ID: 1084946654

View in Genome Browser
Species Human (GRCh38)
Location 11:72642367-72642389
Sequence GGCGGCTGCGAGCATGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084946654_1084946656 -9 Left 1084946654 11:72642367-72642389 CCAGGACCATGCTCGCAGCCGCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1084946656 11:72642381-72642403 GCAGCCGCCCGCCCGCCCGCCGG 0: 1
1: 1
2: 13
3: 79
4: 434
1084946654_1084946658 -4 Left 1084946654 11:72642367-72642389 CCAGGACCATGCTCGCAGCCGCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1084946658 11:72642386-72642408 CGCCCGCCCGCCCGCCGGCCCGG 0: 1
1: 9
2: 37
3: 156
4: 640
1084946654_1084946665 9 Left 1084946654 11:72642367-72642389 CCAGGACCATGCTCGCAGCCGCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1084946665 11:72642399-72642421 GCCGGCCCGGCCGCTGCGCTCGG 0: 1
1: 0
2: 1
3: 21
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084946654 Original CRISPR GGCGGCTGCGAGCATGGTCC TGG (reversed) Intronic
900466967 1:2830434-2830456 GGCAGCTCCGAGGATGGCCCCGG - Intergenic
901784679 1:11616896-11616918 GGCGGCTCAAAGCATGGTCCCGG - Intergenic
902768563 1:18632454-18632476 GGCGGCGGCGAACCGGGTCCTGG + Intronic
903907732 1:26697563-26697585 GGCTGGGGCGAGCGTGGTCCTGG + Intronic
905584838 1:39108071-39108093 GGTGGCAGTGAGCATGGTCTTGG + Intronic
907200955 1:52726541-52726563 GGCGGCTCCGGGCTTGGCCCAGG - Exonic
910758216 1:90712653-90712675 AGCAGCTGTGGGCATGGTCCAGG + Intronic
913208091 1:116559671-116559693 GACAGCTGAGAGCAAGGTCCGGG - Intronic
920544220 1:206802061-206802083 GGGGGCTCCCAGCATGGTCCTGG + Intronic
923124275 1:231021862-231021884 TGCAGCTGTCAGCATGGTCCTGG - Intronic
923171917 1:231424636-231424658 GGCGGCTGCGACAATGCTACTGG - Exonic
1063453835 10:6169360-6169382 GGCGGCTGTGAGCAGGGTAGGGG + Intronic
1065188760 10:23192518-23192540 TGCGGCGGCGAGCATGGACGCGG + Exonic
1065204595 10:23344519-23344541 GGAGGAAGCGAGCAGGGTCCAGG - Intronic
1066063639 10:31746125-31746147 GGGGTCTGCAGGCATGGTCCAGG + Intergenic
1072491260 10:95907895-95907917 GGCGGCAGCGCGCATGCTCCTGG + Intronic
1074962717 10:118462777-118462799 GGCTGCTGTGAGCATTGTCCAGG - Intergenic
1075871706 10:125775807-125775829 GGAGGCGGCGAGCATTGGCCTGG + Exonic
1077016492 11:401007-401029 GGCGGGTGTGAGCGGGGTCCGGG - Intronic
1079244661 11:18743556-18743578 GGCAGCTGAGAGCAGGGCCCCGG + Intronic
1083617975 11:64035821-64035843 GGCGGCGGCGAGCAGGGCGCGGG - Intronic
1083732407 11:64659865-64659887 GGCAGCTGCGTGCATGGACCAGG + Intronic
1084041576 11:66545967-66545989 GGCGGCTGGGAGCACGGACGGGG - Exonic
1084946654 11:72642367-72642389 GGCGGCTGCGAGCATGGTCCTGG - Intronic
1085503139 11:77040426-77040448 GGCGGCCGCGCGCAGGGCCCGGG - Exonic
1087169652 11:95037871-95037893 GGCTGCTGCGAGGCAGGTCCCGG - Intergenic
1087172791 11:95067508-95067530 GGCGGCTGCGGGGCAGGTCCCGG - Exonic
1088624649 11:111721035-111721057 GGCAGCTGCTAGCAAGGTCCTGG - Exonic
1091631396 12:2163622-2163644 AGCGTCTTCCAGCATGGTCCAGG + Intronic
1094624116 12:32106787-32106809 GGCGGCTCCGAGCAGGGGGCGGG - Intergenic
1096477841 12:51919267-51919289 GGGGGCAGGGAGCATGGGCCAGG - Intronic
1096509341 12:52119032-52119054 GGAGGCTGTGAAGATGGTCCAGG - Intergenic
1102041821 12:109805845-109805867 GGGGGCTTCTAGCATAGTCCAGG - Intronic
1103903240 12:124314483-124314505 GGAGGCTGGGGGCAGGGTCCTGG - Exonic
1107276690 13:38687337-38687359 CCCGGCTGAGTGCATGGTCCCGG - Exonic
1113647328 13:112007946-112007968 AGCGGCTGAGAGCATGGGGCTGG - Intergenic
1114813461 14:25927981-25928003 GGAGGCTGCTAGGATGTTCCAGG + Intergenic
1117014881 14:51508151-51508173 GGTGGCTGCGAGCACGGGACAGG - Intronic
1130540347 15:84817362-84817384 GGCGGCGGCGGGCAGGGGCCCGG + Exonic
1131863168 15:96676335-96676357 GGGGTCTGTGACCATGGTCCAGG + Intergenic
1136505312 16:30699013-30699035 GCCGGCTGCGCGCACGGCCCAGG - Intronic
1141675019 16:85513272-85513294 GGCAGCTGGGAGCATGAACCCGG + Intergenic
1142278201 16:89133900-89133922 GGGGGCTGCCAGCAGGCTCCAGG - Intronic
1143104103 17:4519869-4519891 GGGGGCTGAGAGAATGTTCCTGG - Intronic
1143390131 17:6555489-6555511 GGCGGCAGCAAGCCTGGTCTCGG - Intronic
1144497658 17:15758600-15758622 GGCTGCTCCGAGGATGGCCCTGG - Intergenic
1144629454 17:16863083-16863105 GGCTGCTCCGAGGATGGCCCTGG - Intergenic
1145161027 17:20573649-20573671 GGCTGCTCCGAGGATGGCCCTGG - Intergenic
1146371131 17:32266142-32266164 GGCGGCTGCGGGGCTCGTCCCGG - Intergenic
1148335175 17:46836020-46836042 GGGGCCTGCGAGGATGGTCAGGG + Intronic
1148842449 17:50508017-50508039 GGCTGCAGCGAGCGTGGACCCGG + Intergenic
1152067140 17:78118046-78118068 GGCTGCAGGGAGCAGGGTCCAGG - Intronic
1152316522 17:79583816-79583838 GGAGGCCGCGGCCATGGTCCAGG + Intergenic
1152377725 17:79927430-79927452 GGCGGCTGCCAGCTGGGGCCGGG + Intergenic
1152684650 17:81688104-81688126 GGCTGCTGCAAGCAGGCTCCGGG - Intronic
1152758919 17:82098349-82098371 GGCGGCGGCGCGCCGGGTCCCGG - Intergenic
1153688108 18:7566909-7566931 GGCGGCTTCGAGCCTGGCGCCGG - Exonic
1154146698 18:11872885-11872907 GGCTGCTGCCAGCATGGGCTTGG - Intronic
1156427958 18:37036608-37036630 GGTGGCTGTGAGCATGGACCAGG - Intronic
1160563766 18:79774381-79774403 GGTGGGTGCCTGCATGGTCCCGG - Intergenic
1160823423 19:1068450-1068472 GGCGGCTCCAGGCTTGGTCCGGG - Exonic
1160948032 19:1652418-1652440 GGCGGCGGCGCGCGTGGCCCGGG + Intronic
1161168381 19:2800812-2800834 GGTGGCTGCGGGAATGGTGCGGG - Intronic
1161420136 19:4171976-4171998 GGGGCCTGGGAGCATAGTCCTGG - Exonic
1161646649 19:5456993-5457015 GGCGGCTGTGACCGTGGTGCCGG + Intergenic
1162333427 19:10045071-10045093 GGCGGCTGGGAGGAGGGTCCTGG - Intergenic
1162533203 19:11247633-11247655 GGCGGCTGAGAGCCAGGCCCAGG + Intronic
1162738092 19:12757744-12757766 GGCGGGCGCGGGCATGGTCGCGG + Exonic
1163138927 19:15332958-15332980 GGAGGCTGCGAGCAAGGCCGAGG + Intergenic
1163843872 19:19628044-19628066 GGCGGGTGCGGGCCTGGGCCCGG - Intronic
1168306618 19:55439378-55439400 GGAGGCTGGGATGATGGTCCAGG - Intronic
926425081 2:12732744-12732766 GGCGGCTGCTACCAAGGGCCTGG - Intronic
934040963 2:88127149-88127171 GGGGGCAGGGAGCATGCTCCAGG - Intronic
937789372 2:125942883-125942905 GGCAGCTCCGCCCATGGTCCTGG - Intergenic
938365038 2:130727655-130727677 GGCTGCGGCGGGCGTGGTCCGGG + Intergenic
942128086 2:172847447-172847469 GGAGGCTGAGAGCATGAGCCAGG - Intronic
1168800405 20:640917-640939 GGAGGCTGTGAGCAGGTTCCTGG - Intergenic
1169235367 20:3925984-3926006 GGGGGCTGTGACCGTGGTCCAGG + Intronic
1172062961 20:32199493-32199515 GGCGGCTGCAGGAAAGGTCCTGG - Intronic
1175683253 20:61006653-61006675 GGCAGCTGAGAGCAAGGCCCTGG - Intergenic
1183393711 22:37560334-37560356 GGCGGCCGCGAGGACGGTGCCGG + Intergenic
1185003713 22:48262891-48262913 GGCAGGTGGCAGCATGGTCCCGG + Intergenic
1185302585 22:50090199-50090221 GGCGGCTGGGAGGCGGGTCCCGG + Intronic
954137112 3:48587019-48587041 GGAGGCTACGAGGAGGGTCCTGG - Exonic
954677335 3:52323194-52323216 GGGGCCTGGGAGCATGTTCCAGG + Intronic
954796098 3:53161918-53161940 GGGGGCGGCGAGCGTGGGCCGGG - Intronic
960274224 3:115708780-115708802 GGGGGATGGGAGCATGGACCTGG + Intronic
966866150 3:184260110-184260132 GGCCGCTGCGAGGCTGGGCCCGG + Exonic
967445067 3:189555790-189555812 GGCAGCTGCAAGCAGGGTACTGG - Intergenic
972344149 4:38178781-38178803 GGGGGTTGCGAACATGGTTCTGG - Intergenic
974670529 4:65024442-65024464 GGGGGCAGGGAGCATGGTACAGG - Intergenic
980378328 4:131977280-131977302 GATGGCTGCGCGCTTGGTCCAGG - Intergenic
982868294 4:160545244-160545266 GGCAGCTGCCAACATGGTCATGG + Intergenic
983738783 4:171100780-171100802 GGCAGCTGCGCACATGTTCCTGG + Intergenic
985068471 4:186145074-186145096 GGGGGCTGCGAGCACAGGCCCGG + Exonic
985277404 4:188251247-188251269 GGTGGCTGAGAGAATGGGCCTGG - Intergenic
991266975 5:64731088-64731110 GGAGGCTGAGAACAAGGTCCAGG + Intronic
1000692934 5:164345371-164345393 GGAGTGTGCTAGCATGGTCCTGG - Intergenic
1001493906 5:172174653-172174675 GGCAGCTGCCACCATGGTCAGGG + Intronic
1007432878 6:41786639-41786661 GGCGGCGGCGCGCACGGCCCAGG + Intronic
1007795392 6:44342867-44342889 GGCTGCAGCGAGCCTGGTTCGGG + Exonic
1007830184 6:44631843-44631865 GGCAGCTCCGTGCATGGTCAAGG + Intergenic
1011517227 6:88166892-88166914 GGCGGCAGCGAGCTGGGCCCGGG + Intergenic
1012450731 6:99350057-99350079 GGGGGCTGGGAGCGTGGGCCAGG + Intronic
1013267445 6:108513546-108513568 GGCGGCAGCGAGGATGGTGGAGG + Intronic
1014802393 6:125791125-125791147 AGAGGCCGCGAGCAGGGTCCAGG + Intronic
1017672430 6:156779333-156779355 GGCGGCCGCGGGCATGGGCTTGG + Exonic
1019474640 7:1238202-1238224 GGCGGCTGCGGGCAGGGGCGGGG - Intergenic
1024195303 7:47053074-47053096 GGCTGCTGCGAGGCAGGTCCCGG - Intergenic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1029200959 7:98838953-98838975 GGCTGCTGCAGGCTTGGTCCTGG - Intergenic
1035476636 7:159148801-159148823 GGAGGCTGCGAGACGGGTCCAGG - Intergenic
1035612169 8:973852-973874 GGCGGCTGCGACCACGGGCCAGG + Intergenic
1036749783 8:11436389-11436411 CCAGGCTGCGAGCATGGCCCAGG + Intronic
1037891857 8:22627830-22627852 GGCAGCTGCCAGCGTGGTGCAGG - Intronic
1053209692 9:36217391-36217413 GGGTGCTGCCAGCATGGTTCTGG - Exonic
1054787227 9:69221246-69221268 CGCGGCTGCGGTCACGGTCCCGG - Exonic
1054905855 9:70413349-70413371 GGCGGCCGCGGACATGGTGCGGG + Exonic
1057296952 9:93851917-93851939 GGAGGCTGCCAGCATGATCTTGG + Intergenic
1060218559 9:121752654-121752676 GGCCGCTGCGAGAGTGGGCCTGG + Intronic
1062439761 9:136564446-136564468 GGAGGCTGCGGGCAGGCTCCAGG - Intergenic
1062629955 9:137459088-137459110 GGCGGCGGCGCCCATGGTCGAGG + Exonic
1190745293 X:53318927-53318949 GGCTGCTGCGAGCTCAGTCCGGG - Intronic
1195072035 X:101290894-101290916 GGCGCCTGGCAGCATGCTCCAGG + Intronic
1196655336 X:118212006-118212028 AGCGGCTGCGAATGTGGTCCTGG - Intergenic
1196708356 X:118737217-118737239 GGCGGCTGTGCACATGTTCCTGG - Intronic
1199927232 X:152480400-152480422 TGAGGCTGAGAGCATGGACCAGG + Intergenic
1200239339 X:154485785-154485807 GGCAGATGCCAGCAGGGTCCTGG - Exonic