ID: 1084949708

View in Genome Browser
Species Human (GRCh38)
Location 11:72657912-72657934
Sequence CCCTGCTCACAGAGGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 1, 2: 2, 3: 52, 4: 375}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084949708_1084949715 5 Left 1084949708 11:72657912-72657934 CCACCCAGCCTCTGTGAGCAGGG 0: 1
1: 1
2: 2
3: 52
4: 375
Right 1084949715 11:72657940-72657962 CATGTCCCTCCTGATGTCACAGG 0: 1
1: 0
2: 2
3: 34
4: 296
1084949708_1084949725 25 Left 1084949708 11:72657912-72657934 CCACCCAGCCTCTGTGAGCAGGG 0: 1
1: 1
2: 2
3: 52
4: 375
Right 1084949725 11:72657960-72657982 AGGAGCTGAGGAGGGGTGGAGGG 0: 1
1: 0
2: 9
3: 170
4: 1251
1084949708_1084949720 16 Left 1084949708 11:72657912-72657934 CCACCCAGCCTCTGTGAGCAGGG 0: 1
1: 1
2: 2
3: 52
4: 375
Right 1084949720 11:72657951-72657973 TGATGTCACAGGAGCTGAGGAGG 0: 1
1: 0
2: 2
3: 27
4: 295
1084949708_1084949723 21 Left 1084949708 11:72657912-72657934 CCACCCAGCCTCTGTGAGCAGGG 0: 1
1: 1
2: 2
3: 52
4: 375
Right 1084949723 11:72657956-72657978 TCACAGGAGCTGAGGAGGGGTGG 0: 1
1: 0
2: 5
3: 82
4: 639
1084949708_1084949721 17 Left 1084949708 11:72657912-72657934 CCACCCAGCCTCTGTGAGCAGGG 0: 1
1: 1
2: 2
3: 52
4: 375
Right 1084949721 11:72657952-72657974 GATGTCACAGGAGCTGAGGAGGG 0: 1
1: 0
2: 0
3: 44
4: 356
1084949708_1084949724 24 Left 1084949708 11:72657912-72657934 CCACCCAGCCTCTGTGAGCAGGG 0: 1
1: 1
2: 2
3: 52
4: 375
Right 1084949724 11:72657959-72657981 CAGGAGCTGAGGAGGGGTGGAGG 0: 1
1: 2
2: 18
3: 135
4: 1321
1084949708_1084949722 18 Left 1084949708 11:72657912-72657934 CCACCCAGCCTCTGTGAGCAGGG 0: 1
1: 1
2: 2
3: 52
4: 375
Right 1084949722 11:72657953-72657975 ATGTCACAGGAGCTGAGGAGGGG 0: 1
1: 0
2: 3
3: 46
4: 352
1084949708_1084949718 13 Left 1084949708 11:72657912-72657934 CCACCCAGCCTCTGTGAGCAGGG 0: 1
1: 1
2: 2
3: 52
4: 375
Right 1084949718 11:72657948-72657970 TCCTGATGTCACAGGAGCTGAGG 0: 1
1: 1
2: 3
3: 27
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084949708 Original CRISPR CCCTGCTCACAGAGGCTGGG TGG (reversed) Intronic
900148225 1:1167457-1167479 CCCTGCCCACAGCGCCTGGGCGG + Intergenic
900208436 1:1441405-1441427 CCCTGCACACACAGGCAGGGGGG - Exonic
900411253 1:2513661-2513683 CCACCCTCACAGAAGCTGGGAGG + Intronic
901057782 1:6456809-6456831 CCCTGAGCCAAGAGGCTGGGTGG + Intronic
901528988 1:9842101-9842123 CCCTCCTCTGAGATGCTGGGAGG - Intergenic
901535243 1:9878433-9878455 CACTGAGCACAGAGGCTGCGGGG - Intronic
901667633 1:10835683-10835705 CCCTCCTCACCAAGGCTGAGAGG + Intergenic
902171261 1:14613248-14613270 CTCAACTCACAGAGGCTGGCAGG + Intronic
902244882 1:15114301-15114323 CCCTGCTCAGGGAGGTTGAGGGG - Intronic
902476571 1:16691643-16691665 CCCTGAGCCAAGAGGCTGGGTGG - Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903833453 1:26188491-26188513 CCCCACTCACCGAGGCTGAGTGG - Exonic
905456621 1:38092526-38092548 CCCAGCTCACAGAGGCTGGGAGG + Intergenic
906253764 1:44331873-44331895 CCCTGCTCACAGTGTGGGGGAGG - Intronic
907410907 1:54282622-54282644 CCGTGCTCACACAGGCGGGGCGG + Intronic
907554652 1:55333805-55333827 CCCTACTCAAACAGCCTGGGAGG - Intergenic
912822473 1:112878992-112879014 CCCTGCTCTGAGAGGCTGGGTGG - Intergenic
913089344 1:115466034-115466056 CACTGCTAACAGAAGCTTGGAGG + Intergenic
913199345 1:116483567-116483589 CCCTGCTCACAGTGGCTTCTTGG + Intergenic
915093814 1:153445022-153445044 CCCTGCTCACACAGGCCGATAGG - Intergenic
915517496 1:156421694-156421716 CCCTGCTCGCCTAGGCTCGGCGG - Intronic
915586469 1:156846399-156846421 CCTGGCCCACAGAGGCTGGAAGG - Intronic
915635076 1:157180750-157180772 CCCTGCTGGCAGACACTGGGTGG - Intergenic
916013205 1:160725415-160725437 CCCTGCTCACAGAGGGCCGGTGG - Intergenic
916416008 1:164592567-164592589 CCCTGGCCACAGAGGCTTTGGGG + Intronic
916745575 1:167682512-167682534 CCCTGCTGGAAGTGGCTGGGAGG + Intronic
916787601 1:168097795-168097817 CGCTGCTCACAGTTGCTGTGAGG - Intronic
918247421 1:182672094-182672116 CTCTGCACCCAGAGGCTGTGCGG + Intronic
918802248 1:188986712-188986734 CCCTGCTCACTGAGGAAGGACGG + Intergenic
918918473 1:190673809-190673831 ACCTGCTCATACAAGCTGGGAGG - Intergenic
919535016 1:198776648-198776670 CCCAGCTAAGACAGGCTGGGTGG - Intergenic
919703052 1:200651414-200651436 CCCTTCTAAAAGAGGCTGGATGG + Intronic
920431357 1:205921244-205921266 CCCTCCTCAGAGAACCTGGGTGG + Intronic
920699207 1:208204986-208205008 GGCTCCTCACAGAAGCTGGGGGG - Intronic
922787573 1:228290570-228290592 TCCTGTGCACTGAGGCTGGGTGG - Intronic
924381748 1:243471597-243471619 CCCTGCTATCAGGGGTTGGGGGG + Intronic
1062902107 10:1154230-1154252 CCCTGCTCCCTGACGCTGGCAGG - Intergenic
1062939102 10:1408758-1408780 CTCAGTCCACAGAGGCTGGGAGG - Intronic
1064057061 10:12106621-12106643 CCCTGAGCACAGGTGCTGGGTGG - Intronic
1064963811 10:20995207-20995229 TCCTGTTCTCAGAGACTGGGGGG - Intronic
1065407793 10:25388809-25388831 CCTTGCCCACACAGGCTTGGAGG + Intronic
1066489847 10:35883836-35883858 GCGAGCTCTCAGAGGCTGGGAGG - Intergenic
1066990826 10:42511680-42511702 CCCTGATCTGAGAGGCTGTGAGG + Intergenic
1067053270 10:43037332-43037354 CCATTCTCACAGAGGGTGGTGGG + Intergenic
1067523509 10:47025382-47025404 CCCTGCTCTCAGAGGCAGTCTGG + Intergenic
1067854996 10:49784405-49784427 GTCTGCTCACAGAGGGTGGGAGG + Intergenic
1068620557 10:59176890-59176912 ACCTCCTCACAGGGGCTGGTGGG - Exonic
1070466882 10:76732811-76732833 CCATGGTCATAGGGGCTGGGTGG - Intergenic
1070642556 10:78180134-78180156 CCCTGCTCACAGAGGGGGTTCGG + Intergenic
1070788711 10:79177115-79177137 GCCTGCTCACAGCGCCTGGCAGG + Intronic
1072727293 10:97822361-97822383 ACCTGCTCACAGAGTGTGGCGGG - Intergenic
1075614265 10:123880148-123880170 CCCTGTTCAGGGAGGGTGGGTGG - Intronic
1075725396 10:124608280-124608302 CCCTGGGCACACAGGCTGGTGGG - Intronic
1075784960 10:125042787-125042809 CCCTTCTGGCTGAGGCTGGGAGG + Intronic
1076452905 10:130569080-130569102 CCTTGTGCACAGTGGCTGGGAGG + Intergenic
1076543221 10:131227442-131227464 CCCTGCTGTCAGAGCTTGGGTGG + Intronic
1077037484 11:502461-502483 AGGTGCCCACAGAGGCTGGGTGG - Exonic
1077230148 11:1455068-1455090 CCCTGCCCTCGGAGGCCGGGTGG + Intronic
1077402327 11:2365352-2365374 CCCTGGTCCTAGAGGCTGGGAGG + Intergenic
1077872106 11:6270990-6271012 CCCTGAGCACAAAGGGTGGGCGG - Exonic
1078100850 11:8329470-8329492 CCCAGCGCACAGGGGCCGGGAGG + Intergenic
1078855617 11:15204516-15204538 CCCAGCTCACAGAGGGTGGCAGG - Intronic
1079320452 11:19447515-19447537 CCCACCTCACAGAGGTTTGGGGG + Intronic
1080109338 11:28547804-28547826 CCCTGCTCCTAAAGGCTTGGTGG + Intergenic
1080912193 11:36613595-36613617 CCCTCCAAACACAGGCTGGGTGG - Intronic
1082792936 11:57359676-57359698 CCCTGCCCACTGAGGCTGCAAGG + Intronic
1082996317 11:59258351-59258373 AACTGCTCACTGAGGCTGTGTGG - Intergenic
1083301219 11:61740455-61740477 TCCTGCTCACAGCAGCTGAGAGG - Exonic
1083683146 11:64360469-64360491 CGCCGCTCACATAGTCTGGGAGG - Exonic
1083738550 11:64695329-64695351 CCCTGCCACTAGAGGCTGGGAGG + Intronic
1084147966 11:67275075-67275097 CCCCACCCTCAGAGGCTGGGAGG - Intronic
1084256224 11:67944714-67944736 CCCTGTTAGCAGGGGCTGGGGGG + Intergenic
1084599524 11:70136582-70136604 ACTTGCTCACAGAGGCTTGCAGG - Intronic
1084816533 11:71650585-71650607 CCCTGTTAGCAGGGGCTGGGGGG - Intergenic
1084949708 11:72657912-72657934 CCCTGCTCACAGAGGCTGGGTGG - Intronic
1085255450 11:75170086-75170108 CCCTGCTCACACATGCTGTGGGG + Intronic
1088693025 11:112344011-112344033 CACTGCCCAGAGAGGCTGAGGGG + Intergenic
1088742542 11:112778784-112778806 CCCTGCCCAGAGTGGCTGGATGG + Intergenic
1089273131 11:117315434-117315456 CCCTGCTCAAATGGGCTGGTGGG - Intronic
1089366057 11:117921738-117921760 CTCTGCTGTCAGAGCCTGGGAGG + Intronic
1089573042 11:119422759-119422781 CCCAGCTCGCAGAGGCGGGGAGG - Intronic
1089700651 11:120241975-120241997 ACCTGCTCACAGGGACAGGGTGG - Intronic
1090667826 11:128926613-128926635 CTCTGCGCACAGAGGCGGCGAGG - Intergenic
1091088369 11:132745890-132745912 CCCATCTCTTAGAGGCTGGGAGG - Intronic
1091100074 11:132863748-132863770 CGCTGCTCCTAGAGGCCGGGAGG + Intronic
1091236895 11:134028160-134028182 CTCTGCTCTCAGAAGCTTGGAGG + Intergenic
1091553389 12:1553879-1553901 GCCTGCTTGGAGAGGCTGGGAGG - Intronic
1096179619 12:49543473-49543495 GCCAGGTCACAGACGCTGGGCGG - Exonic
1096649870 12:53057084-53057106 GGCTGCTCACCGACGCTGGGAGG - Exonic
1098675857 12:73289121-73289143 CCCTGCCCCCAGAGGCAGGCAGG + Intergenic
1100755506 12:97747290-97747312 TCTTGCTCACACAGTCTGGGAGG + Intergenic
1100856462 12:98761852-98761874 CCCTCCTGACCCAGGCTGGGAGG + Intronic
1102012756 12:109628677-109628699 CCCACCTCACAGAGCCTGGGGGG + Intergenic
1102446478 12:113006860-113006882 CCTTGCCTACAGAGGGTGGGTGG + Intronic
1103341842 12:120224984-120225006 CCCTGCTCACTGAGGGGGTGGGG - Intronic
1103981839 12:124741835-124741857 CCCTGCTCACGGGGTCTGGTAGG - Intergenic
1104259536 12:127170328-127170350 CCCTGCTCAAAGATGGTTGGAGG - Intergenic
1104638051 12:130450156-130450178 CCCCACTCACAGGGGCTCGGTGG + Intronic
1104723487 12:131060266-131060288 CTTTGCTCATAGAGGCTGGGTGG + Intronic
1104775386 12:131387549-131387571 CACTGCTCTAAGAGGCCGGGAGG + Intergenic
1104919606 12:132283662-132283684 CCATGGTCACCGAGGCTCGGGGG + Intronic
1105250946 13:18698067-18698089 CCCTGGTCACTGAGGGTGGCAGG - Intergenic
1105303680 13:19155198-19155220 TCCTGCTCACAGAGCATGTGAGG - Intergenic
1105514332 13:21076500-21076522 CCCTTCTCACAGGGCCTGGCTGG - Intergenic
1106166552 13:27251926-27251948 CCCCTCTCACATAGGCTGTGTGG + Intronic
1106275985 13:28207033-28207055 CCCCTCTCACAGAGGCAGGGCGG + Intronic
1106597659 13:31161068-31161090 GCCAGCTCAGAGAGGCCGGGTGG + Intronic
1106805564 13:33303032-33303054 CCCTGCTCTCACAGCCTGTGAGG + Intronic
1107549802 13:41464139-41464161 CCCTGGGCCCAGAGGCTGGCTGG - Intronic
1107825185 13:44323008-44323030 GCCTGAACACACAGGCTGGGAGG - Intergenic
1108699802 13:52933939-52933961 CCCCGCTCACGGTGGCTGCGAGG + Intergenic
1109704309 13:66069751-66069773 CCCTGCTCACAGAGGAAAGCTGG + Intergenic
1113592053 13:111507960-111507982 ACCTGAGCACCGAGGCTGGGGGG - Intergenic
1114268763 14:21088855-21088877 CCCAGGTCACAGAGGCGTGGTGG - Exonic
1117321497 14:54628216-54628238 CCCTGATCACAGAAGGTGGGAGG + Intronic
1117340664 14:54788807-54788829 CTCTGCCCTCAGAGGCTGGGAGG + Intronic
1117677015 14:58165649-58165671 CCCTGATTACCGAGGCTGGGTGG + Intronic
1118729500 14:68656511-68656533 TACTGCCCAGAGAGGCTGGGAGG - Intronic
1119731475 14:76953849-76953871 CCCAGCTCACAGAGATGGGGTGG + Intergenic
1119886948 14:78151417-78151439 CTCTGCTCACAAAGGCTTGGAGG - Intergenic
1120891904 14:89498814-89498836 GGCTGCACACAGAGGGTGGGGGG + Intronic
1121307681 14:92917285-92917307 CCCTGGACACCGAGGCTGGCTGG - Intergenic
1121322913 14:93003020-93003042 CCCTCCTCACAGAGGCCCTGTGG - Intronic
1121482793 14:94291562-94291584 GCCTGATCCCAGAGGCTGGCTGG + Intronic
1121533324 14:94673660-94673682 CCGTGCACACAAAGGCTGGTGGG + Intergenic
1122044817 14:99015999-99016021 GCCTGCTCACCATGGCTGGGCGG - Intergenic
1122254664 14:100468064-100468086 CCCTGCACACAGAGGCAGTGCGG + Exonic
1122922871 14:104887163-104887185 CTGTGCCCGCAGAGGCTGGGGGG - Exonic
1122935659 14:104954888-104954910 CCCTGCTGGCTGAGCCTGGGAGG - Intronic
1123994194 15:25706823-25706845 GCCTGGTCAATGAGGCTGGGCGG + Intronic
1124024243 15:25949915-25949937 CAATGCTCTCAGAGGCTGAGGGG - Intergenic
1124322341 15:28724475-28724497 CAGTGCTCTCAGAGGCTGAGGGG + Intronic
1124523431 15:30426280-30426302 CAGTGCTCTCAGAGGCTGAGGGG + Intergenic
1124535235 15:30539934-30539956 CAGTGCTCTCAGAGGCTGAGGGG - Intergenic
1124632174 15:31344239-31344261 CCCTCCTGACACAGGCTGGAGGG - Intronic
1124763419 15:32467662-32467684 CAGTGCTCTCAGAGGCTGAGGGG + Intergenic
1124775207 15:32581385-32581407 CAGTGCTCTCAGAGGCTGAGGGG - Intergenic
1126109787 15:45168464-45168486 CCCTGGCCACAGAGGCTGGAGGG - Intronic
1127389267 15:58492091-58492113 CCCTGCTGTCAGATTCTGGGTGG - Intronic
1127995762 15:64152378-64152400 CCCGCCTCACAGGGCCTGGGCGG - Intronic
1129159200 15:73737808-73737830 CCCTCCGGACAGACGCTGGGGGG + Exonic
1129168669 15:73794467-73794489 CCCTGCTCACAGATGGCAGGAGG - Intergenic
1129250073 15:74303786-74303808 GCCTGCTGACAGGGGCTGGAGGG + Intronic
1129706412 15:77797053-77797075 CCCTACTCACAGAGGATGGAGGG - Intronic
1130256937 15:82330128-82330150 CCCTGCACACAGTGGGTGGTGGG + Intergenic
1130598011 15:85259860-85259882 CCCTGCACACAGTGGGTGGTGGG - Intergenic
1132323238 15:100942849-100942871 CTCTGCTCACAGTGGGCGGGTGG + Intronic
1132771439 16:1565619-1565641 CCTGGCTCACGCAGGCTGGGCGG + Intronic
1133371839 16:5251128-5251150 CCCTGTTAGCAGGGGCTGGGGGG - Intergenic
1136024356 16:27460454-27460476 ACCTGCTGGCTGAGGCTGGGCGG + Intronic
1136662107 16:31772049-31772071 CCCTCCTCACTGAGGGTGAGGGG + Intronic
1136845551 16:33573303-33573325 CCAAGGTCACAGAGCCTGGGAGG - Intergenic
1137983248 16:53087326-53087348 CCCTGCAGTCAGAGGCTGAGAGG - Intronic
1137984825 16:53099032-53099054 CACTACCCACAGAGGGTGGGTGG + Intronic
1138279604 16:55762709-55762731 CCCTGTTTACATAGGCTCGGTGG - Intergenic
1138288920 16:55830967-55830989 CCCTGTTTACACAGGCTCGGTGG + Intronic
1139233077 16:65305809-65305831 CCCTGCTCCCAGTGGCTGCTGGG - Intergenic
1139316295 16:66072252-66072274 CTGTGCTCACATAGGCTGAGAGG + Intergenic
1139319063 16:66098203-66098225 GCATGCTGACATAGGCTGGGAGG - Intergenic
1139355105 16:66362994-66363016 CCCGGGTCAGAGAGACTGGGGGG - Intergenic
1140962960 16:79934793-79934815 TCCACCTCACAGAGGCTGTGAGG - Intergenic
1141172165 16:81698281-81698303 CCCCGGTCACCGGGGCTGGGGGG - Intronic
1141612209 16:85188047-85188069 CCCTGTTCACAGTGGCTGCCAGG + Intergenic
1141807683 16:86352500-86352522 CCCTGCACCCAGGAGCTGGGGGG + Intergenic
1141833340 16:86522035-86522057 CCCTGCCCACAGGGGCACGGTGG + Intergenic
1203107259 16_KI270728v1_random:1421956-1421978 CCAAGGTCACAGAGCCTGGGAGG - Intergenic
1143178022 17:4967740-4967762 TCCTGGTCACCGAGGCTGGGTGG + Exonic
1143614140 17:8039551-8039573 CCCTGCTACCAGTGGCTGGAGGG + Exonic
1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG + Intronic
1146633051 17:34484410-34484432 CACGGCTCCCGGAGGCTGGGAGG + Intergenic
1146744060 17:35313089-35313111 CCCTGATGACAGTGGGTGGGTGG + Intergenic
1146891763 17:36510903-36510925 CCGTCCTGACAGAGTCTGGGAGG + Exonic
1147457684 17:40548606-40548628 CAGCGATCACAGAGGCTGGGGGG - Intergenic
1147776294 17:42904055-42904077 CCCTGCAGACAGAAGCTGAGTGG + Intronic
1148127359 17:45243728-45243750 CCCTGCTCCCAGGGACTGGTGGG + Intronic
1148206365 17:45782835-45782857 CCCAGCTCACAGTGCCTGGAGGG - Intergenic
1150207117 17:63417430-63417452 CCCTGGAAACAGAGACTGGGGGG - Intronic
1151209764 17:72535789-72535811 CCCTGCTCCCTGAGGCTGCCTGG - Intergenic
1151493183 17:74444509-74444531 CCCGGCTGGCAGAGGCTGTGGGG + Intronic
1151659905 17:75513647-75513669 CTCAGTTCACAGAGGCTTGGTGG - Intronic
1151783266 17:76261750-76261772 CCATCCCCACAGAGGCGGGGAGG + Intergenic
1151898147 17:76994226-76994248 CCTTGCTCAGAGATGATGGGAGG + Intergenic
1152130700 17:78474603-78474625 CCCAGATCACAGAGGCAGAGAGG - Intronic
1152234834 17:79133145-79133167 CCCTGCCCACAGGAGCAGGGTGG + Intronic
1152267666 17:79305649-79305671 CCCAGCCCACACAGGCTGTGTGG - Intronic
1152534268 17:80941343-80941365 CCCCGGTCACAGAGACTGTGTGG + Intronic
1152888869 17:82868395-82868417 CGCTGCACACAGAGGCCCGGGGG - Intronic
1153656974 18:7291203-7291225 TTCTGCTCACAGAGGCTGCGAGG + Intergenic
1156637204 18:39046123-39046145 CCCTGCCCACTGAGGCTGAGAGG - Intergenic
1157487367 18:48097933-48097955 GCCTGCTGAGAGAGGCTGGGTGG - Intronic
1158565312 18:58549999-58550021 CCCTGCTCAGAGCTACTGGGAGG - Intronic
1159043741 18:63348653-63348675 CACTTGTCACAGAGGTTGGGGGG + Intronic
1159253042 18:65906780-65906802 ACCTTCCCACAGAGGCTGGGAGG + Intergenic
1160187848 18:76689160-76689182 CTCTGCTCACAGGGGCTAAGAGG - Intergenic
1160509193 18:79443835-79443857 CCCTTCCCAGAGAGGGTGGGCGG - Intronic
1160534848 18:79586271-79586293 CTCTGACCACAGGGGCTGGGAGG - Intergenic
1161010302 19:1956636-1956658 CCCTCCACAGAGGGGCTGGGTGG + Intronic
1161768781 19:6220473-6220495 CGCTGCTTAGAGTGGCTGGGTGG - Intronic
1162771699 19:12953272-12953294 GCCTGCTCAGAGAAGCTGGCAGG + Exonic
1162796875 19:13091678-13091700 CCCTGCTGGCAGAGGCGGGAGGG + Intronic
1163362165 19:16853466-16853488 CTCTGCCCACAGACCCTGGGCGG - Intronic
1163406556 19:17126497-17126519 CCATTCTGACAGAGACTGGGTGG - Intronic
1163525030 19:17815665-17815687 CCCTGCTCACACAGCCTCTGTGG + Intergenic
1163813680 19:19450593-19450615 CCCTCCTCTCACAGGCTAGGGGG + Intronic
1164399716 19:27894241-27894263 CCCAGCTCTCACAGGCTGAGTGG + Intergenic
1164458682 19:28429483-28429505 CCACCCCCACAGAGGCTGGGAGG - Intergenic
1164479417 19:28599971-28599993 CCCAGCTCCCCGAAGCTGGGAGG - Intergenic
1164962195 19:32443158-32443180 CCCTGCTGACACATGCTGGCTGG - Intronic
1165019036 19:32908039-32908061 TCCTGCACACAGAGGCTAGATGG - Intronic
1165782573 19:38442698-38442720 CCCTGCACACAGGGGCTGGAGGG + Intronic
1166670713 19:44708039-44708061 CCCCGCGCACACAGGCCGGGAGG + Exonic
1166703194 19:44893908-44893930 CCCTGCTCACGGTGGCCGAGGGG - Intronic
1167156725 19:47743229-47743251 CCGTGCTCTCAGGGGCGGGGTGG + Intergenic
1167261818 19:48463045-48463067 CCCTGCTCTCAGAGGTTAGGAGG - Intronic
1167415570 19:49369673-49369695 CCTTTCTCAGAGTGGCTGGGCGG - Intronic
1168056462 19:53867674-53867696 CCCTGCTCACTGGGGTGGGGCGG + Intronic
1168172548 19:54598031-54598053 CCCTGAGCACAGAGCCTTGGTGG - Intronic
1168292740 19:55364849-55364871 CCCTGCTCCGGGCGGCTGGGTGG + Exonic
1168467331 19:56613754-56613776 CCCTCCTTACAGAGGCGTGGAGG - Intronic
1202710592 1_KI270714v1_random:17484-17506 CCCTGAGCCAAGAGGCTGGGTGG - Intergenic
924988234 2:289317-289339 CCCTGGTCCCCGAGGCGGGGCGG + Intergenic
925018401 2:549027-549049 CCCTGCACACACAGCCTGGCAGG - Intergenic
925205709 2:2003785-2003807 TGCTGCTCCCAGAGGCTGAGGGG - Intronic
926741110 2:16111605-16111627 TCCTTCACACAGCGGCTGGGAGG + Intergenic
928357592 2:30633949-30633971 CCCAGCTCACTGAGAATGGGAGG - Intronic
928466519 2:31527747-31527769 CCCTCCTCACAGAGTCTAGGAGG + Intronic
928593380 2:32839106-32839128 TCCTGGTCACAGGGGCTGGAGGG + Intergenic
929350104 2:40940291-40940313 AGATCCTCACAGAGGCTGGGTGG - Intergenic
929509343 2:42554734-42554756 CCCTTCTCAGAGAGGCTGTGAGG - Intronic
929604881 2:43227266-43227288 CCCTGTTTACTGAGCCTGGGCGG - Intergenic
932093698 2:68828590-68828612 TCCTGCTGAAAAAGGCTGGGAGG + Intergenic
932588072 2:73044670-73044692 CCCTGAACACAAAGGCTGTGAGG + Intronic
932805472 2:74779075-74779097 CCCTGCACCCACAGGCTGCGAGG + Intergenic
933538095 2:83602791-83602813 CCCCACTTTCAGAGGCTGGGTGG + Intergenic
934917766 2:98314156-98314178 CTCAGCTCACAGAGGCTGCCGGG - Intergenic
935124018 2:100207299-100207321 TCCTGCTCACAGAGGCTCAGGGG - Intergenic
936250709 2:110866324-110866346 ACCTGCTCTCAAAGGCAGGGAGG + Intronic
938652206 2:133395196-133395218 CCCTGAGCACAGAAGCTGGGAGG - Intronic
938727626 2:134121232-134121254 CCCTGCTCCCCGTGGCGGGGTGG + Intronic
940797848 2:158099470-158099492 CCCTACTCCCATAGGCTGTGAGG + Intronic
942063870 2:172252248-172252270 CACTGCTCTCAGAGGCAGTGTGG - Intergenic
942461383 2:176171113-176171135 CCCTGGCAGCAGAGGCTGGGAGG + Intronic
942541275 2:177017771-177017793 CCCTGGGGACAGAGGGTGGGAGG + Intergenic
943484824 2:188465802-188465824 CCCTGCTCAGAGAGGCAGCCTGG - Intronic
945594341 2:211773178-211773200 CCTTGGTAGCAGAGGCTGGGAGG + Intronic
946159980 2:217830170-217830192 CCCTGGGCACAGGGGCTGCGAGG - Intronic
946415849 2:219539291-219539313 CCCTGCCCAGCGAGGCTGGCAGG + Exonic
947565324 2:231189772-231189794 CCCTGCTCACAGAGGGAGGGAGG + Intergenic
947583229 2:231334766-231334788 CCCGGCACACAGAGGCTGGCAGG - Intronic
947713926 2:232330544-232330566 CCCTGCTCAGAGGGGATGGGTGG - Intronic
948561599 2:238857257-238857279 CCCTGGTCCCTGAGGCTGGACGG + Intronic
1168790535 20:573039-573061 CCACGCTCACAGAGCCAGGGAGG - Intergenic
1170575168 20:17657185-17657207 CCCTACTTCCAGAGGCTGGCAGG - Intronic
1172031939 20:31988390-31988412 ACCTGTTCACAGAGGCAGTGGGG + Intronic
1172481838 20:35276088-35276110 CCCTGCTCACTGAGCCTGCATGG + Exonic
1172764626 20:37345055-37345077 CCCTGCTGAGAGGAGCTGGGAGG - Intronic
1173500521 20:43549561-43549583 CCCTTCCCACCCAGGCTGGGAGG - Intronic
1173645377 20:44629874-44629896 CCCTGCTTCCCGTGGCTGGGAGG - Intronic
1173669228 20:44786241-44786263 CCCCTCCCTCAGAGGCTGGGTGG - Intronic
1173763859 20:45588330-45588352 CCCTGCCCACAGGGTTTGGGAGG - Intergenic
1173877097 20:46380077-46380099 CTCTGCTCACAGAGGATCGCGGG + Intronic
1174334141 20:49845730-49845752 CACTGCTCACCAAGGCAGGGAGG - Intronic
1175263708 20:57690170-57690192 CCCAGCTGGCAGAGGCAGGGAGG - Intronic
1175686277 20:61031011-61031033 CCCTGACCACAGGGGCTGTGGGG - Intergenic
1176411152 21:6450267-6450289 GCCTGCACACAAAGGGTGGGTGG + Intergenic
1176457770 21:6928622-6928644 CCCTGGTCACTGAGGGTGGCAGG - Intergenic
1176835942 21:13793706-13793728 CCCTGGTCACTGAGGGTGGCAGG - Intergenic
1178907164 21:36646350-36646372 CCCTGAGGACAGAGACTGGGTGG - Intergenic
1179361948 21:40718032-40718054 CCCTGCCCACCGATGCTGGTAGG - Intronic
1179544522 21:42105373-42105395 CCCTAGTCCCAGAGGATGGGAGG - Intronic
1179686645 21:43058589-43058611 GCCTGCACACAAAGGGTGGGTGG + Intronic
1179928705 21:44552416-44552438 CCCAGCTGAAAGAGGCTGGAAGG - Intronic
1179996645 21:44977367-44977389 CCCTGGTCACTGAGGATGGCAGG - Intergenic
1180600573 22:17012687-17012709 GCCTGCTCACCGAGACTGAGTGG + Intergenic
1180719950 22:17900624-17900646 ACCTCCTCACAGTGACTGGGCGG - Intronic
1181522582 22:23458207-23458229 CCCGGCCCTCAGAGGCTGGCAGG - Intergenic
1181583076 22:23838531-23838553 CCCTGCGGACACGGGCTGGGTGG - Intronic
1181713417 22:24706165-24706187 TCCTGCTCACACAGGCAGGAAGG + Intergenic
1182450537 22:30417889-30417911 CCCTCCTCACAGATGCTCTGTGG + Intronic
1183344312 22:37298760-37298782 CCCTGCTCACCGCGGGAGGGAGG - Intronic
1183358495 22:37371697-37371719 CCATGGTGACAGAGGCTGGCTGG + Exonic
1183579049 22:38712302-38712324 CCATTCTCACAGAGGCATGGAGG + Intronic
1184263959 22:43336698-43336720 CCCTGCTCCCAGAGGCTTCTGGG - Intronic
1184596400 22:45516744-45516766 CCCGGCTCCCCGAGGCTGGCAGG - Intronic
1184696122 22:46140010-46140032 CCAAGGTCACAGAGCCTGGGAGG + Intergenic
1184920152 22:47600459-47600481 ATGTGTTCACAGAGGCTGGGGGG - Intergenic
1184920242 22:47600739-47600761 GGGTGTTCACAGAGGCTGGGGGG - Intergenic
1185208100 22:49551744-49551766 CCCTGCTCGCAGGCGCTGGGTGG - Intronic
949679241 3:6494144-6494166 CCCAGCTCAGAGAGTCAGGGTGG + Intergenic
949732953 3:7135198-7135220 CTCTGCTCACATAGGATGGTTGG - Intronic
950464956 3:13148263-13148285 CCATCCTCACAGAGGGAGGGAGG + Intergenic
950515884 3:13464892-13464914 CCAAGATCACACAGGCTGGGTGG + Intergenic
952740916 3:36733505-36733527 ACCAGCTCACAGAGGGTGGAAGG - Intronic
952883185 3:37998082-37998104 CCCTTCTCATAGACACTGGGGGG - Exonic
952889683 3:38031552-38031574 CCTGGCTCTCACAGGCTGGGAGG + Intergenic
953922244 3:46960215-46960237 CTCTGTGCACAGAGCCTGGGTGG - Intronic
954498488 3:50988088-50988110 TGCTGCTACCAGAGGCTGGGTGG - Intronic
954715189 3:52523415-52523437 CTCTGCTCACAGACGCTGAGTGG + Exonic
955182062 3:56682361-56682383 CTCTGCTTTCAGGGGCTGGGAGG + Intronic
955596916 3:60601031-60601053 CCCTGCCAGCAGAGGCTGGAAGG + Intronic
960019334 3:112932130-112932152 CTTGGCTCACAGAGGGTGGGTGG - Intronic
960036841 3:113110461-113110483 CCCAGCTCACTGAAGCTGGAAGG + Intergenic
960439541 3:117669875-117669897 ACTTGCTCACAGAGTCGGGGAGG + Intergenic
960709271 3:120511233-120511255 TCCTGCTGACAGAGGTTGGGGGG - Intergenic
961282976 3:125777973-125777995 CCCTGTTAGCAGGGGCTGGGGGG - Intergenic
961422657 3:126818624-126818646 TCCTGCCCACAGAGGCTGAGTGG + Intronic
962065394 3:131974633-131974655 CCCTGTTCACAGAGTATGGGAGG - Intronic
963064521 3:141252929-141252951 CCCTGCTGAGAGGGGCAGGGAGG + Intronic
963281409 3:143387992-143388014 CCCTGGTGACAGGGGCTGGGTGG + Intronic
964372836 3:156019042-156019064 CCCTAGTCACAGAGGCAGGAAGG + Intergenic
964633268 3:158835078-158835100 CCCTGCTCACACCGGGTGAGTGG - Intergenic
965256771 3:166424058-166424080 CCGCGCTCAGAGCGGCTGGGCGG + Intergenic
967868897 3:194213226-194213248 CCGTGCTCACAGCAGCTGGGTGG + Intergenic
968089017 3:195888596-195888618 CTCCCCCCACAGAGGCTGGGAGG - Exonic
968801767 4:2747568-2747590 CCCTGATCACAGAGGTGGGGGGG - Intronic
968880966 4:3299921-3299943 CCAGGCTCACTGAGGGTGGGAGG + Intronic
969103879 4:4790562-4790584 CTAGGCTCAGAGAGGCTGGGCGG + Intergenic
969183362 4:5458404-5458426 CCCTGCTCACAGGGCTTGGGAGG - Intronic
969202294 4:5615862-5615884 CCCTTCTCAGAGAGGCTGACAGG - Intronic
969282869 4:6182932-6182954 GTCTGCTCACAGAGACTTGGAGG + Intronic
970993289 4:22237273-22237295 CCCTGCCCAGAGGTGCTGGGAGG + Intergenic
971244699 4:24917347-24917369 CCGCGCTCACAGTGGCTGAGTGG + Intronic
973626814 4:52780892-52780914 CCCAGCTAACAGAGGGTGGAGGG - Intergenic
975490662 4:74984930-74984952 CCCTCATCACAGAGGATGGCAGG + Intronic
975683567 4:76898191-76898213 CCCTTCCCCCAGAGGCAGGGAGG - Intergenic
978390055 4:108215911-108215933 CCATGCTGACAGTGGCAGGGAGG + Intergenic
981076258 4:140595375-140595397 CCCTGCTGAGGGTGGCTGGGAGG + Intergenic
981634261 4:146857614-146857636 CCCTTCTCCCAGAGGATGGCTGG - Intronic
983536154 4:168859265-168859287 CCATGCTCACAGCTGCTGGCAGG + Intronic
985902011 5:2803918-2803940 TCCTCCTCTGAGAGGCTGGGAGG + Intergenic
986269494 5:6218488-6218510 CCATGCATCCAGAGGCTGGGAGG - Intergenic
988269121 5:28991578-28991600 CCCTGCCCCCAGAGGCAGGCAGG - Intergenic
989171852 5:38479112-38479134 CCCTACACACACAGGTTGGGGGG + Exonic
993882798 5:93382505-93382527 AGCTGCTCACAGAGGTTTGGTGG - Intergenic
997441208 5:133909705-133909727 CCAAGCTCACAGTGGCAGGGTGG + Intergenic
998266784 5:140672898-140672920 CCCTCTTCCCACAGGCTGGGTGG - Exonic
998538771 5:142959544-142959566 CGCTGCCTCCAGAGGCTGGGAGG - Intronic
998587523 5:143443039-143443061 CCCTGCTCACAAAGGTTGTCAGG + Intergenic
1001029897 5:168254634-168254656 TCCTGGTCACAGAGGCAGGAGGG + Intronic
1001478052 5:172064954-172064976 ACCTGCTCAGAGGGGCTTGGTGG - Intronic
1001548771 5:172587148-172587170 TCCTGCTCAGGAAGGCTGGGTGG - Intergenic
1001568687 5:172716450-172716472 TCATGCTCAGGGAGGCTGGGAGG + Intergenic
1002055582 5:176596480-176596502 CCCAGCTCTCAGGGGGTGGGAGG + Exonic
1002212171 5:177605560-177605582 CCCTGTGCACAGAGGCTGGCAGG - Intronic
1002293063 5:178212724-178212746 GCCTGCTCAGGCAGGCTGGGTGG + Intronic
1002512771 5:179733415-179733437 CCCTACTCACCGTGGCCGGGCGG - Exonic
1002558408 5:180062359-180062381 CCCTTATAAAAGAGGCTGGGGGG - Intronic
1003251494 6:4432584-4432606 CCCTGGCCACAGAGCCTGGTGGG + Intergenic
1003880339 6:10474917-10474939 CCCAGCTCCCAAATGCTGGGAGG + Intergenic
1005898146 6:30195784-30195806 TCCTGCTCTCATAGGCTGGGAGG - Intronic
1006440654 6:34051712-34051734 CCCAGCTCACTGAGGTTGGGGGG + Intronic
1006449690 6:34098935-34098957 CCCAGCCCACAGAGGGAGGGAGG - Intronic
1006459230 6:34148730-34148752 CAATGCTCAGAGAGGCTGGGGGG - Intronic
1007445341 6:41901319-41901341 TCCTGCTCACAAAAGCTGGCTGG + Intergenic
1007595242 6:43047056-43047078 CCCTGCTCACTGAGGTCAGGCGG + Exonic
1007600098 6:43076191-43076213 CCCTCCTCGCCGAGGCGGGGAGG - Intergenic
1007765019 6:44155058-44155080 CTCTCCTCACTGAGGTTGGGGGG - Exonic
1015471897 6:133615045-133615067 CCCTGCTCAGAGAGGCAGTCTGG - Intergenic
1015684381 6:135843196-135843218 GCATGCTCACAGTGGCTGAGTGG + Intergenic
1016988869 6:149915924-149915946 CCCTGCTCACAGGGGCTTTTTGG + Intergenic
1017696712 6:157022237-157022259 CCCGACGCACCGAGGCTGGGCGG + Intronic
1018254198 6:161902222-161902244 CCATGCTCACAGAGGGTGCGAGG - Intronic
1019075640 6:169385959-169385981 ACCTGCTCTCAGGGGCTTGGAGG - Intergenic
1019146897 6:169981422-169981444 CACTGCTCACTGAGGCTGGAGGG + Intergenic
1019146915 6:169981494-169981516 CACTGCTCACCGAGGCTGGAGGG + Intergenic
1019540922 7:1550619-1550641 CCCCTCTCACGGAGGCTGTGGGG + Intronic
1019588742 7:1818337-1818359 CCCGGCCCTCAGAGGCTGGCAGG + Intronic
1019725813 7:2602114-2602136 CCCTGCACACAAAGGCCAGGAGG + Intronic
1020081947 7:5291015-5291037 CGCTGCCCACAGAGGGTGAGTGG - Intronic
1022122205 7:27319893-27319915 CCATGCTCAGAAAGGCTTGGAGG + Intergenic
1022353884 7:29592673-29592695 CCATGCACATAAAGGCTGGGAGG - Intergenic
1022616888 7:31940780-31940802 ACCTGCTCACAGAGCGTGGCTGG - Intronic
1023055258 7:36285458-36285480 AGCTGCTCCCAGATGCTGGGGGG - Intronic
1024234191 7:47385483-47385505 CGATGCTCAGAGAGGCAGGGAGG + Intronic
1025196970 7:56941123-56941145 CGCTGCCCACAGAGGGTGAGTGG + Intergenic
1025674978 7:63635814-63635836 CGCTGCCCACAGAGGGTGAGTGG - Intergenic
1025957830 7:66196363-66196385 CCCTGGTTAAAGAGGCTGGAAGG - Intergenic
1026901424 7:74039518-74039540 CCTTGGTGACAGAGGGTGGGTGG + Intronic
1026934687 7:74247061-74247083 CCCGGCTCACTGAACCTGGGAGG - Intronic
1026956147 7:74377471-74377493 ACCTCCTCAGAGGGGCTGGGAGG - Intronic
1027125768 7:75555737-75555759 GGCTGCCCACAGAGGCTGTGGGG + Intronic
1028082728 7:86598904-86598926 CACTGCTCCCAGCGGCTGGCTGG - Intergenic
1029073412 7:97918078-97918100 CCCTGTTAGCAGGGGCTGGGGGG + Intergenic
1029375733 7:100176061-100176083 CCCTGGAGACAGAGTCTGGGGGG + Intronic
1029995113 7:105000320-105000342 CTCTGGTCACAGAGGCTTGAGGG + Intergenic
1033159341 7:138982029-138982051 CCCTGCGCTCAGGGCCTGGGAGG + Intergenic
1033384635 7:140860527-140860549 CCCAGCTAACAGAGGCTGAGAGG + Intronic
1034215840 7:149404974-149404996 CACTGCTGACAGAGGGCGGGAGG + Intergenic
1034270685 7:149802239-149802261 CCCTGCTCCCAGAGGGAGGTGGG + Intergenic
1034446669 7:151117233-151117255 TCCTGCCCACAGGGTCTGGGTGG + Intronic
1036655160 8:10673000-10673022 CCCTGCACACAGTGGCTCGCAGG - Intronic
1036707717 8:11057579-11057601 CCACGGTCACAGAGGCTGGGCGG + Intronic
1036897556 8:12648197-12648219 CCCTGTTAGCAGGGGCTGGGGGG + Intergenic
1038423570 8:27450687-27450709 CCCTGCTCTCAGACTCAGGGAGG - Intronic
1038938882 8:32282033-32282055 CACCGCTCACAGAGTCTGGTGGG + Intronic
1039598523 8:38812715-38812737 CCATGCTCACAGAGCCTTGCAGG - Intronic
1039785871 8:40833730-40833752 CCCTGCTCTCAGATGCTGCATGG - Intronic
1045555735 8:103213153-103213175 CCCTGGACATAGCGGCTGGGTGG - Intronic
1047254459 8:123205525-123205547 CCCTGCTCTGTGAGGCAGGGCGG - Intronic
1049003147 8:139838689-139838711 TCCTCCTCCCAGAGGCTGGCAGG - Intronic
1049197764 8:141324928-141324950 CTCTGCCCACAGTGGGTGGGAGG + Intergenic
1049323525 8:142010122-142010144 TCCTGCTCCAAGCGGCTGGGTGG + Intergenic
1049454198 8:142678705-142678727 CTCTGCTGCCAGTGGCTGGGTGG - Intronic
1049511012 8:143026684-143026706 CCGTGCAGACAGAGCCTGGGAGG + Intergenic
1049696344 8:143985965-143985987 CCCTGCCCACAGACGCCGAGAGG - Exonic
1052013796 9:23442256-23442278 CTCTGCTCAAAGAAGTTGGGAGG + Intergenic
1055743715 9:79418825-79418847 GAGTGGTCACAGAGGCTGGGAGG - Intergenic
1055816443 9:80212659-80212681 CTAAGCTCACAGAGGCAGGGAGG - Intergenic
1056797426 9:89668305-89668327 ACCTTCTCACAGAGGCTGCATGG + Intergenic
1057290400 9:93802663-93802685 CCCTGCTCACACCTGCTGGGTGG + Intergenic
1057334083 9:94142280-94142302 CCCAGGCCACAGCGGCTGGGAGG - Intergenic
1057476302 9:95405782-95405804 CCCAGGTCACAGTGGCTGAGTGG - Intergenic
1057572866 9:96217670-96217692 CCCTGCCCAGAGACGCCGGGAGG + Intergenic
1057854745 9:98593749-98593771 GCCTGCTCACAGATGAAGGGGGG + Intronic
1059039892 9:110801022-110801044 CCTGGCTCACAGAGTCTGAGAGG - Intronic
1060020725 9:120128380-120128402 TCATGGTCACAGAGGCTGGGGGG + Intergenic
1060301144 9:122375264-122375286 CCCTGCCAAGAGAGGCTGTGCGG - Intronic
1061679602 9:132236433-132236455 CCCAGCTCACCAAGCCTGGGTGG + Intronic
1062479343 9:136744255-136744277 CCCTACGCACAGTGGGTGGGAGG - Intronic
1062606959 9:137352776-137352798 CCCTCCTCACAGGGCCTGGTGGG - Exonic
1062610306 9:137370485-137370507 CTCTGCTGCCAGAGGATGGGAGG + Intronic
1186474827 X:9849216-9849238 GCCTCAGCACAGAGGCTGGGAGG + Intronic
1186475977 X:9857982-9858004 CAGCGCTCGCAGAGGCTGGGAGG - Intronic
1187169416 X:16836607-16836629 CCCTGCTGGCTGTGGCTGGGCGG + Intronic
1188144696 X:26596844-26596866 CCCAGCTCACAAAGGATGGCAGG - Intergenic
1190321750 X:49184017-49184039 CCCTGCTCACAGACCTTTGGTGG - Intronic
1198278976 X:135123780-135123802 CCCTGCTTAGAGAAGCTGGAAGG + Intergenic
1198291982 X:135248740-135248762 CCCTGCTTAGAGAAGCTGGAAGG - Intergenic
1199951201 X:152707423-152707445 CCCTACTAACAGAGGCAGGTAGG - Intergenic
1199958480 X:152761038-152761060 CCCTACTAACAGAGGCAGGTAGG + Intergenic
1201147519 Y:11073062-11073084 CCATGCTCCCAGAGGAGGGGTGG + Intergenic