ID: 1084950126

View in Genome Browser
Species Human (GRCh38)
Location 11:72660325-72660347
Sequence GCCCCTCCTTAGTTTCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 161}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084950126_1084950133 24 Left 1084950126 11:72660325-72660347 CCATGCAGAAACTAAGGAGGGGC 0: 1
1: 0
2: 0
3: 11
4: 161
Right 1084950133 11:72660372-72660394 CACATATTAGGTGCTCACACAGG 0: 1
1: 0
2: 2
3: 13
4: 118
1084950126_1084950134 27 Left 1084950126 11:72660325-72660347 CCATGCAGAAACTAAGGAGGGGC 0: 1
1: 0
2: 0
3: 11
4: 161
Right 1084950134 11:72660375-72660397 ATATTAGGTGCTCACACAGGAGG 0: 1
1: 0
2: 0
3: 5
4: 96
1084950126_1084950132 12 Left 1084950126 11:72660325-72660347 CCATGCAGAAACTAAGGAGGGGC 0: 1
1: 0
2: 0
3: 11
4: 161
Right 1084950132 11:72660360-72660382 CCACTACAGAGGCACATATTAGG 0: 1
1: 0
2: 0
3: 8
4: 88
1084950126_1084950129 1 Left 1084950126 11:72660325-72660347 CCATGCAGAAACTAAGGAGGGGC 0: 1
1: 0
2: 0
3: 11
4: 161
Right 1084950129 11:72660349-72660371 GGTCACAGAGCCCACTACAGAGG 0: 1
1: 0
2: 0
3: 15
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084950126 Original CRISPR GCCCCTCCTTAGTTTCTGCA TGG (reversed) Intronic
900458215 1:2787502-2787524 GCCCCTCCTCAGCTGCAGCAGGG + Exonic
902559289 1:17267001-17267023 GCCCCTCCCTAGTGTCTCTAGGG + Intronic
902797812 1:18810594-18810616 GTCCCTCCTAACTTTCTGCTGGG + Intergenic
905771090 1:40638504-40638526 GCCCCTCCTTTGTTTGTGATGGG - Intronic
908775658 1:67637523-67637545 GCCTTTCCTTAGTGTTTGCAAGG - Intergenic
912876998 1:113370451-113370473 CCCCCTCCTTATTTCCTGCTAGG + Intergenic
915065515 1:153221183-153221205 GCCCCTCCCTACTTCCTGAAAGG - Intergenic
915897180 1:159821288-159821310 ACCTCTCCTCAGTGTCTGCAGGG - Intergenic
917261800 1:173177659-173177681 GTCCCTGCTAAGTTTCTTCAAGG + Intergenic
922031065 1:221799277-221799299 GCCCTTCCTTCTTTTCTTCAGGG + Intergenic
924681585 1:246240162-246240184 GCCCCTCCCTAGGTCCTGAATGG + Intronic
924924957 1:248671387-248671409 GGTCCACCTTAGGTTCTGCAGGG + Intergenic
1063089926 10:2854943-2854965 TCCCCTCATTATTTTCTTCATGG - Intergenic
1064425344 10:15224848-15224870 CCCCCTCTTTAGTTCCTGCCAGG + Intronic
1065320746 10:24506951-24506973 CCCCCGACTTAGTTTCTGCCTGG - Intronic
1067512664 10:46908814-46908836 CCGCCTCCTTATTTCCTGCATGG - Intergenic
1067649581 10:48143008-48143030 CCGCCTCCTTATTTCCTGCATGG + Intergenic
1068828164 10:61462939-61462961 CCCCCTCCTTATTTTCTGCCAGG - Intergenic
1070618394 10:77987313-77987335 GCCCCTCCTTTGTAGCAGCAAGG + Intronic
1074435979 10:113434782-113434804 CCCCCACCTCAGTTTCTCCATGG + Intergenic
1074709741 10:116167339-116167361 GCCCCTCCGTATTTTCTCCTTGG + Intronic
1074848860 10:117422421-117422443 ACCCGTCCATAGTTTCTGGATGG - Intergenic
1080799767 11:35599364-35599386 GCCCCTTCTTAGCTGCAGCATGG + Intergenic
1083697173 11:64450529-64450551 CCCTTCCCTTAGTTTCTGCATGG - Exonic
1084192878 11:67506796-67506818 GCCACTCCTTGGTTCCTGGAGGG + Exonic
1084230713 11:67750673-67750695 GCCCCTCCTTAGTTTTCACTTGG - Intergenic
1084950126 11:72660325-72660347 GCCCCTCCTTAGTTTCTGCATGG - Intronic
1090703630 11:129317053-129317075 TCCACTGCTTAGTGTCTGCATGG + Intergenic
1091144702 11:133267862-133267884 GCTCCTCCTTACCTTCTGCATGG + Intronic
1091203479 11:133800739-133800761 GCCCCTCCTTTCTATGTGCAGGG - Intergenic
1092576945 12:9795286-9795308 GACCCTGCTTTGTTTCTTCAAGG + Intergenic
1093876311 12:24353327-24353349 GCCCTTCCATAGTTTCTTTACGG - Intergenic
1094829522 12:34293659-34293681 GCCCCTACGTGGTGTCTGCAGGG - Intergenic
1095638573 12:44459984-44460006 TCCACTCATTAGATTCTGCATGG + Intergenic
1095956844 12:47811823-47811845 GCCCCTCCTGAGTCTCGCCAAGG + Intronic
1096868184 12:54577541-54577563 GTACCTCCTTTGTTCCTGCAGGG - Intronic
1097324274 12:58258175-58258197 GCTCCTCCTCACTCTCTGCAAGG - Intergenic
1102033759 12:109759438-109759460 CCCCCTCCTCAGCTTCTGGAAGG + Intronic
1103094639 12:118122946-118122968 GCCGATCCTTAGTTTCTTGATGG + Intronic
1103585218 12:121948156-121948178 TCACTTCCATAGTTTCTGCAGGG + Intronic
1104856238 12:131903733-131903755 GCCAGGCCTTGGTTTCTGCAAGG + Intronic
1108693859 13:52885428-52885450 GCCTCTGCTTAGTTTCAGCAGGG - Intergenic
1109880756 13:68471543-68471565 GCCCCTCTGTAGATTCTGCAAGG + Intergenic
1110517612 13:76434146-76434168 GCTGCTCCTCAGTTTCTGAAAGG - Intergenic
1113550355 13:111188208-111188230 GCACCTCCTCAGTCCCTGCAAGG + Intronic
1114554973 14:23556639-23556661 GCCCCTCATAAGTTTTTCCAGGG + Exonic
1114726511 14:24943271-24943293 GCCCCTTCTTCCTTTCTGAAAGG + Intronic
1116864109 14:50017474-50017496 TCCCCTCATTTCTTTCTGCAAGG + Intergenic
1119948984 14:78725132-78725154 TCCCCCTCTTTGTTTCTGCAGGG + Intronic
1120184860 14:81384050-81384072 ACTCCTCCCTACTTTCTGCAAGG + Intronic
1120515849 14:85469075-85469097 TCACTTCCTTAGTGTCTGCAGGG + Intergenic
1123154452 14:106210873-106210895 GCCCCTCCTGTCTTCCTGCAGGG + Intergenic
1202945896 14_KI270726v1_random:26579-26601 GCCCCTCCTGTCTTCCTGCAGGG - Intergenic
1128634959 15:69297304-69297326 TTCCCTCTTTAGTTTCTTCAAGG + Intergenic
1128709614 15:69861814-69861836 GCCCCTCCTTAATTTATCTAGGG - Intergenic
1128747838 15:70126976-70126998 GACCCCCCTAAATTTCTGCAGGG + Intergenic
1128802618 15:70506286-70506308 GCCCCTCTGGAGTTTCTCCAAGG - Intergenic
1128993692 15:72281075-72281097 GCCCCTTCTTAGTTTGTACTTGG + Intronic
1130895726 15:88169165-88169187 GCCTCACCTAGGTTTCTGCATGG + Intronic
1134680603 16:16122285-16122307 GCCTCTCCATCCTTTCTGCAAGG - Intronic
1137634546 16:49974411-49974433 GCCCCTCCTCTGTTTTTGAAAGG - Intergenic
1141025198 16:80540593-80540615 TCCCCTCCTTACTTGCTCCAGGG + Intergenic
1143574123 17:7779937-7779959 TCCTTTCCTTACTTTCTGCATGG - Intronic
1144582044 17:16464593-16464615 GCCCGTCCTCACCTTCTGCAGGG + Intronic
1146306901 17:31737009-31737031 GCCCCTCCCTGGTCTATGCAGGG + Intergenic
1148038099 17:44683929-44683951 TTCCCTCCTTAATATCTGCAAGG - Exonic
1151885720 17:76922313-76922335 CCCCCTTCCTGGTTTCTGCAAGG + Intronic
1152587616 17:81196068-81196090 GCCCCTCCTAGGTTTGTGGATGG + Intronic
1153806504 18:8712724-8712746 GCACCTCCTTAGTTACAGCTGGG + Intronic
1153990020 18:10388314-10388336 GCCACTGCTGAGTTTCTTCATGG - Intergenic
1157741576 18:50097852-50097874 GCTCCTCCTCAGTTTCACCAGGG - Intronic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1168095735 19:54113988-54114010 GCCCATCCTTATTCTCAGCAAGG + Intronic
927201921 2:20583332-20583354 GCCCCTCCCTGGTTCCTGCCTGG - Intronic
927201940 2:20583410-20583432 GCCCCTCCCTGGTTCCTGCCTGG - Intronic
929526116 2:42704453-42704475 GCCCCTCCTTACCTTCTGCCTGG + Intronic
929580440 2:43078840-43078862 GCCCCTCCTTAGGAGCTTCAGGG - Intergenic
930572463 2:53104381-53104403 GCCCCTTCCTAGTCTCTGCTTGG - Intergenic
930961601 2:57268258-57268280 GCCCCTCCTTCAATTCAGCATGG + Intergenic
931079891 2:58757041-58757063 ATCCCTCCTGAGTTTGTGCAAGG + Intergenic
934708008 2:96498170-96498192 GCGCCTCCTTCCTCTCTGCAGGG + Exonic
938109168 2:128552676-128552698 GCCCCTCCTTGGTTGCTGGGGGG + Intergenic
940953726 2:159706129-159706151 CTCCCACCTTACTTTCTGCATGG - Intergenic
942256025 2:174099042-174099064 GCCCCTTCTTAGAAACTGCAGGG - Intronic
943162535 2:184272390-184272412 GCCCATCCTTAGTGACAGCAGGG - Intergenic
945884219 2:215357744-215357766 AAACTTCCTTAGTTTCTGCAAGG + Intergenic
946319214 2:218940130-218940152 GCCCCTTCTAAGTTCCTGGAAGG - Intergenic
947362220 2:229357477-229357499 CCCCCTCCTTTGCCTCTGCAAGG - Intergenic
1169067706 20:2703659-2703681 GCCCCGCCTTTTTTTCTTCAAGG - Intronic
1171131418 20:22657264-22657286 GTTCCTCCTTAGTTGCTCCAGGG + Intergenic
1171364071 20:24611649-24611671 GCCCCTCCTCAGCCTCTGCCTGG + Intronic
1174387799 20:50197663-50197685 CCCCCACCTTATTTTCTTCAGGG - Intergenic
1175961845 20:62641413-62641435 GCACCTCCTTCGTCTCTCCACGG + Exonic
1176446917 21:6829493-6829515 GCCCCACCTTAGAGGCTGCATGG - Intergenic
1176825088 21:13694519-13694541 GCCCCACCTTAGAGGCTGCATGG - Intergenic
1177384831 21:20395122-20395144 ACCCCTACTAAGTTTCTGCCAGG - Intergenic
1177409494 21:20711300-20711322 GCCCTTCTTTAATTTCTTCAGGG + Intergenic
1178428953 21:32502396-32502418 GCCCCTCCTTAGTTTTCACTTGG + Intronic
1179392676 21:41008252-41008274 TCCCCTTCTCAGTTTCTGCAGGG - Intergenic
1182314035 22:29431467-29431489 GCCCCTCCTAAGTAGCTGAAAGG - Intergenic
1182579380 22:31295714-31295736 GCTCCTCCTTAGATTTTGAAGGG + Intergenic
1183567755 22:38628381-38628403 GCCCCTCAGTTGTTTCAGCAAGG - Intronic
1184154451 22:42657987-42658009 GGTCCTCCCAAGTTTCTGCAGGG - Intergenic
949773253 3:7601975-7601997 GCCCTTCCTTCTTTTCCGCATGG - Intronic
951348535 3:21576227-21576249 GCTCCTCCTTAGTTCCTCAAGGG - Intronic
952252324 3:31666462-31666484 GTCCCTCCTTTGCCTCTGCAGGG + Intronic
953474442 3:43193905-43193927 GCCCTTCCTTTGTCTCTTCAGGG + Intergenic
957047270 3:75385686-75385708 GCCCCTCCTTAGTTTTCACTTGG - Intergenic
959291488 3:104479960-104479982 GCCCCTGCTTATTTCCTGAATGG - Intergenic
959515441 3:107261396-107261418 CCTCCTGTTTAGTTTCTGCATGG - Intergenic
960084337 3:113574409-113574431 GCCCCTCCTTTGTTTGTTGAAGG - Intronic
960090265 3:113631399-113631421 GCTTCTCCTTAGTTTCACCAGGG - Intergenic
961879338 3:130049787-130049809 GCCCCTCCTTAGTTTTCACTTGG - Intergenic
963926549 3:150957375-150957397 GTCCCTCCTTAGCTCCTTCAGGG + Intronic
966070695 3:175873914-175873936 GCTCCTCCTAAATTTCTGTAAGG - Intergenic
967272202 3:187741101-187741123 GCCCCTCTTTATTTTCTGTCTGG + Intronic
969823783 4:9740711-9740733 GCCCCTCCTTAGTTTTCACTTGG + Intergenic
972711382 4:41598840-41598862 GCCCCTCCCAAGTTGCTGTAGGG - Intronic
981364050 4:143880711-143880733 GCCCCTCCAGAATTTCTGCATGG + Intronic
982986394 4:162212777-162212799 GCCCCTCAGTAGTTTCAGGATGG - Intergenic
986395179 5:7322082-7322104 GCCCCTCCTGGGCTGCTGCAGGG - Intergenic
992052035 5:72949940-72949962 CTCCCTCCTTTCTTTCTGCAAGG - Intergenic
995411413 5:111861249-111861271 TCCCCTCCCTAATTTCTGCTTGG + Intronic
997084396 5:130780625-130780647 GCCCCTGCTTTTTTTCTTCAGGG - Intergenic
997374497 5:133387460-133387482 GCCATTCCTTCTTTTCTGCAAGG + Intronic
997691094 5:135828010-135828032 GGCCCTCCTTGGGTTCTGGATGG - Intergenic
998974603 5:147630712-147630734 GTCTCTCCTTACCTTCTGCATGG - Intronic
999470494 5:151850492-151850514 GCCACTGCTTAGTTTCTCGATGG - Intronic
1001135479 5:169099146-169099168 GCCCCTTCCTTGTTTCTGGAGGG + Intronic
1001473655 5:172033919-172033941 GCCCCTGCACAGTTTCTGCAAGG + Intergenic
1002168044 5:177360173-177360195 ACCCCTCCTTAGTGCCTGCTTGG + Intronic
1002944543 6:1749008-1749030 CCCCCTCCTAAGATTCTTCAGGG - Intronic
1003306545 6:4934162-4934184 GCCCCTCCAGAGTATCTCCATGG - Intronic
1011311711 6:85986874-85986896 ATCTCTCCTTAGTTTCTGAAGGG + Intergenic
1014768751 6:125437261-125437283 CCCCCTCGTTAGTTTAGGCATGG - Intergenic
1014996226 6:128148675-128148697 GCCAGTCCTTGGTTTCTGCTCGG - Intronic
1017972993 6:159329235-159329257 GCCTCTCCTGAGTTTCCACATGG - Intergenic
1019688136 7:2393839-2393861 GCCCCGACTCAGATTCTGCACGG + Intergenic
1021880780 7:25093528-25093550 TGACCTCTTTAGTTTCTGCATGG + Intergenic
1023972174 7:44999872-44999894 ACCCCTACTTCGCTTCTGCACGG - Intronic
1025272820 7:57540956-57540978 GTCCATCCTTAGTCTCTTCATGG + Intergenic
1026960435 7:74404277-74404299 GCTCCCCCTTGGTGTCTGCATGG - Exonic
1027618819 7:80457406-80457428 GCTCCTCCCTTGGTTCTGCATGG - Intronic
1028892370 7:96002663-96002685 CTCCCTCCTTAGTTGCTGAATGG + Intronic
1029035072 7:97510893-97510915 GCCACACATTAGTTTCTGAATGG - Intergenic
1029885102 7:103861088-103861110 GTCCCTCCTCACTTTATGCAAGG - Intronic
1029912244 7:104165765-104165787 GACCCTCTTTAGTTTCTAGAGGG - Intronic
1031009392 7:116509763-116509785 TCACCTCCTTGGGTTCTGCAGGG + Intergenic
1031074948 7:117202870-117202892 TCCCCCCCTCAGTATCTGCAGGG + Intronic
1031150421 7:118047688-118047710 GCATCTGCTGAGTTTCTGCATGG + Intergenic
1032736029 7:134693405-134693427 GCCCCTCCTTCATTTCCACAGGG - Intergenic
1034298422 7:149994291-149994313 GCCCCTCTTTAGTTTCTGTGGGG - Intergenic
1034807592 7:154102491-154102513 GCCCCTTTTTAGTTTCTGTGGGG + Intronic
1036701877 8:11018395-11018417 TCCCTTCCTGAGTTTGTGCAGGG - Intronic
1037949783 8:23011488-23011510 GCCACTCCTTAGTCCCTGCACGG + Intronic
1038084006 8:24173655-24173677 GCCCCTCCTCACTCTCTGCGTGG - Intergenic
1042335416 8:67625073-67625095 GCTCCTCCCTAGTTTCTGCTTGG - Intronic
1046378495 8:113420451-113420473 GCCCCTCCTTAAATTTTGGAAGG + Intronic
1046821814 8:118642157-118642179 GTCCCTACTAGGTTTCTGCATGG + Intergenic
1049580026 8:143406966-143406988 GGCCCCTCTTAGTTTCTGCCCGG - Intergenic
1054870435 9:70043779-70043801 GCCCCTTCCAAGTGTCTGCAAGG + Exonic
1057727545 9:97578859-97578881 GCCCATCCTGAGTTTTAGCAGGG + Intronic
1058302779 9:103397661-103397683 GTCACACCTTAGTTTCTTCATGG + Intergenic
1059684752 9:116624351-116624373 TCCCTTTCTTAGTTTCTGGAAGG - Intronic
1060488304 9:124063399-124063421 GCCCCTCCTTAGGATCTGGCAGG + Intergenic
1060668703 9:125449635-125449657 GCCACTAATTAGTTTCTGCTTGG - Intronic
1061679424 9:132235709-132235731 GCCCCCCCATACCTTCTGCACGG - Intronic
1061765990 9:132881856-132881878 GCGCCTCCTTAAGTTTTGCATGG + Intronic
1203522273 Un_GL000213v1:55038-55060 GCCCCACCTTAGAGGCTGCATGG + Intergenic
1188703686 X:33299500-33299522 GGCCTTCCTTAGAATCTGCACGG - Intronic
1192095961 X:68211121-68211143 GCCCCTAGTTCCTTTCTGCAAGG + Intronic
1197994225 X:132354774-132354796 GCCTCTAGTTAGTATCTGCATGG + Intergenic
1198362943 X:135913792-135913814 CCCCCTCCTTTGATTCTGGATGG + Intergenic