ID: 1084954821

View in Genome Browser
Species Human (GRCh38)
Location 11:72685567-72685589
Sequence GCCTGATGTGAGCCAGCGGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 156}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084954821_1084954829 -7 Left 1084954821 11:72685567-72685589 CCCCCCGCTGGCTCACATCAGGC 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1084954829 11:72685583-72685605 ATCAGGCCTTGGAGCATAAGGGG 0: 1
1: 0
2: 1
3: 6
4: 103
1084954821_1084954827 -9 Left 1084954821 11:72685567-72685589 CCCCCCGCTGGCTCACATCAGGC 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1084954827 11:72685581-72685603 ACATCAGGCCTTGGAGCATAAGG 0: 1
1: 0
2: 0
3: 13
4: 112
1084954821_1084954833 21 Left 1084954821 11:72685567-72685589 CCCCCCGCTGGCTCACATCAGGC 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1084954833 11:72685611-72685633 GAACAGAAGGCTTCCAGCGGCGG 0: 1
1: 0
2: 0
3: 13
4: 101
1084954821_1084954828 -8 Left 1084954821 11:72685567-72685589 CCCCCCGCTGGCTCACATCAGGC 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1084954828 11:72685582-72685604 CATCAGGCCTTGGAGCATAAGGG 0: 1
1: 0
2: 0
3: 6
4: 114
1084954821_1084954831 8 Left 1084954821 11:72685567-72685589 CCCCCCGCTGGCTCACATCAGGC 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1084954831 11:72685598-72685620 ATAAGGGGTGTCTGAACAGAAGG 0: 1
1: 0
2: 0
3: 14
4: 121
1084954821_1084954832 18 Left 1084954821 11:72685567-72685589 CCCCCCGCTGGCTCACATCAGGC 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1084954832 11:72685608-72685630 TCTGAACAGAAGGCTTCCAGCGG 0: 1
1: 0
2: 0
3: 15
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084954821 Original CRISPR GCCTGATGTGAGCCAGCGGG GGG (reversed) Exonic
900476280 1:2877870-2877892 GCCTGTCGTGAGACAGAGGGAGG + Intergenic
900622049 1:3592019-3592041 GCCTGACCTGAGCCAGCATGTGG - Intronic
902335470 1:15751932-15751954 CCCTGAGGGGAGCCAGCGGAGGG + Intergenic
906293355 1:44634128-44634150 GCCTGTTGTGAGCCTGAGGCAGG - Intronic
908401687 1:63777227-63777249 GGCTGCTGGGAGCCAGAGGGAGG + Intronic
909506342 1:76394813-76394835 CCCTGGTGTGAGGCAGAGGGGGG + Intronic
919757883 1:201077216-201077238 GACTGATGTGACACAGAGGGAGG + Intronic
920111776 1:203592175-203592197 TCCTGATGTGAGGGAGCTGGGGG - Intergenic
922674611 1:227542711-227542733 CCCTGGTGGCAGCCAGCGGGAGG + Intergenic
924819617 1:247476331-247476353 GACTGATTTGAGCAAGCAGGGGG + Intergenic
1065745868 10:28841386-28841408 ACTTGAGTTGAGCCAGCGGGAGG - Intergenic
1070219202 10:74422937-74422959 GCCTGATGACAGCCAGCTGAAGG + Intronic
1070783823 10:79151818-79151840 GCGGGATGTGAGCCAGGGTGGGG + Intronic
1071345589 10:84688772-84688794 GCCTGATGTGAGGAAGCAGTAGG + Intergenic
1073056728 10:100707895-100707917 GCCTGAGAGGAGACAGCGGGTGG - Intergenic
1076845518 10:133067769-133067791 GCCTGGTGCGGGCCAGGGGGTGG + Intergenic
1077141149 11:1025488-1025510 GCCTGCTGAGAGCCAGCTTGGGG + Intronic
1081713367 11:45232283-45232305 GCCTGATGGGACCCAGGAGGTGG + Intronic
1082569493 11:54720351-54720373 GCCTGCTGTGAACCAAAGGGTGG + Intergenic
1082901690 11:58261170-58261192 GCCTGTTGTGGGACAGGGGGAGG - Intergenic
1083644834 11:64166106-64166128 ACCTGCTCGGAGCCAGCGGGAGG + Intronic
1084411364 11:69008062-69008084 GCCTGCTGTGCTCCAGCTGGTGG + Intronic
1084493557 11:69491028-69491050 GCCTGCTGTGCGCCAGCTGCTGG + Intergenic
1084552226 11:69851599-69851621 GCCTGAAGGGAGCCAGAGGGTGG + Intergenic
1084954821 11:72685567-72685589 GCCTGATGTGAGCCAGCGGGGGG - Exonic
1085451411 11:76636268-76636290 CCCTGGTGTGAGCCAGTGGGAGG + Intergenic
1085981619 11:81733020-81733042 ACCTGCTGTGGGCCAGAGGGGGG - Intergenic
1086322474 11:85664869-85664891 GCCTCATGAGGGCCAGCGGCGGG + Exonic
1091449186 12:562102-562124 GTCTGACGTGAGCCATCCGGAGG - Exonic
1092109795 12:5951351-5951373 GGCTGTTGTCAGCCAGCTGGTGG + Intronic
1096613327 12:52817247-52817269 GGCTGAGGTGAGGCAGCCGGGGG - Intergenic
1099973729 12:89525499-89525521 GCCTGCCTTGGGCCAGCGGGCGG - Intronic
1103570131 12:121839466-121839488 GCCTTATGGCAGCCAGGGGGAGG - Intergenic
1104287756 12:127440549-127440571 GTCTGAGGTGAACCAGAGGGGGG - Intergenic
1105045723 12:133001725-133001747 GCCTGAGGTGAGCCGCAGGGAGG + Intronic
1105211818 13:18261495-18261517 GGCTCATGTGAGGCAGCAGGTGG + Intergenic
1107477510 13:40753438-40753460 GCATTCTGTGAGACAGCGGGAGG - Intronic
1112210882 13:97375871-97375893 GGCTTATGTGAGCCAGCGAGTGG + Intronic
1113604846 13:111597860-111597882 CCCTGACGTGACCCTGCGGGAGG + Intronic
1113656640 13:112072219-112072241 GCCTGAAGCGAGCCTTCGGGGGG - Intergenic
1115442770 14:33454985-33455007 GCCTGATGGAAGCCAGCGCCGGG - Intronic
1118762423 14:68888659-68888681 GCAGGAGGTGAGCCAGCAGGTGG + Intronic
1121210893 14:92207384-92207406 GCCTGATGTGAGCCTAGGTGAGG + Intergenic
1121701438 14:95957356-95957378 GACTGATTTGAGCAAGCAGGCGG - Intergenic
1124404069 15:29378595-29378617 GCCTGAAGGGAGGCAGCAGGTGG - Intronic
1128447774 15:67779854-67779876 GCCAGATTTGCGGCAGCGGGAGG + Intronic
1129167243 15:73785636-73785658 GACTGATTTGAGCAAGCAGGTGG + Intergenic
1129945888 15:79539089-79539111 GCCAGATGAGAGCCAGAGTGGGG + Intergenic
1130344629 15:83031620-83031642 GCCTGCTGTGGGGCAGCGGGAGG + Intronic
1131870264 15:96756818-96756840 GCCGGGTGGGAGCCAGCGGGAGG + Intergenic
1132748374 16:1446306-1446328 GCCTCTTGGGAGCCAGCGGCAGG - Exonic
1139471008 16:67178181-67178203 GCCAGGTGTGCGCCAGCGCGGGG - Exonic
1141694465 16:85613141-85613163 CCCTGACCTCAGCCAGCGGGAGG - Intronic
1143564251 17:7712025-7712047 GACAGATGGGAGACAGCGGGAGG - Intergenic
1147184789 17:38707201-38707223 GCCTGAGGTGGGGCAGAGGGAGG - Intronic
1147662656 17:42125272-42125294 GCCTGATGAGAGCCAGCTGAAGG + Intronic
1147865000 17:43546169-43546191 GCCTCAGGTGAGGCTGCGGGAGG - Exonic
1147945904 17:44080091-44080113 GCCAGATGTAAGCCTGCTGGGGG - Exonic
1148923099 17:51057219-51057241 GCCTGTGGTGAGGCAGAGGGTGG + Intronic
1151670750 17:75570504-75570526 GCCTGAGGTGAGGCTGCGGCCGG + Intronic
1152942509 17:83180366-83180388 GCCTGGTGTGACCCTGCTGGAGG + Intergenic
1155153689 18:23141422-23141444 GCCTGATGTCACAAAGCGGGTGG - Intronic
1155155740 18:23156083-23156105 TCCTGATGTGGGCCAGCAGCGGG + Intronic
1155341321 18:24817389-24817411 GCCTGAGGTGACCCAGCTGGAGG + Intergenic
1161767719 19:6216376-6216398 GCCCGGTGGGAGCCAGGGGGCGG - Intronic
1162565778 19:11445335-11445357 GGCTGATGGGAGCCGGTGGGTGG + Intronic
1165924379 19:39318252-39318274 GCTTGCTGTCAGCCAGCTGGGGG - Intergenic
927450658 2:23206730-23206752 GGCTGAGCTGAGCCAGCTGGAGG + Intergenic
927963320 2:27254374-27254396 GCATGCTGTGAGCCAGGGGAAGG + Intronic
929604720 2:43226722-43226744 GCCTGACGTCCGCGAGCGGGCGG - Intergenic
934301809 2:91780959-91780981 GGCTCATGTGAGGCAGCAGGTGG - Intergenic
934542406 2:95186830-95186852 GCCTGCTGTGGGGCAGGGGGAGG - Intergenic
934770736 2:96906469-96906491 GCCTGATGTGAACCATCGTGGGG + Intronic
936950860 2:117976001-117976023 GCCTGAGGTCACCCAGCTGGTGG - Intronic
936971982 2:118185287-118185309 CCCAGATGTGAGCCTGCAGGCGG + Intergenic
938381289 2:130837695-130837717 TCCCCAGGTGAGCCAGCGGGAGG + Intronic
938689682 2:133776178-133776200 GGCAGCTGAGAGCCAGCGGGAGG + Intergenic
939931533 2:148240259-148240281 GCCTGTCGTGAGGCAGGGGGAGG + Intronic
944412034 2:199455900-199455922 GCCCCATGGGAGCCCGCGGGAGG - Exonic
947729370 2:232419636-232419658 GCGTGAGGTGAGCCTGCGGTCGG - Intergenic
948281164 2:236748930-236748952 GCCTGAATTGAGCCAGAGGAGGG + Intergenic
948479743 2:238241708-238241730 GACAGTTGGGAGCCAGCGGGAGG - Intergenic
1172039068 20:32031191-32031213 GCGTGATGTCAGCCAGCAGCCGG - Exonic
1172781381 20:37438684-37438706 GCCTCCTGGGAGCCGGCGGGTGG + Intergenic
1174796480 20:53526905-53526927 GCATGATGGGTGCCAGGGGGTGG + Intergenic
1175796149 20:61772276-61772298 GGCTGATGGGAGTCAGTGGGCGG - Intronic
1175920081 20:62446558-62446580 GCCTGGTGGGAGCCAGCAGCAGG - Intergenic
1176051070 20:63120028-63120050 GCCTGGTGTGCGCCAGTGAGGGG + Intergenic
1178602259 21:34004822-34004844 GCCTGATGCTAGGCAGTGGGAGG - Intergenic
1179825895 21:43966354-43966376 GCCAGGGGTGAGCCAGCGGTGGG + Intronic
1180814622 22:18781760-18781782 GGCTCATGTGAGGCAGCAGGTGG + Intergenic
1181200811 22:21216096-21216118 GGCTCATGTGAGGCAGCAGGTGG + Intronic
1181669433 22:24419283-24419305 GCCTGCTGTGAGGCAGGGGGAGG + Intronic
1181700930 22:24620877-24620899 GGCTCATGTGAGGCAGCAGGTGG - Intronic
1182275748 22:29187776-29187798 GCCTGAGGTCACCCAGCGAGTGG + Intergenic
1184650173 22:45916060-45916082 GCTTGGTGGGAGCCAGAGGGAGG + Intergenic
1184863373 22:47189485-47189507 GCCGGCTGTGAGCATGCGGGGGG - Intergenic
1203226106 22_KI270731v1_random:79339-79361 GGCTCATGTGAGGCAGCAGGTGG - Intergenic
1203264722 22_KI270734v1_random:7447-7469 GGCTCATGTGAGGCAGCAGGTGG + Intergenic
950250381 3:11460456-11460478 GCCTGATGTGGGCAAGGGAGAGG + Intronic
950842167 3:15978103-15978125 GCCTGATGTGAACCAGGCAGAGG - Intergenic
953278129 3:41524609-41524631 GCCTGAAGTCAGCCAGAGGCAGG + Intronic
954366966 3:50151384-50151406 ACCTGAGGTGAGCCACGGGGAGG + Intergenic
954438925 3:50511026-50511048 GCCTGAGGTGAGCTAGGGTGGGG + Intergenic
954697405 3:52435164-52435186 GCCTGCAGGGAGCCAGAGGGTGG - Exonic
954904909 3:54052966-54052988 ACTTGATGAGAGCCATCGGGTGG - Intergenic
954931941 3:54290901-54290923 GCCTGTTGTGGGGTAGCGGGGGG + Intronic
958877613 3:99633794-99633816 GCCTGCTGTGTGCCAGTTGGTGG - Intergenic
959448269 3:106467155-106467177 ACCTGCTGTGAGTCAGAGGGGGG - Intergenic
962891748 3:139678081-139678103 GGCGGTTGGGAGCCAGCGGGCGG - Intergenic
964118437 3:153159958-153159980 GCCAGAGGAGAGCCAGAGGGTGG + Intergenic
969241841 4:5904088-5904110 GGCTGCTGTGAGACAGTGGGTGG - Intronic
969401626 4:6959483-6959505 GCCGGCTGTGAGCCTGCAGGAGG - Intronic
971932354 4:33101462-33101484 GCCAGATGTAAGTCAGAGGGTGG - Intergenic
980653180 4:135747940-135747962 GCCTGTTGTGGGGCAGGGGGAGG - Intergenic
982066731 4:151660955-151660977 GCCTGAGGTCAGCCAGCAAGTGG + Intronic
983451316 4:167914545-167914567 GCCTGTTGTGGGGCAGGGGGAGG + Intergenic
983485486 4:168327613-168327635 GCCAGATGCGAGCGAGAGGGAGG + Intergenic
984194810 4:176646254-176646276 TCCTGATGTGTGCCAGCCGGTGG + Intergenic
984752085 4:183287793-183287815 GGCTCTTGTGAGCCAGCGTGAGG - Intronic
993437154 5:87911957-87911979 GCCTGATCTGAGCCTGTGGGTGG + Intergenic
993615505 5:90106145-90106167 GCCTGTTGTGGGGCAGAGGGAGG + Intergenic
997380044 5:133429150-133429172 TGCTGATGTGAGCCAACGAGGGG - Intronic
999407547 5:151320627-151320649 GGCTGCTGTGAGCCAGGGAGTGG + Intronic
1001557081 5:172643937-172643959 GCCTGGTGGGAGCCATGGGGAGG - Intronic
1002487623 5:179550540-179550562 GTGTCATGTGACCCAGCGGGCGG - Exonic
1003212523 6:4079643-4079665 GCTTGATGTGAGCAGGCGGTGGG - Exonic
1004468417 6:15906818-15906840 GCCAGATGCCAGCCAGCGTGTGG - Intergenic
1009353395 6:62709349-62709371 ACCTGCTCTGAGCCAGTGGGGGG - Intergenic
1010292276 6:74151277-74151299 GCCTGTTGTGAGGTAGGGGGAGG + Intergenic
1010351779 6:74883433-74883455 GCCTGTTGTGGGGCAGGGGGAGG - Intergenic
1013878507 6:114865032-114865054 GCCTGTTGTGGGGTAGCGGGAGG - Intergenic
1014097325 6:117474561-117474583 GCCTGTTGTGGGGCAGGGGGAGG + Intronic
1016911945 6:149208004-149208026 GGCTGATGTCAACCAACGGGAGG + Intergenic
1018027766 6:159819184-159819206 GCCTGCTGTGATCAGGCGGGTGG - Intronic
1018952284 6:168386998-168387020 GCCTGAGGTGGCCCAGCTGGAGG - Intergenic
1021081316 7:16369254-16369276 GACTGATTTGAGCAAGCAGGGGG + Intronic
1023240548 7:38141662-38141684 TTCAGGTGTGAGCCAGCGGGTGG - Intergenic
1024521104 7:50304591-50304613 GCCTGGTCTGAGCCGGCTGGGGG + Intronic
1024672232 7:51606718-51606740 GCCGGATGTGAGGAAGCCGGTGG + Intergenic
1024962416 7:54991510-54991532 TCCTGATGTGAGCTGGCGGCAGG - Intergenic
1028369694 7:90076874-90076896 GCCTGAAGTGAGGTAGGGGGAGG + Intergenic
1028491596 7:91418485-91418507 GCCTGTTGTGGGACAGGGGGAGG - Intergenic
1033121800 7:138673215-138673237 GAATGATGTCAGCCAGCGTGTGG + Intronic
1039586683 8:38712877-38712899 GCCTGCAGTGAGCCAGCGATGGG - Intergenic
1040977285 8:53207847-53207869 GCCTGATTTGAGCAAGGGGAAGG + Intergenic
1042156393 8:65848791-65848813 GCCACATGTGAGCAGGCGGGTGG + Intergenic
1045789038 8:105959282-105959304 GCCTGTTGTGGGGCAGGGGGAGG + Intergenic
1052855712 9:33404936-33404958 GGCTGATGGGAGCCAGTAGGGGG + Intergenic
1052991740 9:34522786-34522808 GCCTGGTGCGCGCCCGCGGGAGG + Exonic
1053672239 9:40378088-40378110 GCCTGTTGTGGGGCAGGGGGAGG + Intergenic
1054091136 9:60848051-60848073 GCCTGCTGTGTGCTAGAGGGAGG + Intergenic
1054112547 9:61123607-61123629 GCCTGCTGTGTGCTAGAGGGAGG + Intergenic
1054383350 9:64518122-64518144 GCCTGTTGTGGGGCAGGGGGAGG + Intergenic
1054512385 9:65998222-65998244 GCCTGTTGTGGGGCAGGGGGAGG - Intergenic
1055706292 9:79008569-79008591 GACTGATTTGAGCAAGCAGGGGG - Intergenic
1056950448 9:91036970-91036992 GTGCGATGTGGGCCAGCGGGCGG + Intergenic
1057168579 9:92947371-92947393 GCCTGCGGAGAGCCAGTGGGAGG - Intergenic
1061160405 9:128890667-128890689 GCCCTAGGTGAGCCAGGGGGAGG - Intronic
1061623691 9:131827900-131827922 GCATGATGTGGGGCAGGGGGAGG + Intergenic
1061780788 9:132994982-132995004 GGTTGCTGTGAGCCAGAGGGCGG + Intergenic
1061881924 9:133573008-133573030 GCCTGCTCCGAGCCAGGGGGTGG - Intronic
1061951829 9:133940531-133940553 GCCTGCTGTGAGGCAGGGTGAGG - Intronic
1186049462 X:5574847-5574869 ACCTGATGTGAGCCTTTGGGGGG - Intergenic
1192210188 X:69123062-69123084 GCCTGAAGTGGGGCAGTGGGTGG - Intergenic
1196196529 X:112842767-112842789 GCCTAATGGGAGCCATCTGGGGG + Intergenic
1196681708 X:118476143-118476165 GCCTGATGTGAGTGAGCAAGGGG + Intergenic
1202150053 Y:21836345-21836367 GGCTGACGTGAGCCAGCCTGAGG - Intergenic