ID: 1084951457

View in Genome Browser
Species Human (GRCh38)
Location 11:72668492-72668514
Sequence CCCTGGCTTGCTATGTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084951457_1084951466 -5 Left 1084951457 11:72668492-72668514 CCCCAACACATAGCAAGCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 182
Right 1084951466 11:72668510-72668532 CAGGGGGTCCCTGAGGGAAGAGG 0: 1
1: 0
2: 8
3: 62
4: 486
1084951457_1084951469 16 Left 1084951457 11:72668492-72668514 CCCCAACACATAGCAAGCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 182
Right 1084951469 11:72668531-72668553 GGTCGATGCTGCTTCACCTTTGG 0: 1
1: 0
2: 0
3: 6
4: 68
1084951457_1084951470 17 Left 1084951457 11:72668492-72668514 CCCCAACACATAGCAAGCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 182
Right 1084951470 11:72668532-72668554 GTCGATGCTGCTTCACCTTTGGG 0: 1
1: 0
2: 0
3: 9
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084951457 Original CRISPR CCCTGGCTTGCTATGTGTTG GGG (reversed) Intronic
901158054 1:7153953-7153975 TCCTGGCTTCCTCTGTGATGTGG + Intronic
901674589 1:10875485-10875507 CCTGGGCTTGCTATGTGCTGGGG + Intergenic
901854655 1:12037001-12037023 CCCTGCCTTGTTAGGTGTGGTGG - Intergenic
901906223 1:12413986-12414008 CCCTGCCTAGCTATGTCTTTTGG - Intronic
902706029 1:18205211-18205233 CCATGGCTTTCTCTGTGTAGTGG + Intronic
905263921 1:36738329-36738351 TCCTTGCTTGCTCTGTGATGTGG - Intergenic
905922547 1:41729070-41729092 TCCTGGATGGCTGTGTGTTGGGG - Intronic
906259732 1:44377932-44377954 CCTTGGCTTGGGGTGTGTTGAGG + Intergenic
907399076 1:54213326-54213348 CCCTGGTTTGGGGTGTGTTGGGG + Intronic
907941035 1:59087575-59087597 CCCAGAATTCCTATGTGTTGTGG - Intergenic
909204538 1:72738498-72738520 CCCAGGATTCCCATGTGTTGTGG - Intergenic
909301918 1:74023412-74023434 CCCTTGCTTGTAAAGTGTTGAGG + Intergenic
911045814 1:93626596-93626618 CTCTGCCTTGCTTTGTGCTGAGG - Intronic
912302440 1:108532039-108532061 TCCTGCCTTGCTAGGGGTTGTGG - Intergenic
912503214 1:110136273-110136295 CCCTTCCTTGCTGGGTGTTGGGG - Intergenic
913054144 1:115141926-115141948 CCCAGGCATACTATGTGCTGGGG - Intergenic
914868812 1:151456942-151456964 CCCTGACTTGCTTTGTGCTAAGG + Intronic
915567036 1:156720749-156720771 CCCTGGCTTTGTATGTGTCTTGG - Intergenic
918186026 1:182128579-182128601 CCCTGGGTGGCTATGGGCTGAGG + Intergenic
918827991 1:189352139-189352161 CTCTGGCATGCTATGATTTGGGG - Intergenic
920734594 1:208520116-208520138 TCCTAGATTGCTATGTCTTGTGG + Intergenic
922098785 1:222465257-222465279 CCCTTGCCTGCTTTTTGTTGGGG - Intergenic
924443991 1:244111487-244111509 CACAGGCATCCTATGTGTTGGGG - Intergenic
1063437987 10:6049993-6050015 CCAAGGCGTGCTATGTGCTGAGG + Intronic
1064000839 10:11662619-11662641 CCCCGGCCAGCTGTGTGTTGGGG - Intergenic
1065174139 10:23060755-23060777 CCCTGGCTTCCAAAGTTTTGGGG + Intergenic
1068439278 10:57031218-57031240 CCCAGAATTCCTATGTGTTGTGG + Intergenic
1073559765 10:104486851-104486873 CCTGGGCTTGCTGTGGGTTGGGG + Intergenic
1075002615 10:118809456-118809478 CTCTGGCTTGTTTTGTGCTGTGG + Intergenic
1075599697 10:123758371-123758393 CCCTGGCATTCTTTGTCTTGAGG + Intronic
1075920356 10:126206834-126206856 CCCTGAATTCCCATGTGTTGTGG + Intronic
1076734226 10:132451617-132451639 CCCTGGAATGCTGTGTTTTGGGG - Intergenic
1076781435 10:132726936-132726958 TCATGCCTTGCTCTGTGTTGAGG + Intronic
1077251827 11:1564187-1564209 CCATGGCTTGCTGTGTGGTGTGG - Intronic
1079093138 11:17494548-17494570 CCCTGGCCTCCTGTGTGCTGTGG - Intronic
1084942116 11:72618438-72618460 CCCTTGCTTGCTCTGTGAGGGGG - Intronic
1084951457 11:72668492-72668514 CCCTGGCTTGCTATGTGTTGGGG - Intronic
1085217475 11:74845008-74845030 CCCTGACTTGCTCTGAGCTGTGG + Intronic
1088510873 11:110573551-110573573 CCCTGGCTGGGTATTTTTTGTGG + Intergenic
1090928502 11:131274154-131274176 CCCTGGCTTGATTTGTGCTATGG + Intergenic
1093215919 12:16361165-16361187 ACATGGCTGGCTATGTGCTGAGG + Intronic
1094799130 12:34009804-34009826 CCCAGGCTTGCGATGTTTGGAGG - Intergenic
1095111880 12:38303923-38303945 CCCAGGCTGGCGATGTGTGGAGG - Intergenic
1095319792 12:40813348-40813370 CCCTGGCCTGTTGTGGGTTGGGG - Intronic
1096880194 12:54661306-54661328 CCCAGGCTTGCTACATGCTGAGG + Intergenic
1097170504 12:57110261-57110283 CCCAGCCTTGTTATGGGTTGGGG - Intronic
1100500683 12:95171340-95171362 CCATGGCTTGCTATGCTATGTGG + Intronic
1101726424 12:107392184-107392206 CCCTGCCTTCCTGGGTGTTGTGG + Intronic
1102581372 12:113890341-113890363 CCCTGCCTTGCTCTCTGGTGGGG + Intronic
1102789667 12:115634358-115634380 ACCTTGCTTGCTAAGTGTTCTGG - Intergenic
1106721171 13:32436034-32436056 CCTTGGGTTGGTATGTGATGAGG - Intronic
1110617106 13:77553596-77553618 CCCTGGCTGGCTGTGTTTGGAGG - Intronic
1114369532 14:22070730-22070752 CCCAGGTTTGCTGTGAGTTGGGG + Intergenic
1115130521 14:30047914-30047936 CCCAGAATTGCTACGTGTTGTGG - Intronic
1117641165 14:57800470-57800492 CCCTTGCTGGTTAGGTGTTGTGG - Intronic
1117718012 14:58600417-58600439 GCCTGCCAGGCTATGTGTTGTGG - Intergenic
1128160023 15:65417424-65417446 CCATGGTTTGCTGTGTGTGGAGG - Intronic
1129417153 15:75391448-75391470 CCCTAGCTTTCTATCTGTTGAGG - Intronic
1133952955 16:10413219-10413241 CCCAGAATTTCTATGTGTTGTGG + Intronic
1134768411 16:16782756-16782778 CCCAGAATTCCTATGTGTTGTGG + Intergenic
1137628967 16:49928595-49928617 CGTTGGCTTTCCATGTGTTGTGG - Intergenic
1140265076 16:73413449-73413471 CGCAGGCCTGCTATGTCTTGGGG - Intergenic
1140753047 16:78043600-78043622 CCCTGGCTTGCTGGGTGATTTGG - Intronic
1140813250 16:78598595-78598617 TCCTGGCTTGGTGTGTTTTGTGG + Intronic
1141344083 16:83229342-83229364 TTCTGGTTTGCTATGTGTAGAGG - Intronic
1142236830 16:88926371-88926393 ACCTGGCGTGCTATGGGCTGGGG + Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1143646217 17:8231987-8232009 CCCTCAGTTTCTATGTGTTGGGG - Exonic
1144784889 17:17826043-17826065 CCCTCCCTTGCTGTGTGATGGGG + Intronic
1145358262 17:22183301-22183323 TCCTGAATTGCCATGTGTTGTGG + Intergenic
1149646084 17:58242642-58242664 TCCTGGCTTGCTATGGGAGGAGG - Intronic
1153562444 18:6384752-6384774 CCCTGGCTTGCTGTCTGTCACGG + Intronic
1154020425 18:10659992-10660014 CCAGGGCTTGCTATTTGTTCAGG - Intergenic
1158833390 18:61304243-61304265 CCCAGAATTCCTATGTGTTGTGG + Intergenic
1159865033 18:73693331-73693353 CCCAGGCTTGCTCAGTGTTGGGG + Intergenic
1162504649 19:11076046-11076068 CCCTGGATTCCTATGGGTTCTGG + Intergenic
1163272575 19:16262994-16263016 GCCTGGCTTTCTATGTGCTGTGG - Intergenic
1166072648 19:40395889-40395911 GCCTGGCTTGCCACGTGATGGGG + Exonic
1168337744 19:55605819-55605841 CACTGACTTGCTAGGGGTTGGGG - Intronic
1168601247 19:57720420-57720442 CCCTGACTTACTATATGGTGGGG - Exonic
926055760 2:9773052-9773074 CCCTGACTGGCTGTGTTTTGGGG - Intergenic
926340802 2:11902920-11902942 CCCTGGGGTGCTCTGTCTTGGGG + Intergenic
927867023 2:26595750-26595772 CCCTGGCTGGCTATGCGCTTGGG - Intronic
927957956 2:27221334-27221356 CCCTGGCTTGCAAGGTATGGTGG + Exonic
928853964 2:35782122-35782144 CCCAGGATTCCCATGTGTTGTGG + Intergenic
929134472 2:38609781-38609803 CCCAGAATTCCTATGTGTTGTGG - Intergenic
934813547 2:97304958-97304980 CCCTGGCTTGTGCTGTGATGTGG - Intergenic
934824149 2:97403522-97403544 CCCTGGCTTGTGCTGTGATGTGG + Intergenic
937449610 2:121991327-121991349 CCATGGGTTGCTAAGTGCTGAGG + Intergenic
938295587 2:130176939-130176961 CCTTGGCCTCCTAAGTGTTGGGG + Intronic
938461037 2:131496885-131496907 CCTTGGCCTCCTAAGTGTTGGGG - Intergenic
938564599 2:132507358-132507380 CCCTGTCCTGCTACGTGGTGGGG + Intronic
938942719 2:136182895-136182917 CTCTGGCTGGCTGTGTGGTGTGG + Intergenic
939195182 2:138962970-138962992 CCCCGTCTTTCTCTGTGTTGTGG + Intergenic
939287580 2:140153484-140153506 CCCAGGATTCCCATGTGTTGTGG - Intergenic
944038768 2:195330809-195330831 CCCTGGCTTCCTCTGTGTAAGGG - Intergenic
944043899 2:195387362-195387384 CCCAGAATTCCTATGTGTTGTGG + Intergenic
944050272 2:195459977-195459999 CCCTGTTTTGCTACGTATTGAGG - Intergenic
944599542 2:201289597-201289619 CCCTGGATGGCTCTGGGTTGGGG - Intronic
944827864 2:203503531-203503553 CCCAGAATTCCTATGTGTTGTGG - Intronic
948636000 2:239338013-239338035 CCCTGGCTTTCGGTGTGCTGGGG - Intronic
1169985094 20:11435331-11435353 CCCCTGCTTCCCATGTGTTGTGG - Intergenic
1171089433 20:22269971-22269993 CGCTGGCTTGCTGAGTCTTGTGG - Intergenic
1172026691 20:31953522-31953544 TCCTGGCTTGCTGTGTGATGAGG - Intergenic
1175138912 20:56845130-56845152 TCCTGGTTTGCCAGGTGTTGAGG + Intergenic
1175237259 20:57523836-57523858 CCCTGGGTTGCTGTGGCTTGAGG - Exonic
1176295688 21:5070929-5070951 ACCTGGCTTGCTGTGTGCTCTGG - Intergenic
1176703814 21:10093622-10093644 CCCTGGCTTGGCATATGTTTGGG + Intergenic
1177059548 21:16353766-16353788 CCCAGAATTGCTATGTGTTGTGG + Intergenic
1179820582 21:43934721-43934743 GCGTGGCTTGCTTTGTGCTGTGG - Intronic
1179861359 21:44191195-44191217 ACCTGGCTTGCTGTGTGCTCTGG + Intergenic
1181030225 22:20145945-20145967 CCCTGGCCTGCTCTGGGTGGTGG + Intronic
1182330488 22:29548133-29548155 CCCAGAATTGCCATGTGTTGTGG - Intronic
1182762668 22:32735137-32735159 CCCTGGCTCTGTGTGTGTTGAGG + Intronic
1183545677 22:38453958-38453980 CCCTGGCTTGGCCTGTGCTGAGG - Intronic
949776016 3:7633363-7633385 CACTTGCTAGCTATGTGTTTTGG - Intronic
950587530 3:13905158-13905180 CCCTTGCTGGATAGGTGTTGTGG - Intergenic
952006774 3:28850268-28850290 CCCTGAATTGCTATGTAGTGAGG + Intergenic
958162521 3:89835108-89835130 TCCTGGTTTAGTATGTGTTGAGG - Intergenic
963379176 3:144506713-144506735 CCCAGGCTTCCCATGTGTTGTGG - Intergenic
964249461 3:154694826-154694848 CCTTGCCTTGCTTTGTGTTGAGG + Intergenic
966237442 3:177717874-177717896 CACTGGCTTCATATGTTTTGAGG - Intergenic
966589981 3:181671600-181671622 CACTGTCTTGATATGTGCTGAGG - Intergenic
966817584 3:183901733-183901755 CCCAGGCTTGCTGTGTGCTGAGG - Intergenic
967574921 3:191077980-191078002 CCCTTGCTTGAGAGGTGTTGTGG - Intergenic
968482290 4:839464-839486 GCCTGGCCTGCTATGAGTTTTGG + Intergenic
969204985 4:5637035-5637057 CGCTGGCTTGCAAGGTGGTGTGG + Intronic
969558983 4:7933735-7933757 CCCTTGCTGGCCATCTGTTGGGG - Intronic
971143023 4:23945658-23945680 CCCTGGCTTCCTCAGTGCTGTGG - Intergenic
972193735 4:36627055-36627077 CCTTGAATTCCTATGTGTTGTGG - Intergenic
974686305 4:65235425-65235447 CCCTGGCTTTATACTTGTTGTGG - Intergenic
977135650 4:93300483-93300505 CCCAGCCTTGATCTGTGTTGAGG + Intronic
978100942 4:104840619-104840641 CCCAGAATTCCTATGTGTTGTGG - Intergenic
980376030 4:131949973-131949995 CCCTGGCTTGGCATATGTTTGGG + Intergenic
982193074 4:152877699-152877721 CCCAGAATTGCCATGTGTTGTGG + Intronic
987215202 5:15729150-15729172 TCCTGGCTTGTTATGTCTAGTGG - Intronic
987986435 5:25153378-25153400 CCCTGGCTAGGAAAGTGTTGGGG - Intergenic
988009049 5:25460634-25460656 CCCTGAATTCCCATGTGTTGTGG + Intergenic
995627914 5:114099161-114099183 ACCTGGCTGCCTATGTGGTGTGG - Intergenic
997611261 5:135217361-135217383 CACTGGCTTGCTATGTGAGCTGG + Intronic
998576818 5:143325418-143325440 CCCAGAATTCCTATGTGTTGTGG - Intronic
1000358720 5:160427501-160427523 CACTGCCTTGATTTGTGTTGAGG + Intronic
1003137173 6:3442529-3442551 CCCTTGATTGCTATGTGTTGAGG - Intronic
1006474975 6:34247723-34247745 CCATGGTGGGCTATGTGTTGGGG - Exonic
1007398099 6:41588647-41588669 CCAGGGCGTGCTCTGTGTTGAGG - Exonic
1008695702 6:54033589-54033611 CACTGGCTTGCTATGTGTCCTGG - Intronic
1009688324 6:66991979-66992001 CCTTGGCTAGCTCTGTGGTGTGG + Intergenic
1010263869 6:73845817-73845839 CCCAGAATTTCTATGTGTTGTGG + Intergenic
1010868321 6:81007145-81007167 CCCAGGATTCCTATGTGATGTGG + Intergenic
1014029798 6:116687248-116687270 CCTTGGCTGGCTATATTTTGAGG + Intronic
1015268063 6:131308734-131308756 CCTAGGCTTTCTTTGTGTTGTGG - Intergenic
1018462849 6:164015566-164015588 CCTTGTCTTGCACTGTGTTGGGG + Intergenic
1020020580 7:4864927-4864949 ACCTGGCTTGTTATGTATTTTGG - Intronic
1020755194 7:12192358-12192380 CCTTGAATTCCTATGTGTTGTGG - Intergenic
1021056927 7:16060472-16060494 TCCTGGGTTGCAATGTGCTGGGG - Intergenic
1022506124 7:30909623-30909645 CCCTGCCCTGCTATGTTCTGAGG - Intergenic
1022952144 7:35349298-35349320 CCCAAGGTAGCTATGTGTTGGGG + Intergenic
1023784040 7:43687893-43687915 CCCAGAATTGCCATGTGTTGTGG + Intronic
1026938967 7:74275655-74275677 CCCTGCCTTGCTGGGTGGTGGGG - Intergenic
1030086447 7:105819756-105819778 CCCGGCCTTGCTTTGTCTTGTGG - Intronic
1030203582 7:106930165-106930187 TCCTGGCATCCTAAGTGTTGAGG - Intergenic
1030585499 7:111413747-111413769 CCCTGTCCTGCTTTGTGATGTGG + Intronic
1031217935 7:118921506-118921528 CCCAGGATTCCCATGTGTTGTGG - Intergenic
1032266824 7:130375259-130375281 CCATGGCTTGATTTGTTTTGGGG + Intergenic
1034848815 7:154474445-154474467 CCCTGGCTGTCTCTGGGTTGTGG - Intronic
1035825295 8:2638473-2638495 CCCAGGATTCCCATGTGTTGTGG - Intergenic
1036618083 8:10404225-10404247 CCCTGCCTTGCTATTTGTGGAGG - Intronic
1037079623 8:14767893-14767915 CCTTGGTTTGCTATCTGTTAAGG + Intronic
1039978163 8:42384496-42384518 CCCAGTCTTTCTAGGTGTTGAGG + Intergenic
1040880505 8:52199775-52199797 TCTTGGCTTGCTATGGGTTTAGG - Intronic
1042021495 8:64374256-64374278 CCCAGGCTTTCTTTGTGTGGCGG + Intergenic
1043349234 8:79340270-79340292 AGCTACCTTGCTATGTGTTGAGG - Intergenic
1044718405 8:95122733-95122755 CCCAGGATTCCCATGTGTTGTGG + Intergenic
1048992233 8:139767223-139767245 CCCTGTCTAGCTGTGTGATGTGG - Intronic
1049001405 8:139827579-139827601 CCCAGGCCTGCCATGTGCTGGGG + Intronic
1049872608 8:144992727-144992749 CCCTGGCTGGCTGTGTGATCTGG + Intergenic
1054321819 9:63676937-63676959 CCCTGGCTTGGCATATGTTTGGG + Intergenic
1056475939 9:86950925-86950947 CCCATGCTTACTATGTGTAGAGG + Intergenic
1056816457 9:89804939-89804961 CCCAGGCTTGCTCTGTGTCACGG + Intergenic
1056968260 9:91181769-91181791 GCAGGGCTTGCTGTGTGTTGGGG - Intergenic
1058174374 9:101721125-101721147 GCCTGGATTCCCATGTGTTGTGG + Intronic
1058174651 9:101723035-101723057 TCCTGGATTCCCATGTGTTGTGG + Intronic
1058914380 9:109551588-109551610 CCTTGTCTTCCTATGTGTTCAGG + Intergenic
1061636821 9:131916677-131916699 CTCTGGCATGCTATGTCATGAGG + Intronic
1062341740 9:136096526-136096548 CCCTGGCTTGCCTTGTATGGGGG + Intergenic
1202788851 9_KI270719v1_random:63717-63739 CCCTGGCTTGGCATATGTTTGGG + Intergenic
1203466177 Un_GL000220v1:90038-90060 ACCTCGGTTGCTTTGTGTTGTGG - Intergenic
1186574672 X:10752216-10752238 CCCTGGCTTCCTATGACTTGAGG - Intronic
1190213370 X:48465183-48465205 TGCTGGCTTGGTATGTGTGGGGG - Intronic
1192361589 X:70444485-70444507 CCCAGGCTTGCTCTGAGCTGGGG - Intergenic
1192932741 X:75825242-75825264 CCTTGAATTGCCATGTGTTGTGG - Intergenic
1194250007 X:91562895-91562917 CTCTGGCTTGGTATTTGTTTTGG + Intergenic
1195848884 X:109261341-109261363 ACTTGCTTTGCTATGTGTTGAGG + Intergenic
1198687202 X:139238958-139238980 CCCTGGCTGGAGAAGTGTTGTGG - Intergenic
1199114119 X:143970001-143970023 CTCTGGCTTGCTAAGTCTTCTGG - Intergenic
1200568968 Y:4804144-4804166 CTCTGGCTTGGTATTTGTTTTGG + Intergenic
1201402967 Y:13622714-13622736 CCATGAATTTCTATGTGTTGTGG - Intergenic