGGGGCGAGGGCAAGG - Intronic
954127561 3:48540449-48540471 ATGGGGTTGGGAAGGGGGCCTGG - Intronic
954506049 3:51074673-51074695 CTGGGGGTGTGGTGAGGGGAGGG + Intronic
954614788 3:51964128-51964150 CTGGGGCTGGGGAGGGGGCCTGG - Intronic
954671665 3:52294357-52294379 CTGAGGGTGTGGAGGGGCCCTGG + Intergenic
954700362 3:52447702-52447724 CCGTGGGGGTGGAGGGGGCATGG - Intergenic
954701069 3:52451198-52451220 CTGGGGTTGGGGAGGGGGTCGGG - Exonic
954716791 3:52530973-52530995 CTGGGGTTGTGGCTGAGACAGGG - Intronic
954750347 3:52810056-52810078 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
955058238 3:55474690-55474712 CGGGGGTGGGGGTGGGGGCAAGG + Intronic
955250915 3:57281330-57281352 CTGGGGTTGTAAGGGGGGCTGGG + Intronic
955961233 3:64343247-64343269 CTGGGGTGGTGGAGGGGCAGGGG - Intronic
956826005 3:72997195-72997217 CTGGGGAGGTGGAGGGGGATGGG - Intronic
957244294 3:77698115-77698137 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
957389949 3:79551328-79551350 GTGGGGTGGGGGAGGGGGGAAGG - Intronic
957494006 3:80966899-80966921 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
957721974 3:84013600-84013622 CTGGGGTCGGGGATGGGGAAGGG + Intergenic
957792822 3:84960840-84960862 TTTGGGTGGTGGAGGAGGCAGGG + Intronic
958543447 3:95510068-95510090 CTGCAGTTGTGCAGAGGGCAAGG + Intergenic
958597414 3:96245438-96245460 CTGGGGTAATGGAGGGGCTAAGG - Intergenic
958825786 3:99028729-99028751 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
959618569 3:108375328-108375350 GTGGGGTAGGGGAGGGGGGAGGG + Intronic
959625394 3:108443997-108444019 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
959724383 3:109527339-109527361 ATGGGGTGGTGGAGGGTGGAGGG + Intergenic
959808033 3:110581595-110581617 CTGGAGGAGTGGAGGGGACAGGG - Intergenic
960158753 3:114325988-114326010 CTGGGGTTGGGGCAGGTGCAGGG + Intergenic
961064357 3:123862006-123862028 CTGGAGCTCTGGAGTGGGCAGGG - Intronic
961070892 3:123925320-123925342 CTGGGGTTGTGGTGGATGTAAGG + Intronic
961200589 3:125042626-125042648 CTGGGAGTTTGGAAGGGGCAAGG + Intronic
961333320 3:126155543-126155565 CTGGGGCTGGGAAGGAGGCAGGG - Intronic
961455202 3:127020555-127020577 CTGGGGTTGGGGCAGGGGAATGG + Intronic
962741744 3:138367132-138367154 CTAGGGCTGTGGATGGGGCAAGG + Intronic
962843910 3:139258879-139258901 CTGGAGTCATGGAGGAGGCAAGG + Intronic
962986928 3:140544701-140544723 CTCAGGGTGGGGAGGGGGCAGGG + Intronic
963216919 3:142758817-142758839 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
963231398 3:142911725-142911747 TAGGGGTTGTGGTGGGGGCTGGG - Intergenic
963679307 3:148353245-148353267 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
963751064 3:149180475-149180497 CTGGGATTGGTGAGTGGGCATGG - Intronic
963955389 3:151247611-151247633 GTGGGGTCGGGGAGGGGGGAGGG + Intronic
964075637 3:152688529-152688551 TTGGTGCTGTTGAGGGGGCATGG + Intergenic
964185219 3:153934255-153934277 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
964500789 3:157346028-157346050 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
964570932 3:158106541-158106563 CGGGGGTTGGGGAGGGGAAAAGG + Intronic
964643279 3:158932106-158932128 CTTGAGTTGTGGAGTGGGAATGG + Intergenic
964691481 3:159454564-159454586 CTGGGTTTGGGAAGGGGGCATGG + Intronic
964722665 3:159782873-159782895 CTGGGTGTGTTGAGGTGGCAAGG - Intronic
966068364 3:175843794-175843816 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
966193341 3:177290718-177290740 CAGGCCTTGGGGAGGGGGCATGG - Intergenic
966230158 3:177642674-177642696 GGGAGGTTGTGGAGGGGGCTGGG - Intergenic
966303490 3:178504645-178504667 GTGGTGTTGGGGAGGGGGGATGG + Intronic
966744507 3:183262938-183262960 CTGGGGTTGTTGGGGTGGGAGGG + Intronic
966824805 3:183954550-183954572 CTGGGGTTGTGATGGTGGGATGG + Intronic
967392314 3:188968695-188968717 GTGGGGTGGGGGAGGGGGAAGGG + Intronic
967572129 3:191042303-191042325 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
967748471 3:193086457-193086479 ATGGGGTGGGGGAGGGGGGAGGG - Intergenic
967958735 3:194901211-194901233 CTGGTGTTGTTGGTGGGGCATGG - Intergenic
968276487 3:197444306-197444328 CAGGTGTTGTGGGGGGGGTACGG + Intergenic
968351181 3:198054030-198054052 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
968479551 4:827138-827160 GTGGGGGTGGGGAGGGGGGAGGG + Intergenic
968480900 4:832640-832662 CGGGGGGTGTGGAGAGGGCTTGG + Intergenic
968498319 4:931534-931556 CTGGGGTTATTGAGCAGGCAGGG - Intronic
968541761 4:1171672-1171694 CCGGGGATGCGGTGGGGGCAGGG - Intronic
968597056 4:1491118-1491140 CTGGCGTAGAGGAGTGGGCAGGG + Intergenic
968598082 4:1495663-1495685 CGGGGGCGGTGGAGGGGGCGAGG - Intergenic
968619524 4:1597516-1597538 CTGGGGGTCTGGAGCAGGCAGGG - Intergenic
968913889 4:3488839-3488861 CTGTGGATGTGGAAGGGGCAGGG + Intronic
968962793 4:3753706-3753728 CTGGGGGAGTGCATGGGGCAGGG + Intergenic
969167423 4:5329186-5329208 CTGTGATGGTGGAGGGTGCAGGG - Intronic
969168909 4:5343091-5343113 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
969398762 4:6939754-6939776 GTGGTGGTGTGGAGGTGGCATGG + Intronic
969548280 4:7846447-7846469 GAGGGGTTCTGGAGGGGCCATGG + Intronic
969574247 4:8027341-8027363 CTGGGGCTGTGGAAGAGTCAGGG + Intronic
969737579 4:9001435-9001457 AGGGGCTTGTGGCGGGGGCAGGG + Intergenic
970015044 4:11503855-11503877 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
970415937 4:15856901-15856923 CTGGGGTTGTGGAAGGTGTGTGG + Intergenic
970928630 4:21483077-21483099 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
970948220 4:21720672-21720694 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
971371456 4:26022698-26022720 TTGGGGTTGTAGGGGGGACAGGG + Intergenic
971500239 4:27311281-27311303 CTGGGGTTGTTGCGAGGTCAGGG - Intergenic
971880100 4:32360704-32360726 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
972223765 4:36987954-36987976 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
972336895 4:38114994-38115016 CTGGGATTGGGGTGGGTGCAGGG + Intronic
972456788 4:39263115-39263137 CTTGGTTTATGGAGGGGGAAGGG + Intronic
972817648 4:42661413-42661435 CTGGGGTGGTCGAGGCTGCAGGG + Intergenic
973542423 4:51947644-51947666 ATGGGGTGGTGGATGGGGGAGGG - Intergenic
973764262 4:54149354-54149376 CAGGGGGTGGGGAGGGGGCGGGG + Intronic
973770425 4:54201373-54201395 CAGGGGTTGGGGAGGAGGGAGGG + Intronic
974719712 4:65722495-65722517 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
975176889 4:71299661-71299683 CCAGCGTTGTGGAGAGGGCAGGG + Intronic
975435760 4:74349351-74349373 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
975637489 4:76464560-76464582 ATGAGATTTTGGAGGGGGCAGGG + Intronic
975821032 4:78270551-78270573 CTGGGGTGGTGGTGGTGGCGGGG - Intronic
976026488 4:80693546-80693568 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
976451330 4:85194603-85194625 GTGGGGTTGGGGAAGGGGGAGGG + Intergenic
977154111 4:93552021-93552043 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
977464660 4:97368826-97368848 GTGGGGTTGGGGAGGGGAAATGG - Intronic
978241398 4:106520983-106521005 CTGCTGTGGTGGAGGGGTCAAGG + Intergenic
978900118 4:113939053-113939075 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
979224517 4:118269085-118269107 CTGGGGCTGGGTTGGGGGCAGGG - Intergenic
979420222 4:120494808-120494830 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
979469086 4:121073020-121073042 CTGGGGTTGATCTGGGGGCAGGG + Intronic
979749386 4:124258682-124258704 TTGTGGTTGTGGATGGGGCTGGG + Intergenic
980112472 4:128647898-128647920 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
980172942 4:129311605-129311627 CCTGGGTGGTGGTGGGGGCACGG + Intergenic
980405018 4:132344729-132344751 CTGGGGCTGTGGCTGGGGCTGGG + Intergenic
980762460 4:137253759-137253781 CTGGGGTAAGGGAGGGGCCAAGG - Intergenic
981018887 4:140004530-140004552 AGGGGTTTGGGGAGGGGGCAGGG + Intronic
981547257 4:145906510-145906532 CTGAGGGTGTGGAGGGGGTTAGG - Intronic
981587705 4:146322361-146322383 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
981932765 4:150208636-150208658 CTGGGGTTAGGGAGGAGGCTGGG + Intronic
982039777 4:151385255-151385277 CTGGGGTGGAGGTGGGGGGATGG + Intergenic
982657833 4:158171088-158171110 CTGGGACTCTGGAGGGGCCAGGG + Exonic
982889111 4:160824061-160824083 ATGGGGTGGGGGAGGGGGGAGGG + Intergenic
983210586 4:164954022-164954044 CTGGGTTGGTGAAGGGGACAGGG - Intergenic
983512269 4:168621491-168621513 CTGGGGTGGTGGAAGGAGTAAGG - Intronic
983950796 4:173639048-173639070 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
984129577 4:175856877-175856899 GAGTGGTTTTGGAGGGGGCATGG + Intronic
984186612 4:176551668-176551690 CTGGTGTTGTGGTAGGGGGAGGG - Intergenic
984333208 4:178354040-178354062 CTGGGGTGGTGGAAAGGGAAAGG - Intergenic
984337749 4:178415036-178415058 CTGGGGGCGGGGAGGGGGCGCGG + Intergenic
984473193 4:180203425-180203447 CGTGGTGTGTGGAGGGGGCAGGG + Intergenic
985063368 4:186099403-186099425 GTGGGGTGGTGGAGGGGGGAGGG - Intergenic
985471601 5:50456-50478 CTGGGGTTGTGGTTTGGGCGGGG - Intergenic
985572431 5:655608-655630 GTGGGGTGGTGGAGGGCGCGGGG + Intronic
985608392 5:871759-871781 CTGGCGCTGAGGAGGGGGCTGGG - Intronic
985758896 5:1734660-1734682 CTGTGGTTCTGGTGGGGGCGGGG + Intergenic
985790846 5:1926273-1926295 CTGGGGCTGTGGCAGGGGCAGGG - Intergenic
985930510 5:3053275-3053297 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
985963200 5:3319412-3319434 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
986087940 5:4470904-4470926 GTGGGGTGGGGGAGGGGGGATGG + Intergenic
986286684 5:6364315-6364337 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
987606316 5:20140317-20140339 ATGGGGTTGGGGAGGGGGAAGGG + Intronic
987716145 5:21574141-21574163 CTGTGGTGGTGGAGGGGGTGGGG + Intergenic
987861342 5:23491965-23491987 CTGGTGGTGTGGTGGGGGCACGG + Intergenic
987958104 5:24766130-24766152 CTGGGCTAGGGGAGGGGGGAGGG + Intergenic
988235257 5:28535840-28535862 GTGGGGTTGGGGTGGGGGGAGGG - Intergenic
988320210 5:29685427-29685449 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
988971914 5:36477051-36477073 GTGGGGTGGGGGAGGGGGGACGG + Intergenic
989129762 5:38095342-38095364 CTGAGGTTTAGGAGGTGGCAGGG - Intergenic
989240806 5:39201593-39201615 CTGGGGTTTTGTTGGGGGAAGGG - Intronic
989315964 5:40078905-40078927 CTGGGGTTGATGAGGAGGGAGGG + Intergenic
989323539 5:40164860-40164882 CTGGGGTTGAAGAGGGAGGAAGG + Intergenic
989560214 5:42841897-42841919 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
989690354 5:44136168-44136190 GTGGGGTGGAGGAGGGGGGAGGG - Intergenic
990062524 5:51669808-51669830 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
990210579 5:53479146-53479168 TTGCAGTTGTGGAGGGGGGAAGG + Intergenic
991125607 5:63066293-63066315 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
991529383 5:67598477-67598499 GTGGGGTTGGGGTGGGGGGAGGG - Intergenic
991559116 5:67930390-67930412 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
992000652 5:72432679-72432701 CTGGAGCTGGGGAGGGGGAAGGG + Intergenic
992188139 5:74263683-74263705 CTTGAGTCGTGGAGGGGGCCTGG - Intergenic
992236282 5:74712280-74712302 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
992371027 5:76144390-76144412 CTGGGTTTGTGGAAGGGGTGGGG + Intronic
992939567 5:81750241-81750263 CTGGGGCTGGGGCGGGGGCGGGG - Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993435590 5:87889008-87889030 CTGGGGTTGGGGAAGGGGTGGGG + Intergenic
993613164 5:90079075-90079097 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
993901057 5:93584618-93584640 CGGGGGGTGGGGAGGGGGGAAGG + Exonic
994414624 5:99454079-99454101 GTGGGGTGGAGGAGGGGGGAGGG - Intergenic
994477443 5:100289072-100289094 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
994853398 5:105085823-105085845 CAGGGGTTGGGGAGAGGGAAAGG + Intergenic
994982349 5:106891984-106892006 GTGGGGTGGGGGAGGGGGTAGGG - Intergenic
995198362 5:109398627-109398649 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
995327548 5:110908086-110908108 ATGGGGTAGGGGAGGGGGGAGGG + Intergenic
995426779 5:112032728-112032750 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
995896773 5:117022282-117022304 CTGGGGTGGTGATGGGGGTAGGG + Intergenic
996547363 5:124694712-124694734 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
996936374 5:128953334-128953356 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
997319039 5:132963194-132963216 CGGGGGTTGTGGCCGGGGCCGGG - Intronic
997332576 5:133076335-133076357 CTGGTGTAGTGGGGAGGGCATGG + Intronic
997469996 5:134112349-134112371 CTTGGGCTGTGGAGAGGGAAGGG - Intergenic
997473197 5:134128175-134128197 CTGGGGTTGAGGAGTGGGAAGGG - Intronic
997597551 5:135117128-135117150 CTGGGGTGGGGGCAGGGGCAGGG + Intronic
998159257 5:139803838-139803860 CTGGGCTTAGGGAGGGGGCCTGG + Intronic
998190437 5:140019298-140019320 CTGGGGTTATGGAGTGACCAAGG - Intronic
998233844 5:140380790-140380812 GTGGGGGTGGGGATGGGGCAAGG + Intergenic
998529360 5:142870810-142870832 GTGGGATTGGGGTGGGGGCAAGG + Intronic
998670239 5:144345204-144345226 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
998716095 5:144886231-144886253 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
998720029 5:144934244-144934266 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
998727311 5:145032300-145032322 CTGGGCTTGGCGAGGGGGCACGG - Intergenic
999194916 5:149775236-149775258 CTGTGGATCTGGAGAGGGCAGGG + Intronic
999321074 5:150615419-150615441 GTGGGCGTGGGGAGGGGGCAGGG - Intronic
999328418 5:150657211-150657233 CTGGGGTTGGGGATGGGTTAGGG + Intronic
999519106 5:152332126-152332148 CTGCTTGTGTGGAGGGGGCAGGG + Intergenic
999541013 5:152572606-152572628 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
999730352 5:154472890-154472912 CTGGGGATGTGGCGTGGGCGTGG + Intergenic
1000271031 5:159683414-159683436 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1001023825 5:168206528-168206550 CTGGGGTGGAGGAGGGGGCATGG + Intronic
1001055934 5:168449925-168449947 CTGCGGCTGTGGAGGGGCCTTGG - Intronic
1001426138 5:171623897-171623919 CTGGTCTAGGGGAGGGGGCAGGG + Intergenic
1001657495 5:173363233-173363255 CTGGAGCTTTGGAGGGAGCATGG + Intergenic
1001780549 5:174365238-174365260 ATGGAGGTGTGGAGGTGGCAGGG + Intergenic
1001868980 5:175133897-175133919 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1001918765 5:175584054-175584076 GTGGGGTTGTGGGGTGGGCAGGG - Intergenic
1002167669 5:177358385-177358407 GTGGGGATGGGCAGGGGGCAAGG - Intronic
1002317898 5:178356196-178356218 CTGGGGTTGCGGAGGGGAGGAGG + Intronic
1002431628 5:179207486-179207508 GTGGGGTGGCTGAGGGGGCAGGG - Intronic
1002558497 5:180063025-180063047 CTGGGGGTGGGGAGGAGGAAGGG + Intronic
1002632814 5:180591938-180591960 CTGGGGAGGTGGAGGCGCCAGGG + Intergenic
1002886413 6:1299285-1299307 CTGGGGCTAAGGATGGGGCAGGG + Intergenic
1003018730 6:2491237-2491259 CTGGGGTTGGGGGGCGTGCAGGG - Intergenic
1003058029 6:2840866-2840888 CTGGGGGTGGGGCGGGGGTAAGG + Intronic
1003107600 6:3227900-3227922 CTGGGGCTGTGGTGGGGGTCTGG + Intronic
1003405077 6:5821312-5821334 CTGGGGATGGGGAGGAGGGAAGG - Intergenic
1003427872 6:6009210-6009232 CTGGGGATGTGGAGTAGGCAGGG + Intergenic
1003602382 6:7529531-7529553 CTAGGGTTGTGAAGGTGGAAAGG + Intergenic
1003740900 6:8937858-8937880 CTTGGGTGGTGGTGGAGGCAGGG - Intergenic
1004044467 6:12011830-12011852 CTGGGGTTGAGGCCGGGGCGAGG - Intronic
1004615225 6:17282131-17282153 CTGGTGTTTTGGCTGGGGCAGGG + Intronic
1004749732 6:18549488-18549510 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1004799695 6:19132699-19132721 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1004836565 6:19538224-19538246 CTGGGGCGATGGTGGGGGCAGGG - Intergenic
1005168311 6:22951371-22951393 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1005222077 6:23598233-23598255 CTGGGGTGGGGGAGGGGGGAAGG + Intergenic
1005691465 6:28311090-28311112 CTGCTGTTGTGGAGGTGGCAGGG + Intergenic
1005782919 6:29211998-29212020 GTGGGGTGGGGGAGGGGGCAGGG - Intergenic
1005959132 6:30683951-30683973 CTGGGGTGGTGGAGGGGGTGGGG - Intronic
1005968707 6:30744443-30744465 CCGGGATGGTGGAGGGGGCCGGG + Exonic
1006220282 6:32484170-32484192 CTGCAGTTGTGGGGAGGGCATGG + Intergenic
1006301643 6:33196548-33196570 ATGGGGATGGGGAGGGGGCTGGG - Exonic
1006444422 6:34070769-34070791 CTGGGGGTGTGGCGGGGGTGTGG - Intronic
1006575582 6:35042926-35042948 ATGGGGTTGTGGGTGGGGCAGGG + Intronic
1006638384 6:35475871-35475893 CTGGGGTGGGGAAGGGGGCTTGG + Intronic
1006717300 6:36128847-36128869 ATGGGGCTGTGGAAGGGGCGGGG - Intronic
1006781824 6:36637346-36637368 CTGGAGTGGAGGAGGGGGCTTGG - Intergenic
1006985310 6:38172140-38172162 CGGGGGTTGTGAAGGAGACATGG - Exonic
1007076995 6:39074428-39074450 TTGGGGTTGGGAAGGGGGCTGGG + Intronic
1007229358 6:40337749-40337771 CAGGGGTTGTGGTGGGGGGATGG - Intergenic
1007317328 6:40999965-40999987 TTGGGGTGGTGGAGGTGGGATGG - Intergenic
1007380260 6:41485719-41485741 TTGGGGTGGGGAAGGGGGCAGGG - Intergenic
1007483512 6:42165238-42165260 CTGGGGTGGGGGAAGGCGCATGG + Intronic
1007517284 6:42422791-42422813 GTGGGGCTGTGGAGAGGCCATGG - Intronic
1007628452 6:43259596-43259618 CTGGGGTTGTGGGGGAGTCTGGG - Exonic
1007758486 6:44116827-44116849 CTGGGGTTGGAGAGGGAGAATGG + Intronic
1007775378 6:44222019-44222041 CTGGGTCTGTGGGGGTGGCAGGG - Intronic
1007801287 6:44395697-44395719 CTGGGGTGGTGTGGGAGGCACGG + Intronic
1007859297 6:44890608-44890630 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1007988774 6:46233543-46233565 CTGGGGTTGAGATGAGGGCAAGG + Intronic
1008184079 6:48368958-48368980 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1008240555 6:49105928-49105950 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1008786117 6:55170724-55170746 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1008872770 6:56291311-56291333 CTGGGGTGTTTGAAGGGGCAAGG + Intronic
1009717344 6:67416025-67416047 GTGGGGTGGGGGAGGGGGCAGGG - Intergenic
1010347022 6:74824148-74824170 GTGGGGTGGTGGAGGGTGGAGGG - Intergenic
1010643603 6:78360201-78360223 ATGGGGTGGGGGAGGGGGGAGGG + Intergenic
1010849166 6:80750218-80750240 GTGGGGTTGGGGTGGGGGGAGGG + Intergenic
1011540938 6:88427891-88427913 CTGGGTCTGGGGAGGGAGCAGGG - Intergenic
1011948196 6:92933904-92933926 ATGGGATTTTGGAGGGGACAGGG - Intergenic
1012154073 6:95794441-95794463 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1012240047 6:96860908-96860930 ATGAGGTTTTGGAGGGGACAGGG + Intergenic
1012343470 6:98156993-98157015 CTGAGGTTGTGGTGGGGGTGGGG - Intergenic
1013359507 6:109381836-109381858 GTGGGGTTGAGGATGGGGCCGGG - Intronic
1014041996 6:116838750-116838772 CTGGGGTGGAGGAGGGGGGAGGG + Intergenic
1014086001 6:117344819-117344841 CTGGAGTTGTGCAGCGTGCAAGG - Intronic
1015999352 6:139028026-139028048 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
1016330998 6:142951794-142951816 CTGGGGATGAGAAGGGTGCAGGG + Intergenic
1016575409 6:145564783-145564805 CAGGGGGTGTGGAGGGAGCTGGG + Intronic
1017036931 6:150275330-150275352 CTGGGGATGGGGTGGGGACAGGG - Intergenic
1017227096 6:152034140-152034162 GTGTGGTTGGGGAGGGGGGAGGG + Intronic
1017769938 6:157637194-157637216 CTGTGGCTTTGGAGGTGGCATGG + Intronic
1018052679 6:160024887-160024909 CAGGGGTTGGGGAGGAGGCATGG - Intronic
1018073439 6:160187374-160187396 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1018454714 6:163941538-163941560 CTGGGGTTGGGGTGTGGGGATGG + Intergenic
1018606976 6:165608252-165608274 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1018832777 6:167457726-167457748 CTGGGGTTGTGGCGGTGGACAGG + Intergenic
1018906559 6:168079279-168079301 CTGGGTGTGTGGAGGGCGCCAGG + Intronic
1018987171 6:168646738-168646760 CTGGGGTTGAGAAGGGCTCAGGG + Intronic
1019128670 6:169858477-169858499 CCTGGGTTGTGGAGGGAGCCTGG + Intergenic
1019167928 6:170111192-170111214 GTGGGGTGGTGGAGGAAGCAGGG - Intergenic
1019522745 7:1468040-1468062 CTGGGGTCGTGGACCAGGCATGG - Intergenic
1019927689 7:4204092-4204114 CTGGGGCTGTCGCGGGGGGAGGG + Intronic
1019953580 7:4393059-4393081 CAGGGGCTGGGGAGGGGGCTGGG + Intergenic
1020132933 7:5569842-5569864 CTGGGGTGGGGGATGGGGGATGG - Intergenic
1020717058 7:11688051-11688073 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1020878893 7:13733959-13733981 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1021000234 7:15320112-15320134 GTGGGGTGGGGGAGGGGGAAGGG + Intronic
1021107886 7:16659991-16660013 GTGGGGTGGGGGAGGGGGAAGGG - Intronic
1021766359 7:23953157-23953179 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1021771026 7:24001564-24001586 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1021943571 7:25703639-25703661 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1022419313 7:30205854-30205876 CTGGGGATGAGAAGGGGGCGAGG - Intergenic
1022579395 7:31534143-31534165 GGAGGGTTGTGGAGGTGGCAGGG - Intronic
1022671330 7:32458961-32458983 CTGGGGTGGTTGTGGGGGGAGGG - Intergenic
1022929803 7:35098812-35098834 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1023872192 7:44269215-44269237 CTGGGGGCCTGGTGGGGGCAGGG + Intronic
1024007969 7:45241394-45241416 CAGGTGGTGTGGATGGGGCAGGG + Intergenic
1024104173 7:46065118-46065140 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1024202209 7:47118970-47118992 CTGGGGTTGGGGCTGGGGCTGGG - Intergenic
1024350734 7:48360181-48360203 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
1024383083 7:48722201-48722223 GTGGGATTTGGGAGGGGGCAGGG - Intergenic
1024480666 7:49858554-49858576 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1024877351 7:54041438-54041460 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1025134708 7:56401299-56401321 GTGGGGTTGGGGAAGGGGGAGGG + Intergenic
1025315587 7:58022369-58022391 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1026433376 7:70370322-70370344 CTGGGGCAGTGGAATGGGCAAGG - Intronic
1026541027 7:71280159-71280181 CTGAGGTTGTGGAAGAGACAGGG + Intronic
1026840408 7:73667706-73667728 CTGGGGTGCTGGAGGCGGCGCGG + Intergenic
1027202957 7:76074365-76074387 CTGGGCTTGTGGAGGCTGCCCGG + Intergenic
1027336312 7:77154447-77154469 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
1027521108 7:79209014-79209036 CTGGGGTGGTCGTCGGGGCAGGG + Intronic
1027724322 7:81784926-81784948 GTGGGGTGGGGGAGGGGGAAGGG - Intergenic
1028643224 7:93067638-93067660 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1028647492 7:93114299-93114321 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1028702391 7:93795308-93795330 CTGGGGGTGTGGTGAGGGGAGGG - Intronic
1028795506 7:94897302-94897324 CTGGGGTTGGGGAGGTGAGAAGG - Intergenic
1029211271 7:98910190-98910212 CAGGGGCTGGGGAGGGAGCAGGG - Exonic
1029457754 7:100679638-100679660 CTGGGGTTGGGGTGGGTGCAGGG - Exonic
1029510661 7:100992825-100992847 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029510757 7:100993497-100993519 CAGGGCTTGTGGAGCTGGCAGGG - Exonic
1029511150 7:100996074-100996096 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029511250 7:100996746-100996768 CAGGGCTTGTGGAGCTGGCAGGG - Exonic
1029511476 7:100998168-100998190 CAGGGCTTGTGGAGCTGGCAGGG - Exonic
1029511878 7:101000745-101000767 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029511974 7:101001417-101001439 CAGGGCTTGTGGAGCTGGCAGGG - Exonic
1029512370 7:101003994-101004016 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029707825 7:102285053-102285075 CTGTGGGGGTGGAGGGGGCGTGG - Intergenic
1029709394 7:102291319-102291341 CTGGGGTTGTCCTGGGTGCAGGG + Intronic
1029730477 7:102434815-102434837 CCTGGGGGGTGGAGGGGGCAGGG - Intronic
1029779476 7:102716654-102716676 ATGGGGTGGGGGAGGGGGGAGGG + Intergenic
1030138757 7:106284722-106284744 CTGGGGTTGGGGCTGGGGCTGGG - Intronic
1030525936 7:110655274-110655296 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1030638698 7:111979556-111979578 CTGGCGGGGTGGAGGGGGGATGG - Intronic
1031202763 7:118710659-118710681 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1031208382 7:118791959-118791981 ATGAGATTTTGGAGGGGGCAGGG - Intergenic
1031895839 7:127347369-127347391 TTGGGGTTGTGGCGGGGGGGTGG + Intronic
1032456303 7:132075747-132075769 GTGGGGCAGTGGCGGGGGCAGGG + Intergenic
1032545500 7:132738255-132738277 CAGGGGTGGTGGTGGGGGCTAGG + Intergenic
1032951903 7:136924353-136924375 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1033071367 7:138206435-138206457 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1033116824 7:138632710-138632732 AGGGGGTTGTGGAGGGAGGATGG + Intronic
1033220117 7:139522244-139522266 CTGCGGGTGTGGAGGGGGAGGGG + Intergenic
1033270883 7:139931876-139931898 CAGGAGGTGTGGAGGGGTCATGG + Intronic
1033462703 7:141562048-141562070 CTGCTGTGGTGGAGGTGGCAGGG + Intronic
1033512138 7:142069649-142069671 CTGGGGCTGTGGAGAGGACTTGG - Intronic
1033515219 7:142098581-142098603 CTGGGGCTGTGGAGAGGACTTGG - Intronic
1033686000 7:143641984-143642006 CAGGGCTAGGGGAGGGGGCAGGG + Intronic
1033689742 7:143725331-143725353 CAGGGCTAGGGGAGGGGGCAGGG - Intronic
1033698613 7:143815637-143815659 CAGGGCTAGGGGAGGGGGCAGGG - Intergenic
1033707172 7:143901528-143901550 GTGGGTTTGTGGTGGGGGAAGGG - Intronic
1033710813 7:143941728-143941750 CAGAGGTTGTGGTGGGGGTAGGG - Intergenic
1033815637 7:145069400-145069422 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1034192631 7:149223842-149223864 CTGGGGCTGTGGCGGGGCCGGGG - Exonic
1034321621 7:150189025-150189047 CTGGGGTGTTGGAGGGAGCTTGG - Intergenic
1034400444 7:150858267-150858289 CTGGGGCTGTGCATGGGGCAAGG + Intronic
1034401166 7:150862557-150862579 ATGGGGATGGGGATGGGGCAAGG + Intergenic
1034420734 7:150989244-150989266 TTGGCATTATGGAGGGGGCAGGG + Intergenic
1034590810 7:152137476-152137498 CTGGGGTGGTGGGGGTTGCAGGG - Intronic
1034718747 7:153267751-153267773 ATGGGGTTGTGGAAGGAGTATGG + Intergenic
1034771126 7:153778257-153778279 CTGGGGTGTTGGAGGGAGCTTGG + Intergenic
1035094289 7:156340990-156341012 CTGGGGTGTTGGAGTTGGCAAGG - Intergenic
1035307605 7:157943324-157943346 CTGGGGCATGGGAGGGGGCATGG - Intronic
1035318107 7:158010082-158010104 CTGTCCTTGTGGAGGAGGCAGGG + Intronic
1035600153 8:892532-892554 CAGGGGCTGGGGAGGGGGCGTGG + Intergenic
1035706357 8:1678447-1678469 CCAGGGGTCTGGAGGGGGCAGGG - Exonic
1035792246 8:2317825-2317847 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1035800559 8:2403880-2403902 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1036142981 8:6225463-6225485 CTGGGCTTGTGGAGGGTGGCAGG - Intergenic
1036726291 8:11223941-11223963 GTGGGGTGGTGGTGGGGGGACGG - Intergenic
1036740811 8:11359786-11359808 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1037342499 8:17861424-17861446 CTGGGGAGGTGGAGGTTGCAGGG - Intergenic
1037612379 8:20487046-20487068 CAGGGGGTGGGGGGGGGGCAAGG + Intergenic
1037787964 8:21913499-21913521 CTGGGGTTGGGCAGGGGGCCTGG - Intronic
1037818291 8:22123529-22123551 CTGGGGCTGTGCAGTGGGTAGGG + Intronic
1037910935 8:22743190-22743212 CTGGGGCTGGGGAGTGAGCAAGG + Intronic
1038426926 8:27469677-27469699 CTGGGGTAGAGGAAGGAGCAGGG + Intronic
1038870076 8:31484262-31484284 ATGGGGTGGGGGAGGGGGGAGGG - Intergenic
1039444538 8:37620686-37620708 CTGGGGGTGGGGAGGGTGAAGGG - Intergenic
1039620889 8:38996463-38996485 CTGGGGTTGTGGTTGAGGCCGGG - Exonic
1039902294 8:41761876-41761898 CTGGGGTTGTGGGTGGGGGCTGG - Intronic
1040081741 8:43292265-43292287 CCTGGGTGGTGGAGGGGGCGTGG + Intergenic
1040612660 8:49000851-49000873 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1041169583 8:55127722-55127744 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1041354447 8:56985458-56985480 CTGGGTGTCGGGAGGGGGCAGGG - Intronic
1041381270 8:57256644-57256666 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1041789458 8:61676813-61676835 GTGGGGTGGTGGTGGGGGGAGGG - Intronic
1042014217 8:64289546-64289568 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1042027324 8:64437981-64438003 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1042177832 8:66054877-66054899 CTGGGGTAGGGGAGGTGGGAGGG + Intronic
1042333406 8:67606181-67606203 TTGGGGTGGGGGAGGGGGGAGGG + Intronic
1042609858 8:70586272-70586294 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1042801106 8:72718663-72718685 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1042855217 8:73260386-73260408 GTGGGGTGGGGGAGGGGGCAGGG + Intergenic
1042959863 8:74292025-74292047 GTGGGGTGGGGGAGGGGGCAGGG + Intronic
1043201029 8:77369500-77369522 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1043258862 8:78171964-78171986 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1043316495 8:78928431-78928453 ATGGGGTGGGGGAGGGGGGAGGG + Intergenic
1043511608 8:80955526-80955548 GTGGGGTAGGGGAGGGGGGAGGG + Intergenic
1043738333 8:83775306-83775328 GTGGGGGGGTGGTGGGGGCAGGG - Intergenic
1043871472 8:85438489-85438511 TTGGGGATGGGGTGGGGGCAGGG - Intronic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1044566694 8:93669614-93669636 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1044722810 8:95167429-95167451 AAGGGGGTGTGGAGGAGGCAAGG - Intergenic
1044781504 8:95748060-95748082 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1044881915 8:96731715-96731737 CTGGGGGTGTTGAGGTGGGAAGG + Intronic
1045431411 8:102118269-102118291 CTGGAGTTGTTCAGGGGACAGGG - Intronic
1045744742 8:105405421-105405443 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1045805593 8:106157527-106157549 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1045947794 8:107816449-107816471 GTGGGGTAGGGGAGGGGGGAGGG - Intergenic
1046255778 8:111694583-111694605 CTTAGGTTCTGGAGGGAGCAGGG - Intergenic
1046467941 8:114631427-114631449 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1046667791 8:117023720-117023742 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1046783663 8:118242707-118242729 GTGGGGATGTGGCAGGGGCAGGG - Intronic
1046983369 8:120360940-120360962 CTGGAGTTGCAGAGGAGGCAGGG - Intronic
1047085195 8:121508159-121508181 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1047506376 8:125483926-125483948 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1047637247 8:126777676-126777698 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1048055313 8:130857091-130857113 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1048082689 8:131146439-131146461 GTGGGGTTGTGGTGGTGGGAGGG - Intergenic
1048304338 8:133273092-133273114 GTGGAGTGGTGGAGGGGGCTGGG - Intronic
1048340028 8:133531555-133531577 CTGGGGTCAGGGAGGTGGCAGGG - Intronic
1048793061 8:138122029-138122051 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1048805786 8:138239998-138240020 ATGGGGTGGGGGAGGGGGGAGGG + Intronic
1048816471 8:138339109-138339131 ATGGGGTGGGGGAGGGGGCAGGG + Intronic
1049242579 8:141545698-141545720 CAGGGGGTATGGAAGGGGCAGGG - Intergenic
1049774954 8:144399907-144399929 CTGGGGGAGTGAAGGGGGCCAGG + Intronic
1049989183 9:976418-976440 CTGGGGTAGCGGAGAGGGCTTGG + Intergenic
1050161844 9:2727283-2727305 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1050510295 9:6387557-6387579 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1051392789 9:16584188-16584210 CTGGGGTGGAGGGGTGGGCATGG + Intronic
1051607014 9:18926424-18926446 CTGGTGTTGTGGAAGAGCCATGG + Intergenic
1051676829 9:19566959-19566981 GTGGGGTGGGGGAGGGGGGATGG + Intronic
1051955858 9:22692519-22692541 CTTGGTTTGTGGTGGGGGTAGGG - Intergenic
1052362821 9:27577892-27577914 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1052430054 9:28354002-28354024 GTGGGGTGGGTGAGGGGGCAGGG + Intronic
1052691374 9:31820659-31820681 CTGGGGGTGGGGAGAGGCCACGG - Intergenic
1053009611 9:34625578-34625600 CTGGGGTGGAGGAGGGGGACAGG + Intronic
1053135355 9:35647227-35647249 CTGGGGATGCGGAGGAGGGAGGG - Intergenic
1053143653 9:35697611-35697633 TTGGGGTTGGGGAGGGGACAGGG + Exonic
1053188242 9:36037054-36037076 CGGGGGTCGCGGAGGTGGCAGGG + Exonic
1053413441 9:37930401-37930423 CTGGGGTGGGGGATGTGGCAGGG + Intronic
1053609854 9:39701275-39701297 TTGGGATTGTGGACCGGGCATGG - Intergenic
1053685611 9:40518162-40518184 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1053707311 9:40768477-40768499 CTCAGGTTGAGGAGGGGCCAGGG - Intergenic
1053867925 9:42459532-42459554 TTGGGATTGTGGACCGGGCATGG - Intergenic
1054088399 9:60769875-60769897 TTGGGATTGTGGACCGGGCATGG + Intergenic
1054172634 9:61855669-61855691 CTGGGGCTGGGGATGGGGCTGGG + Intergenic
1054243669 9:62641120-62641142 TTGGGATTGTGGACCGGGCATGG + Intergenic
1054417227 9:64889245-64889267 CTCAGGTTGAGGAGGGGCCAGGG - Intergenic
1054447485 9:65384680-65384702 CTGGGGCTGGGGATGGGGCTGGG + Intergenic
1054557793 9:66675665-66675687 TTGGGATTGTGGACCGGGCATGG + Intergenic
1054664906 9:67725132-67725154 CTGGGGCTGGGGATGGGGCTGGG - Intergenic
1054719674 9:68592466-68592488 GTGGGGTTGGGGAGTGGGGAGGG - Intergenic
1054825330 9:69567564-69567586 GTGGGGTTGTGGAGGGGGGAGGG - Intronic
1054836469 9:69680189-69680211 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1055912026 9:81364047-81364069 CTGGGGGTTTGGCAGGGGCATGG + Intergenic
1056145277 9:83722716-83722738 CTGGGGTAGTGGGGGAGGGACGG + Intergenic
1056664579 9:88571581-88571603 CTGCGCGTGTGGAGTGGGCAGGG + Intronic
1056927524 9:90847547-90847569 CTGCAGGTGTGGAGGGAGCACGG - Intronic
1056932827 9:90892942-90892964 CTGAGGTTGTGCAGGGAGCCAGG - Intronic
1057009596 9:91589725-91589747 TTGGCGCTGTGGAGGGAGCAGGG + Intronic
1057217011 9:93234692-93234714 CATGGGATGTGGAGGGGACATGG + Intronic
1057313992 9:93957655-93957677 CAGGGGGTGAGGAAGGGGCAGGG - Intergenic
1057439530 9:95072989-95073011 CTGGGGCTGAGGCTGGGGCAAGG + Intronic
1057551134 9:96051450-96051472 CTGGGGGGGTGAAGGGGGCGGGG + Intergenic
1057702677 9:97375220-97375242 CTGGGGTTCTGGGGGGGGAAGGG - Intronic
1058618839 9:106862707-106862729 CTGGGGTTCAGCAGGGGGGAGGG + Intergenic
1058625180 9:106927205-106927227 CGGGGGTTGTGGGGGGGGTGGGG - Exonic
1058763517 9:108159765-108159787 CTGGGGTGGTGGCGGGGTCGGGG + Intergenic
1059282340 9:113145676-113145698 CTGGTGGTGGGGAGGGGTCAGGG - Intergenic
1059339842 9:113591495-113591517 CTGGGGTTGTGGGCGGGACCAGG - Intronic
1059449420 9:114361048-114361070 CTGAGGCTGGGGAGGTGGCAGGG - Intronic
1059729840 9:117045850-117045872 ATGGTGTTGTGGTGGGGGAAAGG + Intronic
1059874910 9:118623670-118623692 CTAGGGTTGGGGATGGGGGAAGG + Intergenic
1060093359 9:120764563-120764585 CTGGTGTTGTGGAAGGAGCACGG - Exonic
1060183843 9:121551982-121552004 CTGGGTAGGTGGAGGTGGCAGGG + Intergenic
1060238913 9:121886540-121886562 CTAGAGCTTTGGAGGGGGCATGG + Intronic
1060269072 9:122128444-122128466 TGGGGACTGTGGAGGGGGCAGGG - Intergenic
1060409575 9:123391078-123391100 CTGTGATGGTGGAGGGGGCTGGG + Intronic
1060767798 9:126308013-126308035 CTGGGGCTGTCGGGTGGGCATGG + Intergenic
1061003405 9:127915392-127915414 CTGGGGGTGGGGAGGAGGCGGGG - Intronic
1061033655 9:128101684-128101706 CTGTGCGTGTGGAGGGGGCGGGG + Intronic
1061146687 9:128803799-128803821 CTGGGGGTGGAGAGGGGTCAAGG + Intronic
1061196308 9:129108973-129108995 CGGGGGTTGTGGCAGTGGCAGGG + Intronic
1061210007 9:129185968-129185990 CGTGGTTTGAGGAGGGGGCAGGG + Intergenic
1061218929 9:129237643-129237665 GGGGGGTGGTGGAGGTGGCAGGG + Intergenic
1061297118 9:129682716-129682738 CTGGGCCTGTGGCGGGGTCAAGG + Intronic
1061406424 9:130395116-130395138 GTGGGGGTGGGGTGGGGGCAGGG + Intronic
1061481159 9:130898332-130898354 GTGGGGTTGTCGGGGTGGCATGG + Intergenic
1061487917 9:130929622-130929644 ATGGGGCTGCGGAAGGGGCATGG - Exonic
1061570320 9:131474061-131474083 CTGGGGCTATGGGGGTGGCAGGG - Intronic
1061715337 9:132515134-132515156 CTGGGGATGGGGTGGTGGCAAGG - Intronic
1061749918 9:132770445-132770467 CTGGGGTAGGGGGTGGGGCAGGG + Intronic
1061799427 9:133105845-133105867 CTGGGGCTGGGGCGGGGGCTGGG - Intronic
1061949656 9:133929281-133929303 GTGGGTTTGTGGTGGGGGAAGGG + Intronic
1062060801 9:134494197-134494219 CTGGGGTGGTGGATGGCGCTGGG + Intergenic
1062060827 9:134494287-134494309 CTGGGGTGGTGGATGGCGCTGGG + Intergenic
1062060842 9:134494341-134494363 CTGGGGTGGTGGATGGCGCTGGG + Intergenic
1062060853 9:134494377-134494399 CTGGGGTGGTGGATGGCGCTGGG + Intergenic
1062060859 9:134494395-134494417 CTGGGGTGGTGGATGGTGCTGGG + Intergenic
1062060865 9:134494413-134494435 CTGGGGTGGTGGATGGTGCTGGG + Intergenic
1062060876 9:134494449-134494471 CTGGGGTGGTGGATGGCGCTGGG + Intergenic
1062160276 9:135075930-135075952 CCGGGGTTGGGGAGGGGGCCAGG + Intronic
1062213541 9:135377267-135377289 TTGGGGTGTTGGAGGCGGCACGG + Intergenic
1062437132 9:136551318-136551340 CTGGGGGTAGTGAGGGGGCATGG - Intergenic
1062459214 9:136655887-136655909 CTGGGGCTGGGGGGAGGGCAAGG - Intergenic
1062482612 9:136759449-136759471 CTGGGGAGGGGCAGGGGGCAGGG - Intergenic
1062582015 9:137232946-137232968 CCCGGGTGGTGGGGGGGGCAGGG + Intronic
1062598151 9:137308323-137308345 CTGGGGCTGGGGTGGGGGCGTGG - Intronic
1062698635 9:137887996-137888018 CTGGGAGGGTGGCGGGGGCAGGG + Intronic
1203522291 Un_GL000213v1:55090-55112 CGCAGGTTGTGGAGGGGCCAGGG + Intergenic
1186081043 X:5932136-5932158 CTGGGGGTGTGGAGGGGAAGGGG - Intronic
1186116979 X:6314490-6314512 CTGGGGTTGTGGTGGGGTATGGG - Intergenic
1186225531 X:7395391-7395413 CTGGGAGTGTGGTGGGGGTAGGG - Intergenic
1186337464 X:8605977-8605999 GGGGGGTTGTGTTGGGGGCAGGG + Intronic
1186964542 X:14772966-14772988 GTGGGGTGGTGGTGGGGGAAGGG - Intergenic
1186964869 X:14776112-14776134 CTGGGGTGGGGGTGGGGGAAGGG + Intergenic
1187043754 X:15624910-15624932 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1187346907 X:18473841-18473863 CTGGGGGTGGGGAGAGGGGATGG + Intronic
1187461073 X:19487122-19487144 CTGGGGGTGGGGGGGGGGAAGGG + Intronic
1187934718 X:24324897-24324919 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1188010394 X:25049146-25049168 CTGGGGGTGAGGAGTGGACAAGG + Intergenic
1188448302 X:30281181-30281203 ATGAGGTTGGGGAGGGGGGAGGG - Intergenic
1189251092 X:39601203-39601225 CTGGGGTTGGGGTGGGAGGAGGG - Intergenic
1189623703 X:42872280-42872302 TTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1189637873 X:43031425-43031447 ATGGGGTTGGGGTGGGGGGAGGG + Intergenic
1189765091 X:44363106-44363128 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1189814142 X:44808053-44808075 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1190061685 X:47215690-47215712 CTGGGGCTGGGGCGGCGGCAGGG - Intergenic
1190163811 X:48054956-48054978 CTGTGGATGTGGGGTGGGCAGGG - Intronic
1190384552 X:49872302-49872324 CTAGTGGTGTGGAAGGGGCAGGG - Intergenic
1190478143 X:50848356-50848378 GTGGGGTTGGGGTGGGGGGAGGG + Intergenic
1190504253 X:51110935-51110957 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1190557508 X:51650607-51650629 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1190598201 X:52066826-52066848 AAGGGGGTGTGGAGGTGGCAGGG + Intronic
1190610623 X:52187247-52187269 AAGGGGGTGTGGAGGTGGCAGGG - Intronic
1191048760 X:56168639-56168661 ATGGGGTCGGGGAGGGGGGAGGG - Intergenic
1191060531 X:56290867-56290889 CTGGTGTTGGGGTGGGGTCAGGG + Intergenic
1191820431 X:65300311-65300333 TTGGTGCTGTTGAGGGGGCAGGG + Intergenic
1192013238 X:67298817-67298839 GTGGGGTTGGGGATGGGGGAGGG - Intergenic
1192021352 X:67395734-67395756 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1192041444 X:67626772-67626794 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1192142390 X:68656857-68656879 GTGGGGTGGAGGAGGGGGGAGGG + Intronic
1192155945 X:68746770-68746792 CAGGGGTTGTGGAGATGGAAGGG + Intergenic
1192293495 X:69822838-69822860 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1192397210 X:70794509-70794531 CTGGGCTTGGGGGAGGGGCAGGG - Intronic
1192408215 X:70908677-70908699 CGGAGGTTGTGGAGAGAGCAGGG - Exonic
1192451349 X:71246965-71246987 CTGGAGTTGTGGAGGGGCAGGGG + Intronic
1192860937 X:75069683-75069705 GTGGGGTTGGGGAGGGAGAAGGG + Intronic
1192921913 X:75715789-75715811 TTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1193040156 X:76996671-76996693 CTTGGGTTGTGGATGGGACTGGG + Intergenic
1193245494 X:79224052-79224074 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1193374375 X:80741051-80741073 GTGGGGTGGGGGAGGGGGGATGG - Intronic
1193977986 X:88147387-88147409 CTGGGCATGTGGATGGGGCAGGG - Intergenic
1194042009 X:88952558-88952580 ATGAGGTTGGGGAGGGGGGAGGG + Intergenic
1194259762 X:91678822-91678844 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1194345281 X:92756201-92756223 ATGAGATTTTGGAGGGGGCAGGG + Intergenic
1194490158 X:94535649-94535671 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1194558549 X:95393105-95393127 CTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1194609334 X:96021349-96021371 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1195214544 X:102686025-102686047 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1195342911 X:103922348-103922370 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1195363544 X:104107008-104107030 GTGGGGATATGGATGGGGCAGGG - Intronic
1195363563 X:104107085-104107107 GTGGGGATGTGGATGGAGCAGGG - Intronic
1195421968 X:104685619-104685641 CTGGGGTGGGGGAAGGGGGAAGG + Intronic
1195766601 X:108302989-108303011 TTGGGGGGGTGGAGGGGGGAGGG - Intronic
1196125230 X:112090878-112090900 CTGGGCTTCTTAAGGGGGCAAGG + Intergenic
1196253143 X:113485245-113485267 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1196603919 X:117633890-117633912 ATGGGGTGGGGGAGGGGGGAGGG + Intergenic
1196675778 X:118419030-118419052 TTGGGGCTGTTGAGGGGGCATGG - Intronic
1196804093 X:119569387-119569409 CTGGGGGGGCGGAGGGGGCAGGG + Intergenic
1197556700 X:127964363-127964385 CTGTTCTTGTGGAGGTGGCAGGG + Intergenic
1197989802 X:132305923-132305945 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1198018489 X:132635378-132635400 CTGGGGGTGTGGAAGTGGCATGG - Intronic
1198131704 X:133702589-133702611 TTGGGGTTGGTGAGGGGGGAGGG - Intronic
1198627686 X:138596856-138596878 CTGGGGCTGTGCAGGGGAAAAGG + Intergenic
1198638688 X:138730185-138730207 GTGGGGTGGAGGAGGGGGGAAGG + Intronic
1198806434 X:140499730-140499752 TTTGGGATGGGGAGGGGGCAGGG - Intergenic
1198807627 X:140506119-140506141 CGGGGGCAGTGGAGGGGGCCCGG - Intergenic
1199272480 X:145900315-145900337 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1199937364 X:152587893-152587915 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1200084248 X:153595571-153595593 CTGTGGGTGTGGCGTGGGCATGG - Intronic
1200120021 X:153785811-153785833 CTGGGGTGCTGGAGTGGGAAGGG + Exonic
1200302781 X:154995215-154995237 CTCACGTTGTGGTGGGGGCAGGG + Intronic
1200343858 X:155427964-155427986 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1200578463 Y:4918015-4918037 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1201072400 Y:10160214-10160236 GTGGGGTGGGGGAGGGGGGAAGG - Intergenic
1201278641 Y:12321731-12321753 CTGGGGTTGACACGGGGGCATGG - Intergenic
1201436765 Y:13967505-13967527 GTGGGGTGGGGGAGGGGGTAGGG - Intergenic
1201551926 Y:15226634-15226656 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1201563383 Y:15342106-15342128 GTGGGGTGGGGGAGGGGGAAGGG - Intergenic
1201675325 Y:16575629-16575651 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1201771557 Y:17621421-17621443 CTGGGGTTGTGGGGGGGGCAGGG - Intergenic
1201829998 Y:18284565-18284587 CTGGGGTTGTGGGGGGGGCAGGG + Intergenic
1201976596 Y:19855961-19855983 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic