ID: 1084952804

View in Genome Browser
Species Human (GRCh38)
Location 11:72676002-72676024
Sequence CCATTTTCTCAAAGGGAACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084952796_1084952804 23 Left 1084952796 11:72675956-72675978 CCCCAGAAGGCATCATAGAATTT No data
Right 1084952804 11:72676002-72676024 CCATTTTCTCAAAGGGAACGAGG No data
1084952798_1084952804 21 Left 1084952798 11:72675958-72675980 CCAGAAGGCATCATAGAATTTTA No data
Right 1084952804 11:72676002-72676024 CCATTTTCTCAAAGGGAACGAGG No data
1084952797_1084952804 22 Left 1084952797 11:72675957-72675979 CCCAGAAGGCATCATAGAATTTT No data
Right 1084952804 11:72676002-72676024 CCATTTTCTCAAAGGGAACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084952804 Original CRISPR CCATTTTCTCAAAGGGAACG AGG Intergenic
No off target data available for this crispr