ID: 1084951222

View in Genome Browser
Species Human (GRCh38)
Location 11:72666652-72666674
Sequence CAATGTGAGCACAGGGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 337}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084951222_1084951229 16 Left 1084951222 11:72666652-72666674 CCCTCATCCCTGTGCTCACATTG 0: 1
1: 0
2: 1
3: 25
4: 337
Right 1084951229 11:72666691-72666713 ATACACAGGGAACACACATACGG 0: 1
1: 0
2: 1
3: 23
4: 205
1084951222_1084951228 3 Left 1084951222 11:72666652-72666674 CCCTCATCCCTGTGCTCACATTG 0: 1
1: 0
2: 1
3: 25
4: 337
Right 1084951228 11:72666678-72666700 CACAGGCATCTGTATACACAGGG 0: 1
1: 0
2: 1
3: 13
4: 247
1084951222_1084951227 2 Left 1084951222 11:72666652-72666674 CCCTCATCCCTGTGCTCACATTG 0: 1
1: 0
2: 1
3: 25
4: 337
Right 1084951227 11:72666677-72666699 ACACAGGCATCTGTATACACAGG 0: 1
1: 0
2: 0
3: 14
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084951222 Original CRISPR CAATGTGAGCACAGGGATGA GGG (reversed) Intronic
900595613 1:3478906-3478928 CCATGTGAGCAGAGGGAGGTGGG + Intronic
901727240 1:11251352-11251374 CTATTTGAGCACAGCCATGAAGG - Intronic
903067349 1:20708002-20708024 TAATGTGAGCTCAGTGATGATGG - Intronic
903231451 1:21924794-21924816 CAATGTGAGTCCAGGGACAATGG + Intronic
903455932 1:23486794-23486816 AAATTTGATCACAGGGAAGAAGG - Intergenic
904962168 1:34342200-34342222 AAATGTGAGGATAGGGATGGGGG + Intergenic
906095030 1:43217104-43217126 GAGTGTGTGCAGAGGGATGAGGG + Intronic
906667409 1:47631649-47631671 CACTGGGAGCACAGGGACAATGG - Intergenic
907568970 1:55465650-55465672 CAATGTAAGCACAGAGCAGATGG - Intergenic
907620345 1:55971661-55971683 CAATCTGAGCACAGACTTGAAGG + Intergenic
907797172 1:57729324-57729346 CCCTGTGAGCTCAGGGATGTGGG - Intronic
908519809 1:64930945-64930967 CAATGAGAACACATGGATGCAGG + Intronic
909025587 1:70478054-70478076 CTTTGTAAGCACATGGATGAAGG - Intergenic
910991368 1:93059747-93059769 CAATGAGAACACATGGATGCAGG - Intergenic
911187132 1:94915515-94915537 CAATCTGAGAGCATGGATGAGGG + Intronic
912361160 1:109097038-109097060 CAATGGGATAACAGGAATGATGG - Intergenic
912720554 1:112016403-112016425 CAAAGTGAGCAGAGGGTTGGGGG - Intergenic
913064753 1:115240347-115240369 CACAGTGAGCACAGAGAGGAAGG - Intergenic
913074831 1:115333124-115333146 CTAAGTGAGCCCAGGGAGGATGG - Intronic
915155564 1:153873098-153873120 AAATGTTAACACAGGGAAGAAGG + Intronic
916039433 1:160949639-160949661 CTCTGTGAGCACAGGGTTGGGGG + Intronic
916983282 1:170163043-170163065 CAAGCTGACCACAGGGATGCTGG + Intronic
917043871 1:170834957-170834979 CAATGAGAGCACATGGATACAGG - Intergenic
917846249 1:179022979-179023001 CAATGTGATCACAACCATGAGGG + Intergenic
919786498 1:201261596-201261618 CACTGTGAGCAAGGGGGTGATGG + Intergenic
921535358 1:216342784-216342806 CAATGAGAACACATGGACGAAGG + Intronic
924641316 1:245836317-245836339 CGAGGGGAGCACAGGGATGCGGG - Intronic
1062979347 10:1708886-1708908 GTATGTGAGCAGAGGGCTGAGGG + Intronic
1063226216 10:4017316-4017338 CAAAGTGAGCCCAGGCATTATGG - Intergenic
1063352764 10:5372006-5372028 CAATGAGAGAACAGGCATGTCGG + Intronic
1064036114 10:11914675-11914697 CAATGTGAAGACGAGGATGAAGG + Intergenic
1064484589 10:15772603-15772625 CAATGAGAACACAGGGATACAGG - Intergenic
1064769184 10:18706332-18706354 AAATGTGATCACACCGATGAAGG - Intergenic
1065974381 10:30829532-30829554 CAATGTGTGCAAAGGGATAAGGG + Intronic
1069004298 10:63299770-63299792 GAATTTGAACACAAGGATGAGGG - Intronic
1070500155 10:77065192-77065214 CAAGGTGAGCACTGTGAAGATGG - Intronic
1070732707 10:78842336-78842358 ACATGAGACCACAGGGATGAGGG + Intergenic
1071917449 10:90310646-90310668 CAATGAGAGCACATGGAGGCAGG + Intergenic
1072417387 10:95260541-95260563 CACTGTGTGCACTGGGAGGAAGG + Intronic
1072705172 10:97675793-97675815 CAACCTGAGCACAGGCTTGAGGG - Exonic
1073824786 10:107308139-107308161 CAAGGTGAGAACATGGAGGATGG + Intergenic
1073862504 10:107763874-107763896 CAATGAGAACACATGGATGCAGG - Intergenic
1074734401 10:116413718-116413740 CTATGTGAGTACCAGGATGAAGG + Intergenic
1074763943 10:116686880-116686902 CAGTGTGGGAAGAGGGATGAGGG - Intronic
1076192674 10:128493897-128493919 CAGTGTGAGCACAGGCCTGAAGG + Intergenic
1076768852 10:132651976-132651998 CATCCTGAGCACAGGGGTGAGGG - Intronic
1078209425 11:9258320-9258342 CAATGAGAACACATGGATGTAGG - Intronic
1078543571 11:12230109-12230131 CAATGCCAGCACAGTGATCAGGG + Intronic
1078838559 11:15055938-15055960 CAATGTGAGTATATGGGTGAGGG + Intronic
1078942203 11:16020121-16020143 CAATGTGAACACAGGAAAGGAGG - Intronic
1079493502 11:21015393-21015415 CACTATGAGCACAGGGAAAAGGG - Intronic
1080774125 11:35370021-35370043 CAGTGTGGGCAAAGGCATGAAGG + Intronic
1083097446 11:60266298-60266320 AAATGTGAGCACATGCATGATGG + Intergenic
1083608628 11:63994199-63994221 CCATGTGACCACGGGCATGAGGG - Intronic
1083934283 11:65862276-65862298 CAGGGTGAGCACAGGGATCAGGG + Exonic
1084709210 11:70833605-70833627 CAAAGCAAGCACAGTGATGATGG + Intronic
1084951222 11:72666652-72666674 CAATGTGAGCACAGGGATGAGGG - Intronic
1085735415 11:79034729-79034751 CAAGGTGAGCACATGGCTGTGGG + Intronic
1085884956 11:80511029-80511051 CAATGAGAACACATGGATGCAGG + Intergenic
1086677188 11:89622605-89622627 AACGGTGAGCACAGAGATGATGG - Intergenic
1086838933 11:91660535-91660557 CAATGTAAGAATGGGGATGAGGG + Intergenic
1087293308 11:96341981-96342003 CAATGTGAGCTCAGTGTTCAGGG + Exonic
1088516324 11:110638797-110638819 CAATGAGAACACATGGATGCAGG + Intronic
1089814352 11:121159014-121159036 CACTGTGAGCACAGAGAGGCAGG + Intronic
1090836651 11:130458912-130458934 CAAGATGAGGGCAGGGATGAAGG - Intronic
1092567389 12:9682562-9682584 CAATGAGAACACATGGATGCAGG - Intronic
1093004981 12:14041714-14041736 CAATGAGAACACATGGATGCAGG + Intergenic
1094057325 12:26280553-26280575 TAATGTGTACACAGGGATGTAGG + Intronic
1095503912 12:42871730-42871752 CAATGTGAGAAACTGGATGAGGG - Intergenic
1097158037 12:57026906-57026928 CACAGTGAGGACAGGGGTGAGGG + Intronic
1097524005 12:60707428-60707450 CAATGAGAACACATGGATGCAGG - Intergenic
1098519929 12:71423621-71423643 CAGTGTGAGCAAGAGGATGATGG - Intronic
1099158702 12:79212308-79212330 CAATGAGAACACATGGATGCAGG + Intronic
1099327728 12:81241029-81241051 CAATGAGAACACATGGATGCAGG - Intronic
1099990706 12:89718002-89718024 CCATGTGAGGACAGGGCAGAAGG - Intergenic
1101997651 12:109536369-109536391 GACTGTCAGCACAGGGAAGATGG + Exonic
1102780700 12:115562167-115562189 CAATGTCAGCACAGGCAGGCAGG + Intergenic
1102817363 12:115878117-115878139 GAATGTGAGCTCCAGGATGAAGG - Intergenic
1103257953 12:119559056-119559078 CCATGTGAGCAAAGGCATGGAGG + Intergenic
1103943671 12:124514377-124514399 CAAGGTGGGGACAGGGGTGATGG + Intronic
1104471424 12:129032889-129032911 CCTTGTGAGCAGAGGGATGCAGG - Intergenic
1105432009 13:20345196-20345218 CAGTGTGACCCCTGGGATGAGGG + Intergenic
1106214266 13:27680443-27680465 AAATGAGACCAGAGGGATGAAGG + Intergenic
1106576285 13:30978874-30978896 CAAAGAGAGCAGAGAGATGATGG - Intergenic
1107135917 13:36944046-36944068 CAATGTGAAGACAAGAATGAAGG - Intergenic
1107669341 13:42727990-42728012 GAATGTGAGTATAGGTATGAAGG + Intergenic
1108302525 13:49092610-49092632 CAATGTGAACAAAGGTATGAAGG - Intronic
1109911190 13:68913019-68913041 CAATGAGAGCACATGGATACAGG + Intergenic
1110669600 13:78161764-78161786 CAAGGTGAGGACAGGCAAGATGG + Intergenic
1110843196 13:80166086-80166108 CAAAGTGAGCAGATGGCTGAAGG - Intergenic
1112773555 13:102819551-102819573 CAATGTGAACACATGGACGTAGG + Intronic
1116098419 14:40403103-40403125 CAGTGTCAGCACTGGGTTGAAGG - Intergenic
1116148152 14:41101369-41101391 CAATGAGAACACATGGATGCAGG - Intergenic
1116464061 14:45212071-45212093 CAATGTGAGCAAAGCCCTGAGGG - Intronic
1118307539 14:64667731-64667753 AAATGTGATCCCAGTGATGAAGG - Intergenic
1118945236 14:70379455-70379477 CAGTTTGAGCACAGGTATAAAGG - Intronic
1119424572 14:74527384-74527406 CAGCGTGAGCTCAGGGAGGAGGG + Intronic
1120032311 14:79656142-79656164 TAGTGTGAGCACAGGGCTTAAGG + Intronic
1120877020 14:89384293-89384315 CAAAGTGAGCACAGTGAAGCAGG - Intronic
1121346143 14:93137124-93137146 CAATGTGAGCCCAGGCACGGTGG + Intergenic
1122215613 14:100201951-100201973 CAATGTGAGCCCAGGGAAGTGGG + Intergenic
1122660683 14:103293009-103293031 CAGTCTGAGGACAGAGATGAGGG + Intergenic
1122687719 14:103518013-103518035 CGAGGTGAACACAGGGCTGAGGG - Intergenic
1123121818 14:105920276-105920298 CAAGGTGTGAACAGGGAGGATGG - Intronic
1123404513 15:20011927-20011949 CAAGGTGTGAACAGGGAGGATGG - Intergenic
1123513846 15:21018574-21018596 CAAGGTGTGAACAGGGAGGATGG - Intergenic
1123992891 15:25696489-25696511 CAGTGGGAGCAACGGGATGAAGG - Intronic
1124448125 15:29757937-29757959 AAATGTGAAAACAAGGATGAAGG + Intronic
1125409305 15:39388792-39388814 AAACGTGAGCACTGAGATGAAGG + Intergenic
1125483136 15:40094022-40094044 CACTCTGAGCACAGAGATAATGG - Intronic
1126957272 15:53947555-53947577 CAAGGTGATCAGAGGCATGATGG - Intergenic
1129320244 15:74770760-74770782 CAAAGTGAGGACAGGTAGGAAGG - Intergenic
1133623500 16:7548953-7548975 GAATGTGAGCTCTGGGATGGTGG - Intronic
1135187466 16:20327569-20327591 CAATTGGTGCACAGGTATGATGG + Intronic
1135325636 16:21523745-21523767 CAATGTGTGCAGAGGGAACACGG + Intergenic
1136035979 16:27540798-27540820 GAGTGTGTGCACAGGGATTAGGG + Intronic
1138135043 16:54514030-54514052 CAATGTCAGGGCAGGGATGCAGG + Intergenic
1138315464 16:56065923-56065945 CACAGGGAGCAGAGGGATGAAGG - Intergenic
1139257799 16:65559632-65559654 CGATGTGAGCCCAGGGAATAAGG - Intergenic
1140721690 16:77777840-77777862 AAATGTGAGCTCAGGGTTGCTGG - Intergenic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1141923288 16:87150710-87150732 CAATCTTACCACAGGGATGGGGG + Intronic
1141978663 16:87535559-87535581 CAATGTCATCACAGGGATCCTGG - Intergenic
1142337932 16:89502299-89502321 GAATGTGAGGCCAGGGAGGAGGG - Intronic
1142489081 17:266348-266370 TGAGGGGAGCACAGGGATGACGG - Intronic
1143407893 17:6690240-6690262 CTTGGTGAGCACAGGGATAAGGG - Intronic
1146608625 17:34285347-34285369 CCATGTGAACACAGGAATCAAGG + Intergenic
1147376770 17:40027205-40027227 CAATGTGAACATAGGGCTGAAGG + Intronic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1148521454 17:48279860-48279882 AACTGTGAGCACAGGAAAGAAGG - Intronic
1151175570 17:72285064-72285086 GAAGGTGACCACAGTGATGAGGG + Intergenic
1151447220 17:74175195-74175217 CAAGGTGGGCACAAGGATGTTGG - Intergenic
1152041419 17:77906272-77906294 CCATGCAAGCACAGGAATGACGG + Intergenic
1153466671 18:5395730-5395752 AGATGTGAGCACCTGGATGAGGG - Intronic
1154337291 18:13475901-13475923 GAATTTGAGCAAAGGGATGGAGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156806716 18:41191787-41191809 CAGTGTGAACACAGGCAAGATGG - Intergenic
1157854563 18:51093042-51093064 CAATGAGAACACATGGATGCAGG - Intergenic
1158898008 18:61933714-61933736 CAATGGGAGCACAGGGAATAGGG + Intergenic
1160207132 18:76843921-76843943 TAATATGAGCACAAGGAAGAAGG + Intronic
1160489731 18:79326579-79326601 CCATGTGAGCTCAGGGAGGGAGG - Intronic
1160878741 19:1310088-1310110 CAATGGGATCACAGGGAAGGCGG - Intergenic
1161510693 19:4669676-4669698 CAAGCTGAGTACAGGGCTGAGGG + Intronic
1161625608 19:5324834-5324856 CAGTGTGAGGATGGGGATGATGG - Intronic
1164208578 19:23077870-23077892 CTCTGTGAGCACAGGGTTGGGGG - Intronic
1164863227 19:31580459-31580481 CCAAGTGTTCACAGGGATGAGGG + Intergenic
1165259917 19:34604314-34604336 CATAGTGACCACAGGGATGTGGG - Intronic
1167141085 19:47651214-47651236 CCAGGTGAGCCCAGGGCTGAGGG - Intronic
1167260387 19:48454662-48454684 CAAGCTGAGGACAGGGATGCTGG - Exonic
1167993449 19:53380952-53380974 CAATATGATCACAGGCATGCTGG + Exonic
925741138 2:7006954-7006976 GAAAGTGAGCCAAGGGATGAAGG + Intronic
926747013 2:16167095-16167117 CCAGGTTAGCACAGGGATGAGGG + Intergenic
927019938 2:19006094-19006116 TCATGTGATCACAGAGATGATGG + Intergenic
927889852 2:26741503-26741525 GAGTGTGAGCACAGGGCTGATGG + Intergenic
931188468 2:59976550-59976572 TAAAGTGAGCTCAGGGAAGAAGG - Intergenic
931875999 2:66513390-66513412 GAATGTGGGCCCAGGTATGAAGG - Intronic
938558325 2:132446820-132446842 GATTGTGGGGACAGGGATGAAGG + Intronic
938932690 2:136100584-136100606 CACGCTGAACACAGGGATGAAGG + Intergenic
942027986 2:171929647-171929669 CAATATGAGGAAAGGGATTAAGG + Intronic
942541604 2:177020936-177020958 CAGTGTGAGCATGGGGGTGAGGG - Intergenic
943761252 2:191611888-191611910 AAGTGTGTGCACAGGGATGGCGG + Intergenic
944674302 2:202022342-202022364 CAATGAGAGCACATGGAGGCAGG + Intergenic
945144180 2:206719324-206719346 CAATGAGAACACATGGATGCAGG + Intergenic
946089403 2:217207598-217207620 CAAAATGAGCACGAGGATGACGG - Intergenic
946237845 2:218335706-218335728 CAATCTGGGCACATGGTTGAAGG - Intronic
946670022 2:222092553-222092575 TCATGTGCGCACAGGAATGACGG - Intergenic
946965362 2:225031441-225031463 CAATGTGGGCACAGGGCCGAAGG + Intronic
947112751 2:226737136-226737158 CAATGAGATCACATGGATGCAGG - Intronic
947682768 2:232050872-232050894 AGATCTGAGCACAGAGATGAAGG + Intronic
949064019 2:241978757-241978779 CAATGTGAGCACAAGTCAGAAGG - Intergenic
1168918041 20:1507498-1507520 CCATGTGAGGACAGGGAGCAAGG + Intergenic
1168932970 20:1638814-1638836 CAATGTGAACACATGGACGCAGG - Intronic
1170071446 20:12373582-12373604 AAATTTGAGCACAGGCTTGAAGG - Intergenic
1170309463 20:14976410-14976432 CAATGTGATGACAAGGATGGGGG - Intronic
1171373151 20:24674561-24674583 CAATGTGAGAATGGGCATGATGG - Intergenic
1173148565 20:40546422-40546444 CTCTGTGAGTACAAGGATGAGGG + Intergenic
1173361569 20:42349336-42349358 CAGTGTGAGCACAGGCATGGAGG - Intronic
1175173768 20:57097422-57097444 CCATGTGACCAGAGGGAGGACGG - Intergenic
1177667099 21:24174565-24174587 TAATGTAATCACAGGGAAGAGGG - Intergenic
1177748934 21:25256122-25256144 TAATGTGAGCTTAGGGAAGAGGG + Intergenic
1177991997 21:28047953-28047975 CATTGTGAGCTCAAGGAAGAAGG - Intergenic
1179178999 21:39029440-39029462 CACTGAGAGCCCAGGGCTGATGG - Intergenic
1179312992 21:40213358-40213380 CTATGTGTGCACAGGGAGGCAGG - Intronic
1180150894 21:45947187-45947209 CCATCTGAGCACAGGCATGGTGG - Intergenic
1181415004 22:22753073-22753095 CAAGGTGAGCACTGGGAGGACGG + Intronic
1182716467 22:32359731-32359753 CAATGTGATGACAGAGATGCTGG - Intronic
1183951605 22:41355859-41355881 CGATGTGAGCGCTGGGATGGGGG + Exonic
1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG + Intronic
1184690483 22:46115135-46115157 GGAGGTGAGCACAGGCATGAGGG - Intergenic
1185250630 22:49799850-49799872 CATGGTGAGGACAGGGCTGAGGG - Intronic
1185342580 22:50298258-50298280 CAAGGGCAGCACAGGGATGCTGG + Intronic
949161209 3:884446-884468 CAATGAGAGCACATGGATATAGG - Intergenic
949262246 3:2116320-2116342 CAAGCTGAGGACAGGAATGATGG - Intronic
949432159 3:3989399-3989421 CAATGTGAGCACAGTGCTATGGG + Intronic
951707640 3:25559151-25559173 CAATGTGCGCAAAGGCCTGAGGG - Intronic
951843620 3:27061892-27061914 AAAGGTGAGGCCAGGGATGAGGG - Intergenic
952294883 3:32052750-32052772 CAATGAGATCACATGGATGCAGG + Intronic
953525273 3:43684878-43684900 CAATGAGAACACATGGATGCAGG + Intronic
954301228 3:49701813-49701835 CAAAGAGAGCACGGAGATGAAGG + Exonic
957417767 3:79929004-79929026 CCCTGAGAGCACAGGGATGCTGG - Intergenic
958823779 3:99005952-99005974 CAATGAGAACACATGGATGCAGG - Intergenic
959334689 3:105049261-105049283 AAAAGGGAGCTCAGGGATGAAGG - Intergenic
960373626 3:116871287-116871309 CAATGAGAGCACATGGATCCAGG - Intronic
960450352 3:117799243-117799265 AAATGGGGACACAGGGATGAGGG - Intergenic
961606247 3:128097523-128097545 CAAGGTCAGCACAGGGCTGGGGG + Intronic
962013596 3:131418521-131418543 CAAGGTGAGCACAGGATTGCTGG - Intergenic
962376545 3:134863101-134863123 CAGTGTGTGCACAGGCATGGGGG - Intronic
962911628 3:139856246-139856268 CAATCTATGCACAGGGAGGATGG + Intergenic
962940538 3:140121068-140121090 GAATGTGTGGACAGGGGTGAGGG + Intronic
964858755 3:161176625-161176647 CACTGTGAGAACAGTGATGGTGG + Intronic
965162538 3:165152633-165152655 CAATGAGAACACATGGATGCAGG - Intergenic
965295118 3:166935420-166935442 CAATGAGAACACATGGATGCAGG - Intergenic
965425881 3:168522213-168522235 CAATATCAGCCAAGGGATGAAGG - Intergenic
965435099 3:168640566-168640588 CAATGAGAACACATGGATGCAGG + Intergenic
967582834 3:191179721-191179743 CAATGTGAGTACAGGCATTGGGG - Intergenic
967857114 3:194126499-194126521 CAATGAGAACACATGGATGCAGG - Intergenic
968581450 4:1397193-1397215 GGAGGTGAGCACAGGGAGGAAGG - Intergenic
969462554 4:7336413-7336435 CAATGCGAACAGATGGATGAAGG + Intronic
969910532 4:10441089-10441111 AAATGAAAGCACAGGAATGATGG - Exonic
970364866 4:15348436-15348458 GAATGTTAGCAAAGGCATGAAGG - Intronic
970606253 4:17684989-17685011 CAATGAGAACACATGGATGCAGG + Intronic
971295565 4:25386665-25386687 CAACGTGAGCACATGGCTGCTGG + Intronic
972888808 4:43528095-43528117 CAATGAGAACACATGGATGCAGG + Intergenic
974842801 4:67317600-67317622 CAATGAGAACACATGGATGCGGG - Intergenic
975131820 4:70839313-70839335 CAATAGGAGCACAGGGTGGACGG + Intronic
975503790 4:75116553-75116575 CAATGTGAGCACTTGGAAAAGGG + Intergenic
975792902 4:77973963-77973985 CAATGAGAGCACATGGACGCAGG + Intergenic
976517609 4:85986931-85986953 CAGTGGGAGCTCAGGGAGGAAGG + Intronic
976820990 4:89206882-89206904 CAAAGTGAGTGCAGGGATGAGGG - Intergenic
978186854 4:105866036-105866058 CAATGAGAACACATGGATGCGGG + Intronic
978642955 4:110893056-110893078 CAATGAGAGCACATGGATACAGG + Intergenic
979876513 4:125898430-125898452 CAATGAGAGCACATGGACGCAGG + Intergenic
980023816 4:127740630-127740652 CAATGTCTGCACAGGAAGGATGG + Intronic
980530057 4:134041524-134041546 CAATGAGAACACATGGATGTGGG + Intergenic
981141056 4:141269766-141269788 CAATGAGAGCACATGGACGCAGG - Intergenic
981263199 4:142747817-142747839 CAATAAGAACACAGGGATGCAGG + Intronic
982197867 4:152934743-152934765 CAAGGAGATCAAAGGGATGAGGG + Intergenic
983123722 4:163922162-163922184 CAATGGGAACACATGGATGCGGG + Intronic
983429709 4:167633079-167633101 CAATGAGAACACAGGGATGCAGG + Intergenic
983509085 4:168588193-168588215 CACTGTGAGCCCTGGGAGGATGG + Intronic
985781100 5:1872299-1872321 TAACTGGAGCACAGGGATGAGGG - Intergenic
986313729 5:6572597-6572619 CTGTGTGAGCCCCGGGATGAAGG + Intergenic
987112180 5:14698745-14698767 CATTGTGAGCAGAGGAATCAAGG + Exonic
988737587 5:34038267-34038289 TAAGGTGAGCACAGGGAGGATGG + Intronic
988792346 5:34620207-34620229 GAAGGTGAGCACAGAGAAGAGGG + Intergenic
989306215 5:39959763-39959785 CAATGATAGCAGAAGGATGAAGG - Intergenic
991546393 5:67786356-67786378 CAATGAGAACACATGGATAAAGG + Intergenic
992738389 5:79746835-79746857 CAGTGTCAGGACAGGGATGGAGG - Intronic
993615493 5:90106100-90106122 CAATGAGAACACATGGATGCAGG + Intergenic
993826774 5:92697892-92697914 CAATGTGAGCTGAGGGAAGGAGG + Intergenic
993898975 5:93571620-93571642 TTATGTGAGCTCAGGGAGGAAGG + Intergenic
994308268 5:98234888-98234910 CAATGAGAACACATGGATGCAGG - Intergenic
995105141 5:108369080-108369102 TTAGGTGAGCAGAGGGATGATGG - Intronic
995676571 5:114669228-114669250 CAATATTAGCACAGGGCTGCTGG - Intergenic
997358483 5:133279579-133279601 GAATGTGAGCACGGGGAGGGTGG + Intronic
997392877 5:133531339-133531361 CAAGGTGACCACAGAGATTAGGG - Intronic
999380146 5:151115730-151115752 CATTGTGGGCACATGGATGGGGG - Intronic
1000465348 5:161568941-161568963 TAATGGGATCCCAGGGATGAGGG - Intronic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1001855982 5:175011270-175011292 CAGAGTGTGCACAGGGATGTTGG + Intergenic
1002963117 6:1936257-1936279 CAATGTGAGCAGTGGCAAGAGGG + Intronic
1003178145 6:3769123-3769145 CAATGAGAACACATGGATGCAGG - Intergenic
1003532223 6:6947162-6947184 CATTGTGAAGACAAGGATGAAGG + Intergenic
1003691279 6:8356250-8356272 CAATGAGAACACATGGATGCAGG + Intergenic
1003755452 6:9114338-9114360 CAATGAGAACACATGGATGCAGG - Intergenic
1006463902 6:34179516-34179538 CCCTGAGAGCACAGGGATGCTGG + Intergenic
1006902241 6:37510727-37510749 CATGGTGTGCACAGGGAGGAGGG + Intergenic
1008089734 6:47281749-47281771 AAATGTGGGCACAGGTATGTAGG + Intronic
1008873581 6:56301922-56301944 CAATGAGAACACATGGATGCAGG - Intronic
1009802206 6:68552937-68552959 CAATGAGAGCACATGGATGCAGG + Intergenic
1010033157 6:71290004-71290026 CAATGTGACCACAGGGTTTTGGG + Intronic
1011331326 6:86210375-86210397 CAATGAGAACACATGGATGCAGG + Intergenic
1011463260 6:87628169-87628191 CAATGAGAGCACAGGTCGGAGGG + Intronic
1013666387 6:112353443-112353465 CAATTGGGCCACAGGGATGAGGG + Intergenic
1013731684 6:113175653-113175675 CAATGTGAGGTCAGAGAGGATGG + Intergenic
1013871435 6:114766536-114766558 TCAGGTGAGCAGAGGGATGATGG + Intergenic
1014142828 6:117964018-117964040 CAATGAGAACACATGGATGCAGG - Intronic
1014176448 6:118336439-118336461 CAATGAGAACACATGGATGCAGG - Intergenic
1014636055 6:123848231-123848253 CAATGAGAGACCAAGGATGAAGG + Intronic
1015763073 6:136685882-136685904 CAAGGTGCTCACAGGGAGGAGGG - Intronic
1015983314 6:138860922-138860944 CAATGAGAACACATGGATGCAGG - Intronic
1016398879 6:143657030-143657052 CAATGAGAACACATGGATGCAGG + Intronic
1018223757 6:161607861-161607883 CACAGTGAGCAAATGGATGATGG + Intronic
1019200864 6:170313922-170313944 CACTCTGGACACAGGGATGAGGG - Intronic
1020691389 7:11358986-11359008 CAATGAGAGCACATGGATACAGG + Intergenic
1021267031 7:18537562-18537584 CAATGCCAGGACAGGGATAAAGG + Intronic
1021495885 7:21274263-21274285 CTTTGTGAGCACAGGGACCACGG - Intergenic
1022601373 7:31763239-31763261 CAATCTTAGCACATGGCTGAGGG - Intronic
1022744267 7:33154019-33154041 CAATGTGAGCACATAGATGAGGG - Intronic
1023838794 7:44084003-44084025 CACTCAGAGCACAGGGCTGAGGG + Intergenic
1028008531 7:85610834-85610856 CAATGTGAACACATGGATTAAGG + Intergenic
1028448805 7:90956808-90956830 CAATGAGAACACATGGATGCAGG - Intronic
1028887059 7:95946099-95946121 CAATGAGAACACATGGATGCAGG + Intronic
1028940415 7:96515823-96515845 CAATGAGAACACAGGGACGCAGG + Intronic
1028967748 7:96821475-96821497 CAATGAGAACACATGGATGCAGG + Intergenic
1029043382 7:97600911-97600933 CAAGGTGAGCAAGGGGAAGAAGG + Intergenic
1029129320 7:98318109-98318131 CAATGTGAACTGAGGGGTGAGGG - Intronic
1029619763 7:101682838-101682860 ATGTGTGAGCATAGGGATGATGG - Intergenic
1030667351 7:112294069-112294091 CAAAGTGGTGACAGGGATGAAGG - Intronic
1031548237 7:123076798-123076820 CCATGTGATAACAGGGAAGACGG + Intergenic
1032471457 7:132182078-132182100 CAATGTGAGTGTAGGGCTGATGG - Exonic
1032670157 7:134074954-134074976 CAATGTGAGGGCTGAGATGAAGG + Intergenic
1033217741 7:139505843-139505865 CACTGTGAGCACACAGCTGATGG - Intergenic
1034290065 7:149923708-149923730 AAATGTGAGCCCAGGCATGGTGG + Intergenic
1035332982 7:158108266-158108288 CAATGGGAGCACAGAGATCCAGG - Intronic
1035666246 8:1382280-1382302 CAACGTGAAGACGGGGATGAAGG - Intergenic
1037821593 8:22137726-22137748 CAGTGGGAGCACAGGCAGGAGGG - Intergenic
1038459765 8:27705914-27705936 CAATGTGTGCACAGAGCTGGTGG + Intergenic
1038459768 8:27705972-27705994 CAATGTGTGCACAGAGCTGGTGG + Intergenic
1040300836 8:46187216-46187238 CAGTGAGACCACAGGGATGCTGG - Intergenic
1041525574 8:58801627-58801649 AAATGTCAGCTCAGGGCTGATGG - Intergenic
1041958397 8:63582837-63582859 TAATGGGAGGAAAGGGATGATGG + Intergenic
1045844427 8:106616991-106617013 AAATGTGATGACAGGGAAGAAGG + Intronic
1046397970 8:113665231-113665253 CAATGAGAGCACATGGATACAGG - Intergenic
1049481894 8:142828973-142828995 CTCTGTGAGCACAGGGTTGGGGG - Intergenic
1049521248 8:143092520-143092542 GAATGTGTGCTCAGGGTTGAGGG + Intergenic
1050450431 9:5774879-5774901 CAATGTGGGCAGAGGTCTGAGGG + Exonic
1050463391 9:5895949-5895971 AAATGAGAGCACAGGCATGTTGG + Intronic
1050901321 9:10952441-10952463 CAATGAGAACACATGGATGCAGG + Intergenic
1051058718 9:13020589-13020611 GAAAATGAGGACAGGGATGAGGG - Intergenic
1051116457 9:13699612-13699634 CAATGAGAACACATGGATGCAGG - Intergenic
1051776794 9:20643235-20643257 CATTTTGACCACATGGATGAGGG + Intergenic
1052243814 9:26308950-26308972 CAATGTGAGCTCAGGGCTTAGGG - Intergenic
1052982546 9:34459384-34459406 GAATGTGAGAACAAGGAGGAAGG - Intronic
1053218476 9:36292429-36292451 CAATGTTAGGAGAAGGATGAAGG - Intronic
1053416317 9:37949016-37949038 CAGTGTGAGGACAGGCATCATGG + Intronic
1055287550 9:74745575-74745597 AAATTTGAGCACAGAGTTGAAGG + Intronic
1055442934 9:76354272-76354294 CAATGGGAGCAGAGGGAGGGGGG + Intronic
1055656267 9:78453039-78453061 CACTGTGAGGAAAGGGATGGGGG - Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1058566558 9:106291664-106291686 CAATGTGGCCACAGGGTTGATGG + Intergenic
1058711921 9:107686561-107686583 TAATGTGAGCAAATTGATGATGG - Intergenic
1058928801 9:109697930-109697952 CTATGTGGCCACAGGTATGAAGG - Intronic
1059894881 9:118851784-118851806 CAATGTGAACACAATGATGAAGG + Intergenic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1061269277 9:129527843-129527865 CATTGTGAGCTCACTGATGAAGG + Intergenic
1061746096 9:132741261-132741283 CCAAGTGTGCACAGGCATGAAGG - Intronic
1061806792 9:133141365-133141387 CGAGGTGAGAACATGGATGAGGG - Intronic
1062513586 9:136921272-136921294 CTATGTGGTCACAGGGGTGAGGG - Intronic
1062728672 9:138096211-138096233 CAATGTGATCACAGAGAGGAAGG + Intronic
1186448860 X:9655367-9655389 AAATCTGAACACAGAGATGAGGG - Intronic
1187022454 X:15398383-15398405 CAATAAGAGAACAGGGGTGATGG + Intronic
1187121165 X:16407687-16407709 CAATGTGGGCACAGTGAGGAAGG + Intergenic
1187137305 X:16560633-16560655 AAATGTGTGCACAGGAATAAAGG - Intergenic
1187148279 X:16657405-16657427 TGATGTAAGCACAGGGATGGTGG + Intronic
1189158980 X:38791134-38791156 GAATGTGAGCAGAGAGAAGATGG - Intergenic
1190245757 X:48689063-48689085 CAAGGTGAGGACAGGCAGGATGG + Exonic
1191189984 X:57656261-57656283 CAATCTGTGCACTGGGAGGATGG + Intergenic
1191198413 X:57750051-57750073 CAATGAGAGCACAGGGACACAGG + Intergenic
1193036562 X:76957756-76957778 CAATGTGAACCCATGTATGAAGG - Intergenic
1193494722 X:82197142-82197164 CAATGGCAGCACAGTGCTGAGGG + Intergenic
1194164397 X:90497011-90497033 CAATGAGAACACATGGATGCAGG - Intergenic
1194369583 X:93055825-93055847 CAATGTAACCACAGGGTTGGGGG - Intergenic
1195494362 X:105512962-105512984 CAATGAGAACACATGGATGCAGG - Intronic
1196753615 X:119139061-119139083 AACTGTGAGCACAGGGTTTAAGG + Intronic
1196950069 X:120868232-120868254 CACTGTGAGAAAAGGGAGGAAGG - Intergenic
1197649781 X:129051967-129051989 CAATTTGAGGAAAGGGGTGATGG + Intergenic
1198123188 X:133615551-133615573 CAATGAGAGCACATGGACGCAGG + Intronic
1198319822 X:135509675-135509697 CTATGTAAGCACAGAGATAAGGG + Intergenic
1199925940 X:152464218-152464240 CAATGAGAACACATGGATGCAGG + Intergenic
1200677775 Y:6172037-6172059 CAATGTAACCACAGGGTTGGGGG - Intergenic
1201852849 Y:18506773-18506795 CAATGTCTGCACAGTGATGTAGG + Intergenic
1201880472 Y:18813611-18813633 CAATGTCTGCACAGTGATGTAGG - Intronic
1202044631 Y:20726156-20726178 CAATGAGAGCACATGGATACAGG + Intergenic