ID: 1084955225

View in Genome Browser
Species Human (GRCh38)
Location 11:72687648-72687670
Sequence TTTCCTCAGCCTGGGATCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 303}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084955225 Original CRISPR TTTCCTCAGCCTGGGATCTC AGG Intronic
900200073 1:1400596-1400618 TTTCCCCAGGCTGGTAGCTCAGG + Exonic
900376857 1:2358912-2358934 TTTCCCAGCCCTGGGATCTCTGG + Intronic
900624459 1:3601858-3601880 GCTTCTCAGCCTGGGATCTGCGG - Intronic
901171317 1:7259820-7259842 TTCCCTCAGCCTTTGTTCTCTGG + Intronic
901441715 1:9282159-9282181 AGTCCTCAGCCTGGGACCTGAGG + Intergenic
902170038 1:14602572-14602594 TTTCCTCAGCATAACATCTCTGG + Intronic
902549423 1:17210564-17210586 CGCCCTCAGCCTGGGCTCTCTGG + Intronic
902815540 1:18914420-18914442 TGGACCCAGCCTGGGATCTCCGG + Intronic
902942050 1:19807573-19807595 TCTCTTGAGCCTGGGATTTCAGG + Intergenic
904264380 1:29310035-29310057 TCTCCTCAGCTTGGGGGCTCTGG + Intronic
904792695 1:33035776-33035798 TTTCATGAGCCTGAGACCTCAGG - Intronic
905904938 1:41611857-41611879 TCTCCCTAGCCTGGGAACTCCGG + Intronic
907496971 1:54851667-54851689 CTTCCCCACCCTGGGATCTCAGG - Exonic
908122665 1:61000799-61000821 TTCCCCCAGCCTGGCAACTCTGG - Intronic
908229655 1:62091223-62091245 TGTCTATAGCCTGGGATCTCTGG - Intronic
909041919 1:70663891-70663913 CTGCTTCAGCTTGGGATCTCTGG + Intergenic
910783995 1:90974214-90974236 ATGCCTCAGCCTGGGATTACTGG - Intronic
912465774 1:109872761-109872783 TTTTCCCAGCCTAGGATCTGGGG - Intergenic
912468806 1:109892645-109892667 TTTCCTCAGCCCTGGAATTCAGG - Intergenic
914703421 1:150152941-150152963 TGACCTCAGCCTAGGATATCTGG + Intronic
914730650 1:150366833-150366855 TTTCCTCACCTTGGGCTCTGGGG + Intronic
915316500 1:155031758-155031780 TGTCCCCAGCCAGGGCTCTCCGG - Exonic
916749906 1:167714404-167714426 TTTCCTCAGCCCGGGCTCCCGGG + Intergenic
918110655 1:181452557-181452579 CTACCTCAGCCAGGGCTCTCAGG + Intronic
918524631 1:185452079-185452101 TAGCCTCAGCCTGGTATATCTGG - Intergenic
919914675 1:202132217-202132239 TTTCCTGGGCCTGGGATCCCGGG - Exonic
920366129 1:205449340-205449362 TTTCCTGAGCCTGGGCTAGCAGG - Intronic
922963496 1:229667857-229667879 TTCCCTCAGCCAGGAATCTTTGG - Intergenic
1063442523 10:6084443-6084465 TTGCTTGAGCCTGGGATTTCGGG + Intergenic
1064112870 10:12553461-12553483 TTTGCACAGCCTGGGTCCTCTGG - Intronic
1066692056 10:38039305-38039327 TTGCCTGAGCCTGGGAAGTCAGG - Intronic
1067000652 10:42609332-42609354 TTGCCTGAGCCTGGGAAGTCAGG + Intronic
1067769647 10:49114272-49114294 CCTCCTCAGACTGGGATCTATGG + Intronic
1069563787 10:69450158-69450180 TTTTCTCAGCCTGGGACCAGAGG - Intergenic
1069609928 10:69766261-69766283 TTTTCTCGGCTTGGGATCTAGGG - Intergenic
1070237224 10:74641257-74641279 CTGCCTCAGCCTGGGATTTTAGG - Intronic
1070668277 10:78360668-78360690 TTTCCTCTGCCTTGCTTCTCTGG + Intergenic
1071114082 10:82196278-82196300 TTTCCTCAGCCTGACATTTGGGG + Intronic
1073231195 10:101971859-101971881 TTTACTCAGACTGGGAGATCTGG + Intronic
1074155549 10:110795781-110795803 CTTAATCAGCCTGGAATCTCTGG - Intronic
1076039267 10:127229109-127229131 CTGCCTCAGCCTGGGATTACAGG - Intronic
1076787730 10:132759451-132759473 ACACCTCAGCCTGGGATTTCCGG + Intronic
1078122761 11:8527082-8527104 CTGCCTCAGCCTGGGATTACAGG + Intronic
1078182774 11:9026679-9026701 CTCCCTCAGCCTGGGATTACAGG + Intronic
1078425175 11:11243884-11243906 TTTCCTCAGCCTGCAACCCCAGG + Intergenic
1078800875 11:14643573-14643595 TTTCCTCGGCCTGGGCACGCTGG + Exonic
1079344116 11:19637128-19637150 TTGCCACAGCCTGGGTTCTTGGG + Intronic
1080644469 11:34178269-34178291 CCTCCCCAGCCTGGGATCTGTGG + Intronic
1081460036 11:43264150-43264172 TTCCGTCAGGCTGGGCTCTCAGG + Intergenic
1081733797 11:45389921-45389943 TGTCCTCAGACAGGGAGCTCTGG - Intergenic
1083335470 11:61919246-61919268 AGTCCTCAGCCTGGGAGGTCTGG + Intronic
1083767495 11:64848872-64848894 CTTCCTCATGCTGGGTTCTCAGG - Intergenic
1083801207 11:65047552-65047574 TTCCCGCAGCTTGGGTTCTCTGG - Exonic
1083848120 11:65348358-65348380 TTGCTTGAGCCTGGGATTTCAGG + Intronic
1084464025 11:69311923-69311945 TCTCCCCAGCCTGGGACCCCAGG + Intronic
1084955225 11:72687648-72687670 TTTCCTCAGCCTGGGATCTCAGG + Intronic
1085626616 11:78078846-78078868 CTCCCTCAGCCTGGGACCACAGG + Intronic
1086697832 11:89864881-89864903 CTTCCTCAACGTGGGATCCCTGG + Intergenic
1086708330 11:89979607-89979629 CTTCCTCAACGTGGGATCCCTGG - Intergenic
1087077824 11:94142045-94142067 TTTCCAGAGCCTGGGTTCTCAGG + Intronic
1087420327 11:97916261-97916283 TTTCCTCAACCTGGAAGATCAGG + Intergenic
1087551530 11:99656655-99656677 TTTGCTGAGACTGGCATCTCTGG - Intronic
1087784276 11:102337478-102337500 TTGCCTCAGCCTGGGACTACAGG - Exonic
1089348725 11:117809176-117809198 TCTCCTGAGCCTGGGGTCTCAGG - Intronic
1089498626 11:118920183-118920205 GTTTCCCATCCTGGGATCTCAGG - Intronic
1090448150 11:126782084-126782106 TTTCCTCCTCCTGGGTTCACAGG + Intronic
1090566458 11:127997343-127997365 TTTTCTCACCTTGGGATCTTAGG + Intergenic
1091661831 12:2389952-2389974 TTTCCTCAGCCTGGGAGTAGAGG - Intronic
1096146568 12:49282892-49282914 TTGCCTGAGCCTGGGAGTTCAGG - Intergenic
1096981396 12:55729658-55729680 TTTTCTCAGACTAGGATCCCTGG - Exonic
1097922408 12:65090395-65090417 TTGACTCAGCTTGGCATCTCAGG - Intronic
1102377560 12:112435101-112435123 TTGCCTGAGCCTGGGACGTCGGG - Intronic
1102860337 12:116330696-116330718 GTGCCTCAGCCTGGGATTACAGG - Intergenic
1102893900 12:116583011-116583033 TTTCCGTGGCCTGGGAACTCAGG + Intergenic
1103320449 12:120089858-120089880 TTTCCTCATCCTGGGACTCCAGG + Intronic
1104044827 12:125154332-125154354 TTTTGTCAGCCTGGGCTGTCTGG + Intergenic
1104045623 12:125160521-125160543 CTTCCTCAGCTTGGCATTTCTGG - Intergenic
1104324823 12:127786016-127786038 TCTGCTCTGCCTGGCATCTCTGG - Intergenic
1104582394 12:130020617-130020639 CTGCCTCAGCCTGGGATTACAGG + Intergenic
1105422466 13:20265145-20265167 GTTCCTCAGACTGGCATCCCAGG - Intergenic
1106063067 13:26314082-26314104 TTTCCTCAGCCTTAAAACTCTGG - Intronic
1106204307 13:27575564-27575586 TGCCCTCAGACTGGGATCACTGG + Intronic
1106484577 13:30160937-30160959 TTTCCACAGCCTTTGAACTCAGG - Intergenic
1106857536 13:33869172-33869194 TTTTCTCAGCCTGGATTCTCTGG + Intronic
1107418438 13:40222881-40222903 TTTCCCCAGAATGGGTTCTCTGG + Intergenic
1107703709 13:43077275-43077297 TTTGCACAGCTTGGGTTCTCTGG + Intronic
1107990172 13:45812752-45812774 TTTAGTCATGCTGGGATCTCAGG - Intronic
1110683964 13:78349917-78349939 TTCCCTCATCTTGGGATTTCTGG - Intergenic
1112661538 13:101514849-101514871 TTCCCCTAGCCTGGGACCTCAGG - Intronic
1113463400 13:110497137-110497159 TAACCTCAGCCAGGGATCTAGGG + Intronic
1113528276 13:111000022-111000044 TTTTCCTAGCCTGGGAGCTCAGG - Intergenic
1115490930 14:33957485-33957507 TTTCTACAGCCAGGGGTCTCTGG + Intronic
1116717460 14:48445885-48445907 TTTAATCAGCCTTGGATCCCAGG - Intergenic
1116801989 14:49453007-49453029 TTTCCTCCACCTGGGATTTGAGG + Intergenic
1118862282 14:69673745-69673767 TTTCCTCAGTCTGGGCTCTGTGG + Intronic
1119089554 14:71768485-71768507 TTTTCTCAGCTTTGGACCTCCGG - Intergenic
1119359217 14:74033751-74033773 TTGCCTCAGCCTGGGACTACAGG - Intronic
1120497662 14:85256674-85256696 CTGCCTCAGCCTGGGACCACAGG + Intergenic
1122035986 14:98949801-98949823 TCTCTTCAGCCTGGGCTCCCTGG - Intergenic
1123455444 15:20418670-20418692 CTGCCTCAGCCTGGGATTACAGG - Intergenic
1123753865 15:23381253-23381275 CTGCCTCAGCCTGGTCTCTCAGG - Intergenic
1126958950 15:53968584-53968606 TTTCCTCAGCCAGGAAGCTGAGG + Intergenic
1127059145 15:55164204-55164226 ATTCGTCAGCCTGGGTCCTCAGG + Intergenic
1128325828 15:66723427-66723449 CTGCCTCAGCCTGGGATTACAGG - Intronic
1128476787 15:68004349-68004371 TTTCCTAAGCTTGGCCTCTCTGG + Intergenic
1130043307 15:80424239-80424261 ATTCCTCAGGCAGGGTTCTCTGG + Intronic
1130306150 15:82713325-82713347 TTTTCTCAGACTGGGAGCTATGG + Intergenic
1130690689 15:86079445-86079467 GTTTCTAAGCCTGGGACCTCAGG + Intergenic
1131022412 15:89110181-89110203 CTGCCTCAGCCTGGGATTACAGG + Intronic
1132207761 15:99998201-99998223 TTTCCAGAGCCTGGGCCCTCCGG + Intronic
1132214659 15:100053803-100053825 TTACTTCTGCCTGGGACCTCGGG - Intronic
1133238691 16:4402366-4402388 CTGCCTCAGCCTGGGACCACAGG + Intronic
1133398857 16:5470124-5470146 GTTCCTCACTCTGGGAGCTCTGG - Intergenic
1134462516 16:14441774-14441796 CTGCCTCAGCCTGGTCTCTCAGG + Intronic
1134810626 16:17163923-17163945 CTGCCTCAGCCTGGGATCACAGG - Intronic
1134881452 16:17748040-17748062 TTTCCTGAGCCTCTGATGTCTGG - Intergenic
1135498938 16:22976953-22976975 TGGCCTCTGGCTGGGATCTCAGG - Intergenic
1135771453 16:25221271-25221293 TACCCTCTGCCTGGCATCTCAGG + Intronic
1135892037 16:26365955-26365977 TTTCATCACCCTGTTATCTCTGG - Intergenic
1136351907 16:29715867-29715889 CTGCCTCAGCCTGGGATTACAGG + Intergenic
1136582490 16:31161546-31161568 CTGCCTCAGCCTGGGATTACAGG - Intergenic
1137015703 16:35372204-35372226 TTTCTTGAGCCTGGGAGATCAGG + Intergenic
1139331751 16:66197688-66197710 TTTCCGCAGCCAGGGACCTGTGG + Intergenic
1139581561 16:67876851-67876873 TTTTCTCACCCTGGGTTCTCAGG + Exonic
1140333102 16:74076690-74076712 GATGCTCAGCCTGGGAGCTCAGG - Intergenic
1141401302 16:83749416-83749438 ATTCCTCTGCCTTGGATTTCTGG - Intronic
1141558940 16:84854011-84854033 TTTCCTGCCCCTGGGAACTCCGG + Intronic
1141560382 16:84863842-84863864 CTACCTCAGCCTGGGATTACAGG - Intronic
1141672507 16:85499953-85499975 ATTCCCCAGCATGGGATTTCTGG - Intergenic
1142119367 16:88378348-88378370 TTTTACCAGCCTGGGATTTCTGG - Intergenic
1142247717 16:88977397-88977419 TTCCTTCAGCCTGGGGTATCTGG + Intergenic
1142553850 17:758670-758692 CTGCCTCAGCCTGGGATTACAGG - Intronic
1143335202 17:6166985-6167007 TTTCCTTAGGCTGTGTTCTCCGG - Intergenic
1143648472 17:8247914-8247936 TTTCCTCTGCCTTGTCTCTCTGG - Intronic
1143706061 17:8698421-8698443 TCTCCTCAGCCCGGGGTTTCCGG - Intergenic
1143706599 17:8702050-8702072 TTTCCTCAGCCTGGTCTCTGAGG + Intergenic
1143953108 17:10648960-10648982 TTTCCTCAGGCTGGGCTCGGTGG - Intronic
1144334556 17:14257088-14257110 CTGCCTCAGCCTGGGATTACCGG + Intergenic
1144438180 17:15259823-15259845 CTGCCTCAGCCTGGGATTACAGG - Intronic
1144845693 17:18217743-18217765 CCTTCTCAGCCAGGGATCTCAGG + Intergenic
1146309160 17:31753827-31753849 TGTCCTCAGCCTGTGTTCCCAGG + Intergenic
1146956255 17:36937921-36937943 TTTCCTCGCCCCGGGAGCTCAGG + Exonic
1147876905 17:43628198-43628220 TTCCCTCTGCCTGGGAGTTCAGG + Intergenic
1147879099 17:43642497-43642519 TTTCCTAGCCCTGGGACCTCTGG - Intronic
1148163880 17:45468811-45468833 TTTGTGGAGCCTGGGATCTCAGG + Intronic
1148491472 17:48026347-48026369 TCTCCTGACCCTGGGATCTTTGG + Exonic
1148577165 17:48720136-48720158 TGCCCTCAGCCTGGGGTCTGCGG + Intergenic
1149493123 17:57099409-57099431 ATTGCTCAGCCTTGGGTCTCTGG + Intronic
1151403615 17:73872411-73872433 CTGCCTCAGCCTGGGATTACAGG - Intergenic
1151808531 17:76421972-76421994 TTTCCTCCACCTGGGATTTGTGG - Intronic
1151935551 17:77258658-77258680 TCTCCTCGGCTTGGGATCTCCGG + Intergenic
1152237917 17:79148065-79148087 TTTCCTCACCGTGGGACCCCAGG + Intronic
1153655030 18:7274619-7274641 CTGCCTCAGCCTGGGATTACAGG + Intergenic
1154165991 18:12014881-12014903 TTTCCTTAGCCCAGAATCTCAGG + Intronic
1156183467 18:34633789-34633811 TTTCCTTAGGCTGGAAACTCAGG - Intronic
1156246752 18:35307680-35307702 TCTCCTCAGCATGGGTTTTCTGG - Intergenic
1156511864 18:37643739-37643761 CTTCCTCACTCTGGGATCACAGG + Intergenic
1157409143 18:47449191-47449213 CTTCCTCAGCCTGAAATTTCTGG - Intergenic
1160538244 18:79606805-79606827 CTCCCTCCGCCTGGGATCTGGGG - Intergenic
1160563625 18:79773619-79773641 TTTCCTCAGCCTGCTTTCTCTGG - Intergenic
1160589984 18:79938416-79938438 CTTCCTCAGGCTGGGCACTCGGG + Intronic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1161302816 19:3551239-3551261 TGTCCTCACCCTGGGAGCCCTGG - Intronic
1161470463 19:4454505-4454527 TTCCTTGAGCCTGGGAGCTCAGG - Intronic
1161737043 19:5997665-5997687 ATTCCTCAGCCTGTGGTTTCAGG + Intronic
1162665734 19:12210238-12210260 TTGCCTCAGCCTGAGATTACAGG + Intergenic
1163108419 19:15141605-15141627 TTGCCTCTGCCTGGGAGCCCTGG - Intergenic
1163483549 19:17573002-17573024 CTTCCTCAGCCTGGTCTCTGAGG - Intronic
1163827326 19:19530909-19530931 GTTCCTCAGTCTGGGATTTGAGG + Intronic
1164643194 19:29841292-29841314 TTCCCTGAGCCTGTGCTCTCTGG - Intergenic
1166809245 19:45506134-45506156 TTTCCTCAGGCTGAGTTGTCTGG - Intergenic
1167424037 19:49420562-49420584 CTTCTCCAGCCTGGGAGCTCAGG - Intergenic
925332504 2:3069688-3069710 TTTCCTGAGCCTGTGGTCTCTGG + Intergenic
925523400 2:4773099-4773121 TATCATTAGACTGGGATCTCAGG - Intergenic
925617658 2:5758935-5758957 TTTTCACAGCCCGGGTTCTCTGG - Intergenic
925993760 2:9275191-9275213 CCTCCTCAGCCTGGGATTACAGG + Intronic
926294940 2:11562373-11562395 TTTCCTCTGCCTGCATTCTCAGG - Intronic
926306054 2:11637895-11637917 TTACCTGAACCTGGGATCTCAGG + Exonic
926813321 2:16775757-16775779 TTTCCTCATCCTGGGACCTCAGG - Intergenic
927202774 2:20588855-20588877 CTGCCTCAGCCTGGGACCTTGGG - Intronic
927211758 2:20643116-20643138 TTTACTCCCCATGGGATCTCAGG - Intronic
927240269 2:20914821-20914843 TTTGCTCAGGCAGTGATCTCTGG - Intergenic
927548441 2:23975749-23975771 CTACCTCAGCCTGGGATTACAGG + Intronic
927796034 2:26049654-26049676 TTGCCTCAGTCTGGGATTACAGG + Intronic
929238729 2:39631778-39631800 TCTCCTCAGCCTGATATCTTAGG - Intergenic
929450275 2:42032377-42032399 TTTCTTGGGCCTGGGAGCTCTGG - Intergenic
929789465 2:45012746-45012768 TTCCATCAGCCTGAGATCACTGG - Intergenic
929981044 2:46680765-46680787 TTGCCTCAGCCTGGGATTATAGG + Intergenic
931838235 2:66122589-66122611 ATTCCTCTGCCTGAGATATCTGG + Intergenic
931975531 2:67639948-67639970 CTTCCTCAGCCTGGCCTCCCAGG + Intergenic
932040506 2:68294406-68294428 CTGCCTCAGCCTGGGATTACAGG - Intronic
932886582 2:75554419-75554441 TCTCCCCAGCCTGGCATCTGAGG - Intronic
936685903 2:114826383-114826405 TTTCCTCACCCAGGGACCTATGG + Intronic
936766959 2:115862735-115862757 TTGCCACAGACTTGGATCTCTGG + Intergenic
936845943 2:116833277-116833299 TTCCCTCTGACTGGGATCTGGGG + Intergenic
937005228 2:118506010-118506032 CTCCCTCAGCCTGGGATTACAGG + Intergenic
937373527 2:121319392-121319414 TTGTCTGAGCCTGGGGTCTCTGG + Intergenic
938134044 2:128739206-128739228 GTCCCTCAGCCTGAGATCTCAGG - Intergenic
940017993 2:149126697-149126719 TTTCTTCTGCCTGGGATATAGGG + Intronic
940314637 2:152314966-152314988 TTGCCTCAGCCTGGGATTACAGG + Intergenic
944207119 2:197168653-197168675 ATTGCTCAGGCTGGGAACTCAGG + Intronic
948281362 2:236750093-236750115 TTTGCTCAGCGTGGGGACTCAGG - Intergenic
948519147 2:238524549-238524571 ATTCCTTTGCTTGGGATCTCAGG - Intergenic
1169263370 20:4153410-4153432 GTTCCTCAGCCTGGCATCCCAGG - Intronic
1170364017 20:15580568-15580590 TTTCCTCAGGCTGAGAACACTGG + Intronic
1172238372 20:33394273-33394295 CTGCCTCAGCCTGGGATTACAGG + Intronic
1172408823 20:34707883-34707905 CTGCCTCAGCCTGGGATTACAGG + Intronic
1173545971 20:43898236-43898258 CTGCCTCAGCCTGGGATTACAGG - Intergenic
1174077450 20:47948090-47948112 CTGCCTCAGACTGGGACCTCTGG - Intergenic
1175912785 20:62412726-62412748 TGGCCTCCGCCTGGGAGCTCAGG + Exonic
1175941353 20:62538925-62538947 TCCCCTCAGCCCGGCATCTCAGG - Intergenic
1175985886 20:62764006-62764028 TTTCCTGTGCCTGGGGGCTCAGG + Intergenic
1176703978 21:10095725-10095747 CTTCCTCAGCCTGGGATTACAGG + Intergenic
1177707583 21:24727895-24727917 TTACTTCTGCCTGGGAACTCTGG - Intergenic
1178361961 21:31956106-31956128 CTTCCCCAGGCTGGGACCTCAGG - Intronic
1180090238 21:45530598-45530620 TTGCCTCTCCCTGGGACCTCGGG - Intronic
1181472561 22:23149878-23149900 TTTCCTCAGCCTTGAGGCTCTGG - Intronic
1181581644 22:23832073-23832095 TCTCCTCAGCCTGGGGTCTCAGG - Intronic
1182219138 22:28743957-28743979 TTTCTTCAGCCAGAGGTCTCAGG + Exonic
1182443917 22:30379526-30379548 GGTCCTCAGCCTGGGCTCCCAGG - Exonic
1184944518 22:47793788-47793810 TTTCCGCAGGCTGAGATCTGTGG + Intergenic
1184986427 22:48139301-48139323 TCTCCTCTGCCTGGGGTCTCAGG + Intergenic
949518508 3:4828521-4828543 TTTCCTCAGCCTGGCAGCCTAGG + Intronic
950213509 3:11141069-11141091 TCTCCCCATCCTGGGATCCCAGG + Intronic
951806468 3:26649760-26649782 ATTCCTTAGCCTGGCATCTAAGG + Intronic
951983830 3:28595696-28595718 GTTCTGGAGCCTGGGATCTCAGG - Intergenic
952881293 3:37987548-37987570 TATCCTGGGCCTGGGATCACAGG + Intergenic
953200293 3:40772266-40772288 CTGCCTCAGCCTGGGATTACAGG - Intergenic
954635045 3:52066610-52066632 TCTCCACAGCCCGGGATCTGGGG - Intergenic
954640563 3:52095402-52095424 TTTCCCCAGCTTGGGATCGTGGG - Intronic
956172510 3:66443866-66443888 TTTTCCCAGCCTGGGAACTGTGG - Intronic
956312429 3:67895953-67895975 TTGCCCCAGCTTGGGATCTGAGG + Intergenic
959579236 3:107967236-107967258 TGCCCTCAACCTGGGACCTCTGG - Intergenic
961240731 3:125408892-125408914 TCTCCTGAGCCTGGGATATTGGG - Intergenic
961452111 3:127006898-127006920 CTGCCTCAGCCTGGGTCCTCTGG - Intronic
962128851 3:132651205-132651227 TTCCCTCAGCTTTGAATCTCAGG + Intronic
962351945 3:134662922-134662944 ATTCCTGACCCTGGGCTCTCTGG + Intronic
962856606 3:139351852-139351874 ATTCCTCAGCCTAGCATCTGAGG - Intronic
963060602 3:141221912-141221934 TTTGCACAGCCTGGCCTCTCAGG - Intergenic
966428053 3:179801946-179801968 GTTCCTCATCCTGCAATCTCTGG - Exonic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
967726906 3:192870596-192870618 CTGCCTCAGCCTGGGATTACAGG - Intronic
967828915 3:193902206-193902228 TTTCCTCACCCTGGGCTGTACGG - Intergenic
968398274 4:263780-263802 TTTCCTGAGTTTGGCATCTCAGG + Intergenic
969476303 4:7424350-7424372 TGTCTCCAGCCTGGGCTCTCTGG + Intronic
971237277 4:24854136-24854158 TTTCCTGAACCTGGGATTCCTGG + Intronic
972588140 4:40457552-40457574 GTGCCTCAGCCTGGGATTACAGG + Intronic
974877116 4:67714434-67714456 TTCCCTGAGCCTGGGAGCACAGG + Intergenic
975086466 4:70346225-70346247 TTTCCTCAGCTTGTGAAATCTGG - Intergenic
975666358 4:76738987-76739009 TATCCACACCCTGGCATCTCTGG + Exonic
977089648 4:92654168-92654190 TTTCCTTAACCTTGGATTTCTGG - Intronic
977684618 4:99834333-99834355 TTTCTTCACCCTGGGCCCTCAGG - Intronic
979699190 4:123648566-123648588 CTGCCTCAGCCTGGGATTACAGG - Intergenic
980376195 4:131952066-131952088 CTTCCTCAGCCTGGGATTACAGG + Intergenic
981081228 4:140641575-140641597 TGACCACAGCCTGGGGTCTCTGG + Intronic
982136719 4:152279587-152279609 TGTCCTCAGCCTGTGCTCTCAGG - Intergenic
983394304 4:167173946-167173968 ATTCCTCTGCCTGGAATGTCTGG - Intronic
985260820 4:188113205-188113227 TTTCCTCAGCCTGTGAACTTTGG - Intergenic
986172549 5:5326183-5326205 TTCACTCAGCCTGGAATTTCTGG - Intergenic
987210133 5:15673066-15673088 CTTCCTCGGCCTGGGATTACAGG - Intronic
990533465 5:56696940-56696962 TGTCCTCAGCAGGGGCTCTCAGG + Intergenic
990977351 5:61571489-61571511 TTCCCTCTGCCTGGGTTTTCAGG + Intergenic
992091581 5:73322540-73322562 CCTGCTCAGCCTGGGGTCTCGGG + Intergenic
992660037 5:78950314-78950336 TTTCCTCAGCCCAGCTTCTCTGG - Intronic
996308350 5:122076906-122076928 TTTCCTCCGCCGCGCATCTCAGG + Exonic
996709307 5:126528324-126528346 CTGCCTCAGCCTGGGATTACAGG - Intergenic
996949372 5:129107750-129107772 TTTCCTCAGACTTGAATTTCTGG + Intronic
998997519 5:147881770-147881792 TTTGCACATCCTGGAATCTCAGG + Intronic
1002659434 5:180781390-180781412 TTTCCACCTCCTGGGGTCTCTGG - Intergenic
1006138189 6:31909700-31909722 TCCTCTCAGCCTGGGATCACAGG + Intronic
1007633343 6:43284540-43284562 TTTCCTAAGCCTGGCCTCTCCGG - Intronic
1007662862 6:43497074-43497096 GTTCCTCAGCCTTGGCACTCTGG + Intronic
1007796732 6:44354897-44354919 TTGCTTCAGCCTGGGAGGTCAGG - Intronic
1008676977 6:53829520-53829542 TTTCCACAGCCTGGTATTCCAGG - Intronic
1012462616 6:99480549-99480571 CTGCCTCAGCCTGGGATTACAGG - Intronic
1014499786 6:122171897-122171919 TTTCCTCTGCCTGTGTTTTCTGG - Intergenic
1014592886 6:123294457-123294479 TTTCCACAGCCTGGGGTCGGGGG + Intronic
1014863991 6:126505798-126505820 TTTCCCCACCCTGGGATCTTAGG - Intergenic
1015416008 6:132949325-132949347 TGTCCTCAGCATGGTTTCTCAGG + Intergenic
1016386144 6:143532685-143532707 ATTCCTCAGCATGGCATATCAGG - Intergenic
1018841602 6:167521491-167521513 TCTTCTGAGCCTGTGATCTCAGG - Intergenic
1018841623 6:167521594-167521616 TTTCCTGAGCCTGTGATCTCTGG - Intergenic
1018972287 6:168537941-168537963 CTTCCTCACCCTGGAATCTGGGG + Intronic
1020312104 7:6876096-6876118 TTTCTTCTCCCTGGGATATCGGG - Intergenic
1024083140 7:45872666-45872688 TCTCATCAGCCTGGGCTCTGAGG - Intergenic
1024266872 7:47613483-47613505 TCTCCCCAGGCTGGGATCTGGGG + Intergenic
1024472573 7:49778079-49778101 TTTCCTTTACCTGTGATCTCAGG - Intronic
1024865094 7:53896288-53896310 GTTCTTCAGCCTTGGAACTCTGG + Intergenic
1028154887 7:87418690-87418712 TTTCCTCAGCATTGGAGCTTTGG - Intronic
1028872554 7:95785162-95785184 CTGCCTCAGCCTGGGATTACAGG - Intronic
1029617514 7:101668379-101668401 TTTCCTTCACCTGGAATCTCAGG - Intergenic
1031501705 7:122526027-122526049 TGTCCTCAGCCTGGGGTATTGGG - Intronic
1032949913 7:136895880-136895902 TCTCCTCTGCCTGGGAGCTTGGG + Intronic
1033206654 7:139429056-139429078 TCACCTCAGCCTGGGATTACAGG - Intergenic
1034680949 7:152926753-152926775 CTCCCTCAGCCTGGGATTACAGG - Intergenic
1035196180 7:157222668-157222690 TCGCCTCAGCCTGGGATTACAGG + Intronic
1035984766 8:4415184-4415206 GATCCTGAGCCTGGGTTCTCTGG - Intronic
1037345604 8:17897511-17897533 TTTTTTCAGCCAGTGATCTCAGG - Intronic
1038543831 8:28410965-28410987 CTGCCTCAGCCTGGGATTACAGG - Intronic
1039024603 8:33244056-33244078 TTTTCTCAGCCAGGTATCTGTGG + Intergenic
1039034839 8:33348703-33348725 TTTCCTCTGCCAGGAATATCAGG - Intergenic
1040563222 8:48542987-48543009 TTTCTCCTTCCTGGGATCTCAGG - Intergenic
1043482596 8:80668389-80668411 GCGCCTCAGCCTGGGAGCTCAGG - Intronic
1043549176 8:81349515-81349537 TTTCCACAGTCAGAGATCTCAGG - Intergenic
1044306959 8:90649207-90649229 TTTCCTGGGCATGGGACCTCTGG + Intronic
1044738664 8:95303926-95303948 TTTCCTCAGCGCAGGCTCTCTGG + Intergenic
1047038724 8:120969334-120969356 TTTCCCCTGCCTGGGATTACAGG + Intergenic
1048161418 8:132025033-132025055 TTCCCTTAGCCTGGCAGCTCAGG - Intronic
1049960106 9:730112-730134 CTTGCTCAGGCTGGGATGTCTGG - Exonic
1051073939 9:13207492-13207514 TTACCTCAGCCTGGACTCTCTGG + Intronic
1052672348 9:31574238-31574260 GTTCCTCAGCCTGGAATGACTGG - Intergenic
1053360232 9:37481073-37481095 TTGCTTCAGGCTGGGAGCTCAGG - Intergenic
1053641247 9:40082746-40082768 CTTCCTCAGCCTGGGATTACAGG + Intergenic
1053764892 9:41382717-41382739 CTTCCTCAGCCTGGGATTACAGG - Intergenic
1054321987 9:63679038-63679060 CTTCCTCAGCCTGGGATTACAGG + Intergenic
1054543504 9:66293874-66293896 CTTCCTCAGCCTGGGATTACAGG - Intergenic
1055422738 9:76161238-76161260 ATTCCTCAGCATAGGATCGCTGG + Intronic
1055613299 9:78044949-78044971 TGTCCTCACCCTGGAATCCCAGG + Intergenic
1055690568 9:78826110-78826132 AATCCTCAGCCTGGGATTACAGG - Intergenic
1055739939 9:79376909-79376931 CTGCCTCAGCCTGGGACCACAGG - Intergenic
1056744649 9:89289699-89289721 GTTTCTCAGACTGGGATCCCTGG - Intergenic
1056803317 9:89709068-89709090 TCCTCTCGGCCTGGGATCTCAGG + Intergenic
1057187108 9:93063103-93063125 TTTCCTGAGCCTGGGAGGCCAGG - Intronic
1057207408 9:93181968-93181990 TTTCCTCTGCAAGGAATCTCAGG - Intergenic
1059923144 9:119179877-119179899 TTGCCTCAGCCAGGAATTTCTGG + Intronic
1060238736 9:121885304-121885326 CTTCCTCAGCCTGGTTTCTGGGG + Intronic
1061084885 9:128393015-128393037 TGCCCCCAGCCTGGGATCTCCGG + Intergenic
1061935817 9:133857093-133857115 TGTCCTCAGGCTGGGAGGTCAGG - Intronic
1062025044 9:134336304-134336326 TCTCCTGAGGCTGGGATCACAGG + Intronic
1202789015 9_KI270719v1_random:65820-65842 CTTCCTCAGCCTGGGATTACAGG + Intergenic
1185500220 X:591224-591246 TTTCTGCAGCCAGGGGTCTCGGG - Intergenic
1186121571 X:6368672-6368694 TTTCCTGAGCCTTACATCTCAGG - Intergenic
1193194304 X:78612051-78612073 TTACCTGAGCCTGGGAAGTCGGG - Intergenic
1196455776 X:115890741-115890763 TTTACTCTGCTTGGGTTCTCGGG - Intergenic
1197717262 X:129718608-129718630 ATTCCTCAGCCAGGCCTCTCAGG - Intergenic
1197838755 X:130723027-130723049 CATCCTCACCTTGGGATCTCTGG - Intronic
1201354246 Y:13081472-13081494 CTGCCTCAGCCTGGGATTACAGG + Intergenic
1201783244 Y:17745565-17745587 TGTCCTGAGCCTCAGATCTCTGG + Intergenic
1201818309 Y:18160422-18160444 TGTCCTGAGCCTCAGATCTCTGG - Intergenic