ID: 1084955728

View in Genome Browser
Species Human (GRCh38)
Location 11:72690365-72690387
Sequence CTGCAGAAGTGGGTCTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 235}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084955728 Original CRISPR CTGCAGAAGTGGGTCTTGGG AGG Intronic
900550229 1:3250882-3250904 CTGCAGAAGTGGGGCTGGAGTGG + Intronic
903578681 1:24354783-24354805 CTGCAGACAAGGGTCTTGGGAGG - Intronic
903678615 1:25082551-25082573 CTGCAGGGGCGGGTGTTGGGGGG - Intergenic
903818786 1:26084992-26085014 ATGCAGAAGAGGGTCTTGAGGGG - Intergenic
903821149 1:26103462-26103484 CTGCAGAAATGGGGCTGGGGTGG + Intergenic
904400501 1:30253640-30253662 ATGCAGGAGGAGGTCTTGGGAGG + Intergenic
904708398 1:32409525-32409547 CTGCAGAAGTGGCTGCTGGCAGG + Intergenic
906071116 1:43017147-43017169 CTGCAGAGATGGCTCTTTGGAGG - Intergenic
906196322 1:43932736-43932758 CTGCAAAAGTGTGCCTTTGGCGG - Intergenic
906717275 1:47979583-47979605 CAGCAGAAGTGGGGGATGGGAGG - Intronic
907914351 1:58854939-58854961 CTGCAGGAGTAGGTATGGGGTGG + Intergenic
910149617 1:84126319-84126341 CAGTAGAAGTGGCTCTTGGCAGG + Intronic
912388892 1:109287955-109287977 CTGCAGAGCTGTGTCTTGTGGGG + Intergenic
914384765 1:147157809-147157831 CTGCAGAAGGTGGCCTTGGATGG + Exonic
914660347 1:149784594-149784616 CTGCAGATCTAGGTTTTGGGTGG - Intronic
915914395 1:159932318-159932340 CTGCAGAGGTGGTGCTCGGGAGG - Intronic
916397499 1:164407134-164407156 CTGCAGAATTTGGTCTTCTGAGG + Intergenic
916472542 1:165138159-165138181 CAGCAGAACAGGGGCTTGGGTGG + Intergenic
917725115 1:177820829-177820851 CTGGAGAAGTGGGTCTGAGCTGG - Intergenic
917844082 1:179006029-179006051 AGGCAGAAGTGGGTTTTGCGGGG + Intergenic
919739146 1:200972093-200972115 TTACAGGAGTGGGCCTTGGGGGG - Intronic
921995521 1:221413805-221413827 ATGCAAAAGTGTGTGTTGGGAGG + Intergenic
922353095 1:224750902-224750924 CAGCAGTAGTTGGTGTTGGGGGG + Intergenic
923259254 1:232251233-232251255 CTGAAGAAATGGGACTTGGAAGG - Intergenic
1063048717 10:2421214-2421236 CAGCAGAAGTGGGTAATTGGGGG - Intergenic
1063377587 10:5563371-5563393 CTGCAGAAGTGGGTCTGTGAGGG - Intergenic
1063863777 10:10341896-10341918 CTGCAGAAGTAGGTTTAGAGGGG + Intergenic
1064965365 10:21010548-21010570 CTTCAAAAGTTGGTCTTGGCTGG - Intronic
1065723176 10:28645256-28645278 CTACAGAATCAGGTCTTGGGAGG + Intergenic
1067809073 10:49412981-49413003 AGGCAGAAGTGGTTCTTGGTTGG - Intergenic
1068673965 10:59750881-59750903 ATGCAGAAATGGGACTAGGGGGG + Intergenic
1070519351 10:77238311-77238333 CAACAGCAGTGGGTCTCGGGTGG + Intronic
1071275194 10:84047975-84047997 CCGATGCAGTGGGTCTTGGGCGG + Intergenic
1073293257 10:102423783-102423805 CTGCAGAAGTGAGTCTGGGCTGG - Exonic
1074611389 10:115025438-115025460 CTGCAGGGGTGGGGGTTGGGCGG - Intergenic
1075337793 10:121621165-121621187 CTGCAAAAGTGAGTCCTGTGTGG + Intergenic
1075730310 10:124631826-124631848 CTGCAGAGGCGGGTTTTGGTGGG - Intronic
1080787825 11:35492123-35492145 CTGCCGAAATGGCTCATGGGGGG - Exonic
1081198560 11:40190649-40190671 CTGAAGAAATGGGGCTGGGGGGG + Intronic
1082829097 11:57602195-57602217 CTGCAGAGGAGGGTCCTGAGAGG + Intronic
1084270976 11:68029012-68029034 GTTCAAAAGTGGGACTTGGGAGG - Exonic
1084937561 11:72595275-72595297 GTGCAGAGGTGGGGATTGGGAGG - Intronic
1084955728 11:72690365-72690387 CTGCAGAAGTGGGTCTTGGGAGG + Intronic
1089342233 11:117765907-117765929 CTGAAGAAGTGGGGCTTGCTTGG - Intronic
1089625063 11:119745898-119745920 CTGTAGGAGTGGGCATTGGGAGG + Intergenic
1090234512 11:125137583-125137605 CTGCAGGAGTTGGACTAGGGAGG - Intergenic
1090859506 11:130640427-130640449 CTGGAGAAGTGGGGCTTGTCTGG + Intergenic
1091200572 11:133777297-133777319 CTGTAGAATTGGGACTAGGGTGG - Intergenic
1091493214 12:950240-950262 ATGGAGAAGTGCGGCTTGGGGGG + Intronic
1091548111 12:1518072-1518094 CTGCAGAAGTTAGTCCTGGGTGG + Intergenic
1091985989 12:4910496-4910518 ATGCAGAAGCGGGGGTTGGGGGG + Intronic
1092382915 12:8012530-8012552 CTGCAGTAGGGGGAGTTGGGTGG + Intergenic
1094161722 12:27397925-27397947 CCGCAGTAGTGGGTGCTGGGGGG - Intronic
1095948433 12:47767072-47767094 CTGCAGGAGGGGGGCCTGGGTGG + Intronic
1102177425 12:110886527-110886549 CTCCAGAAATGGGTCAGGGGAGG + Intronic
1102270143 12:111526879-111526901 ATGAAGAAGTGGGTTCTGGGAGG - Intronic
1104046628 12:125167849-125167871 CTGCAGAAGTGGCCACTGGGTGG + Intergenic
1104119865 12:125788991-125789013 CTCCAGAGGAGGGTCTTGGGAGG + Intergenic
1104545967 12:129713162-129713184 CTGAATCAGTGGGTCTGGGGAGG - Intronic
1104967185 12:132513615-132513637 CTGCAGAAGGGGTTATGGGGAGG + Intronic
1106155313 13:27149615-27149637 CTGCAGATGTGGGGGGTGGGAGG + Intronic
1108179895 13:47830231-47830253 TTTCAGAAGTGAGTCCTGGGAGG - Intergenic
1110727971 13:78848176-78848198 CTGATGCAGTGGGTCTTGCGTGG - Intergenic
1112338964 13:98537145-98537167 CTTCAGAGGTAGGTCTTGAGGGG - Intronic
1113756906 13:112818727-112818749 CTGATGCAGTGGGTCTAGGGAGG - Intronic
1115078121 14:29415635-29415657 CTGCAGAAGTGGGTGGTGGATGG + Intergenic
1115279891 14:31650113-31650135 CTGAAAAAGTGAATCTTGGGAGG - Intronic
1118418937 14:65577266-65577288 GTGCTGAAGTGGCTCTTAGGTGG + Intronic
1118877655 14:69798246-69798268 CTGCAGAGGTGGGACAAGGGAGG + Intergenic
1119566217 14:75631360-75631382 CTGCTGCAGTAGGTCTGGGGTGG + Intronic
1120302139 14:82721361-82721383 CTGCAGTGGTGGGGCTTGGGAGG - Intergenic
1123467917 15:20529862-20529884 GTGCAGAACTGGGTCTGAGGTGG - Intergenic
1123650196 15:22471180-22471202 GTGCAGAACTGGGTCTGAGGTGG + Intergenic
1123728231 15:23125071-23125093 GTGCAGAACTGGGTCTGAGGTGG - Intergenic
1123740602 15:23280022-23280044 GTGCAGAACTGGGTCTGAGGTGG + Intergenic
1123746396 15:23322536-23322558 GTGCAGAACTGGGTCTGAGGTGG - Intergenic
1123762748 15:23445295-23445317 CTGAGGATGTGGGTCTTGGCTGG - Exonic
1124186239 15:27531870-27531892 CTGCAGGAGGAGGGCTTGGGAGG + Intronic
1124278663 15:28345853-28345875 GTGCAGAACTGGGTCTGAGGTGG - Intergenic
1124304037 15:28565755-28565777 GTGCAGAACTGGGTCTGAGGTGG + Intergenic
1126110773 15:45173561-45173583 CAGCAGCGGTGGGTCCTGGGGGG - Exonic
1127281545 15:57497520-57497542 CTGCAGACAAGGGTCTTGAGTGG + Intronic
1128590119 15:68888228-68888250 CTGCATTTGTTGGTCTTGGGTGG + Intronic
1132084848 15:98899757-98899779 CTGCTCGAGTAGGTCTTGGGTGG + Intronic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1132876898 16:2143993-2144015 CTCCAGAGGAGGGTCTTGGGAGG + Intronic
1134001888 16:10789301-10789323 CTACAGAACTGTCTCTTGGGGGG - Intronic
1134387141 16:13784008-13784030 CTGGAGAAGAGGGTCTTCGCTGG - Intergenic
1134621515 16:15692960-15692982 CAGATCAAGTGGGTCTTGGGTGG + Intronic
1137710277 16:50561974-50561996 CAGCAGAGGTGAGACTTGGGTGG + Intronic
1137927403 16:52553642-52553664 CTTCAGAACTGGTGCTTGGGTGG + Intergenic
1138008604 16:53358566-53358588 GTGCAGAACTGGGTCTGAGGTGG - Intergenic
1140288620 16:73628892-73628914 CTGCAGGACTGGGTCCTGCGTGG - Intergenic
1140389523 16:74573006-74573028 CTGCAGAATTGGTTGTTGGTGGG + Intronic
1141025232 16:80540815-80540837 CTGGAGCAGTGGGTCCCGGGAGG - Intronic
1141774005 16:86110275-86110297 GTGCAGAAGAGGCTCATGGGAGG + Intergenic
1142172963 16:88632396-88632418 CAGCAGCGGTGGGTCCTGGGGGG - Intergenic
1142224982 16:88872842-88872864 CTCAAGGAGTGGGTGTTGGGAGG - Intergenic
1142401728 16:89862342-89862364 CTTAAGAAGTGGGCCTTGGCCGG - Intronic
1143501570 17:7342429-7342451 CTGCTGCAGTGTGTGTTGGGTGG - Exonic
1144197725 17:12911541-12911563 CTGGAATAGTGGGTCTTTGGGGG + Intronic
1144584153 17:16477811-16477833 CTGCAGAAGAGGGCATGGGGTGG + Intronic
1144844239 17:18207840-18207862 GTGGAGAAGGGGGTGTTGGGAGG + Intronic
1146469223 17:33110907-33110929 CTGCAGAGGTGGGTCAAGAGAGG - Intronic
1147644646 17:42026581-42026603 CTGGCCATGTGGGTCTTGGGTGG + Intronic
1147746440 17:42697643-42697665 GTTCGGAAGTGGGTCTTGAGGGG - Exonic
1147760740 17:42796026-42796048 CGGCAGAAGTGAGTCTCGGGAGG + Exonic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1149456944 17:56795577-56795599 CTGACTCAGTGGGTCTTGGGTGG + Intronic
1150138180 17:62707174-62707196 CAGGAGATGTGGGTTTTGGGAGG - Intronic
1150427150 17:65086027-65086049 CTGCCGTGGAGGGTCTTGGGGGG + Intergenic
1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG + Intergenic
1151368103 17:73630259-73630281 CTGAAGCAGTGGGTCTGGGAGGG - Intronic
1151578386 17:74963993-74964015 CTGCAGAGGAGGGTCAGGGGGGG + Intronic
1151833504 17:76569302-76569324 CTGTAGAAGGAGGACTTGGGGGG + Intronic
1152218842 17:79049841-79049863 AGGCAGGAGTGGGCCTTGGGTGG - Intergenic
1152772499 17:82178964-82178986 CTGCAGAGGTGGGGCTGGGCAGG - Intronic
1156700119 18:39815421-39815443 CTGCTGAAGTGGCTCATGAGGGG + Intergenic
1157692506 18:49695092-49695114 CTGCAGAGATGGGTGTGGGGTGG + Intergenic
1157739853 18:50082875-50082897 CTGGAGAATTGGTTCTTGGGTGG - Intronic
1158905119 18:62004248-62004270 CTGCAAAAGTGGGACTGGGAAGG - Intergenic
1160146224 18:76367314-76367336 CAGCAGAAGCAGGTCTTTGGAGG - Intronic
1163035636 19:14567369-14567391 GTGCAGAGCTGGGCCTTGGGTGG - Intronic
1163286513 19:16351820-16351842 CTGGAGATGAGGGTGTTGGGAGG - Intergenic
1163468245 19:17482079-17482101 CAGGAGAGCTGGGTCTTGGGCGG + Intronic
1163784750 19:19269360-19269382 CTTCAGGGGTAGGTCTTGGGAGG - Intronic
1164136449 19:22421343-22421365 CTGCAGAAATGGGGTGTGGGGGG + Intronic
1164155965 19:22597393-22597415 CTGGAGATGTGAGTCTTGGCTGG + Intergenic
1164723843 19:30452210-30452232 CTGCAGAAGTGGCCCCTGGCAGG - Intronic
1167126041 19:47549370-47549392 GTCCAGAAGTGGGTTTTGAGGGG + Exonic
1167414823 19:49364514-49364536 CTGGAGAGGGGCGTCTTGGGTGG + Intronic
1167677268 19:50895048-50895070 CTCCAGAAGTGAGTGCTGGGTGG - Intergenic
925373807 2:3367184-3367206 CTGCAAGGGTGCGTCTTGGGTGG + Intronic
925389295 2:3484543-3484565 CTGCAGAAGCTGGTCCTTGGGGG - Intronic
925437623 2:3854177-3854199 ATGCAGGAGTGGGCTTTGGGTGG + Intergenic
926151496 2:10428043-10428065 CTGAAGAAGTGGGGGTTGGTTGG + Intergenic
926209128 2:10856122-10856144 CTGCAGGTGTGTGTGTTGGGGGG + Intergenic
930148142 2:48028800-48028822 CTGCTTCAGTAGGTCTTGGGTGG + Intergenic
933167127 2:79088443-79088465 CTTCTGAAGTAGGTCTTGAGAGG - Intergenic
933692537 2:85190426-85190448 CTGCAGAGGCCAGTCTTGGGTGG + Intronic
935480492 2:103582043-103582065 GTACAGAAGTGGATCTTTGGAGG + Intergenic
937046438 2:118854543-118854565 CTGCTGAGGTGGGTCTTGGTGGG - Intergenic
937123648 2:119458812-119458834 CTGAGGCAGTGGGTCTGGGGTGG - Intronic
937283208 2:120734905-120734927 CACCCGAAGAGGGTCTTGGGGGG - Intergenic
938196638 2:129334438-129334460 CTGGAGAAGTGGGCCTGGGCGGG + Intergenic
938546488 2:132337490-132337512 TTGCAGAATTTGGTCTTGGCGGG + Intergenic
938662576 2:133502894-133502916 CTGCAGAGGAGGGACTTGGATGG + Intronic
939280275 2:140055139-140055161 CTGCAGGAGTGGGGGTAGGGTGG - Intergenic
940803670 2:158160329-158160351 CAGCAGCAGTGGGTCTTCAGTGG - Intergenic
941156098 2:161980240-161980262 GTGCAGGGGTGGGTGTTGGGGGG - Intronic
941362024 2:164563126-164563148 GTGCAGAAGAGGGTCGTGGAAGG - Intronic
942206024 2:173620597-173620619 CTGGAGAGGTGGGGGTTGGGGGG + Intergenic
944171336 2:196782114-196782136 ATTAAGAGGTGGGTCTTGGGAGG + Intronic
945817547 2:214624303-214624325 CTGCTTCAGTGGGTCTGGGGTGG + Intergenic
948106691 2:235420151-235420173 CTGGAGAGGTGGGTGTTGGGTGG - Intergenic
948649006 2:239427195-239427217 ATGGAGAAGTGGGTATTGGTGGG - Intergenic
1169285758 20:4305841-4305863 ATGCAGATGTGGGTTTTGGCTGG - Intergenic
1169526044 20:6426764-6426786 CTGCAGAAGTTGGGAGTGGGGGG + Intergenic
1169787595 20:9376753-9376775 CTGCAGAATTGGGAGATGGGTGG + Intronic
1172284006 20:33728203-33728225 CGGCAGAAATGGGCCTTGAGGGG + Intergenic
1173233594 20:41222564-41222586 CTACAGAAATGGGGGTTGGGGGG + Intronic
1174230085 20:49039416-49039438 CAGTAGAAGTGGGTCTTCAGAGG - Intergenic
1174376138 20:50127983-50128005 ATGCAGAAGTAGGTCTCGTGGGG + Exonic
1174735195 20:52959601-52959623 CTGGAGAAGAGGGGCTTGGACGG - Intergenic
1174798741 20:53544593-53544615 CTCCAGCAGTGGTTCTTGAGTGG - Intergenic
1174861278 20:54093767-54093789 CTGCAGAACTGGCTGTGGGGAGG + Intergenic
1175666811 20:60868397-60868419 CTGCAGGAGTGAGCCTTGGGGGG + Intergenic
1175806815 20:61834148-61834170 TGGCAGAAGTGGGTCTCGGCAGG + Intronic
1175889176 20:62308537-62308559 CTGCAGAAGTGGGGCTGAGGGGG + Intronic
1175902090 20:62363938-62363960 CTGCAGAGCTGCATCTTGGGTGG - Intronic
1177663106 21:24113551-24113573 CTCCAGAAGAGGGAGTTGGGGGG + Intergenic
1178822082 21:35984458-35984480 ATGCAGAAGTGGGGGTGGGGTGG + Intronic
1178898652 21:36581790-36581812 CTGCAGTAGTGAGTCCTGGGGGG - Intergenic
1179486995 21:41716815-41716837 ATGCTGAAATGGGTCTTGCGGGG - Intergenic
1179749354 21:43459508-43459530 ATGCAGACGTGTGTCCTGGGAGG + Intergenic
1180225084 21:46387427-46387449 GTGCAGAGGTGGGTGGTGGGCGG + Intronic
1181174678 22:21028866-21028888 CTTCAGGAGTGGGCCTTGGCTGG - Exonic
1181513578 22:23399569-23399591 GTGCAGAGGTGGGTGCTGGGAGG - Intergenic
1182928224 22:34147614-34147636 GTGCAGAAGTGGGTGCAGGGAGG + Intergenic
1183111153 22:35649521-35649543 CTGCAGAAGTTGGTTTTGTGGGG + Intronic
1183521353 22:38297825-38297847 CTGAGGAAGTGTTTCTTGGGAGG - Intronic
1184424478 22:44401337-44401359 CTGCAGAACTGGGCCATGTGGGG - Intergenic
949541628 3:5036922-5036944 ATCCAGAAGTGGGGGTTGGGTGG + Intergenic
953604345 3:44401030-44401052 CTGAAGAAGTGTGTCTTTGGGGG + Intronic
954466662 3:50659123-50659145 CTCCACAACTGGGTCTGGGGAGG + Intergenic
954755862 3:52839367-52839389 CTGCAGCAGTGGGGGCTGGGAGG + Exonic
956475686 3:69617717-69617739 CTGCTACAGTAGGTCTTGGGTGG - Intergenic
960251079 3:115454262-115454284 CTGCATAAGTGGATAGTGGGTGG - Intergenic
962200424 3:133396715-133396737 ATGCAGATGTGGGTGTTGGAGGG - Exonic
966330379 3:178805584-178805606 CTGCTTTAGAGGGTCTTGGGTGG - Intronic
969417835 4:7072683-7072705 CTGCAGAGGTGGGTGTGAGGTGG + Intergenic
969875356 4:10132125-10132147 CTCCAGAATGGGGTCTTGGGGGG + Intergenic
970383093 4:15527904-15527926 CACCAGAAGTGGGTGTTAGGTGG + Intronic
970847082 4:20553376-20553398 CTGCAGCAGGGGTTCTTTGGAGG + Intronic
971501099 4:27318638-27318660 CTGCAGAAGTGAGGCTGGAGAGG + Intergenic
972339587 4:38139953-38139975 CTGCAGAAGTGGGCCTGGGCAGG + Intergenic
973078049 4:45955479-45955501 CTGTAGAATTGGGTGTTGGTGGG - Intergenic
973084593 4:46041101-46041123 CTGCAGAACAGGATCTTGGAGGG - Exonic
973375677 4:49285211-49285233 ATGCAGGAGCGGGTCTTGTGCGG + Intergenic
973381734 4:49325030-49325052 ATGCAGGAGCGGGTCTTGTGCGG - Intergenic
973893288 4:55388887-55388909 CTGCTCAACTGGGACTTGGGAGG + Intergenic
975758786 4:77597722-77597744 GTGCACAAATGGCTCTTGGGTGG + Intronic
979679475 4:123443963-123443985 CAGCAGAAGTAGCTCCTGGGAGG + Intergenic
980786699 4:137565228-137565250 CTGCAGGAGGTGGTCTTGGAAGG + Intergenic
981129032 4:141137668-141137690 CTTCAGCATTGAGTCTTGGGGGG + Intronic
986037952 5:3959258-3959280 CTGCTAAATTGGCTCTTGGGAGG + Intergenic
986100315 5:4602471-4602493 CCGCAGAAGTTGGACTTGTGTGG + Intergenic
986195271 5:5532514-5532536 CTGTAGAGGTGGGCCTGGGGAGG - Intergenic
986393381 5:7305059-7305081 CTGAGGATGTGAGTCTTGGGGGG - Intergenic
987068243 5:14310328-14310350 CTGCAGCAGTGGCCCTTTGGTGG - Intronic
992492215 5:77255986-77256008 CTGTAGAAGTGAGTTTTGGGTGG + Intronic
995184140 5:109254076-109254098 CTACAGCAGTGGGTGGTGGGAGG + Intergenic
995656848 5:114435247-114435269 CTTCAGAGGTGGTTTTTGGGTGG + Intronic
997750711 5:136342610-136342632 CTGCAGAAGTTGCTCTATGGTGG + Intronic
1000465476 5:161570227-161570249 CTGCAAAAATGGGGCTGGGGTGG + Intronic
1003305636 6:4924987-4925009 CTGTAGAAGTGGGCCTTGGAAGG + Intronic
1004843721 6:19615080-19615102 CAGCAGAAGTGGGTGTGTGGAGG - Intergenic
1007503411 6:42315867-42315889 CTGAAGAGGAGGGACTTGGGTGG + Intronic
1010339694 6:74734276-74734298 CTGTAAAAGTGGGTCTTTGGAGG + Intergenic
1011087602 6:83559937-83559959 CTGCAAAAGTGAGATTTGGGGGG - Intronic
1016130067 6:140457101-140457123 CTGCAGAAGTGTTTCTTCTGAGG + Intergenic
1017594561 6:156014660-156014682 CAGCAGACCTGGGCCTTGGGAGG - Intergenic
1018083262 6:160277064-160277086 CTGCAGAACTGTCTCTTGGGTGG - Intronic
1020125608 7:5531060-5531082 CTGCAGAAGGAGCTCTTGGAGGG + Intronic
1023024883 7:36041325-36041347 CTGGAGAAGTGTGTGTAGGGAGG + Intergenic
1023371374 7:39515726-39515748 CTGAAGCAGTAGGTCTGGGGTGG - Intergenic
1024657600 7:51464929-51464951 CTGCAGAAATGGGGGTTGAGTGG + Intergenic
1024966000 7:55022305-55022327 CTCCAGAAGTGGGGCTGGGCGGG - Intronic
1026685862 7:72509597-72509619 CTGCAGAAGATGGTTCTGGGAGG - Intergenic
1028582097 7:92419279-92419301 CTGCATCAGTAGGTCTGGGGTGG - Intergenic
1029482558 7:100822192-100822214 CTTAAGAAGTGGGTCCTGAGTGG + Intronic
1030704235 7:112674752-112674774 CTGTAGCAGTGGGTGTGGGGTGG + Intergenic
1031986168 7:128166156-128166178 CTGCAGAACTTGTTCTTTGGTGG + Intergenic
1033636534 7:143217363-143217385 TTGCAGAACTGGGTTTTTGGTGG - Intergenic
1035223288 7:157419204-157419226 CTGCAGTTGTGGGACTGGGGTGG + Intergenic
1035672132 8:1426190-1426212 TTGCTGATGTGGGTATTGGGTGG - Intergenic
1035679349 8:1476774-1476796 CTGCAGAAGGGGCTGGTGGGTGG - Intergenic
1035679362 8:1476826-1476848 CTGCAGAAGGGGCTGGTGGGTGG - Intergenic
1037002964 8:13743447-13743469 CTACAAAAGTGGTTCGTGGGAGG - Intergenic
1042944888 8:74144893-74144915 CAGGTGAAGTGGGTCTTTGGTGG + Intergenic
1043226594 8:77739973-77739995 CTCTAGAAGTGGGTATTTGGTGG - Intergenic
1044743981 8:95354596-95354618 CTACCCAAGTGGGTCCTGGGTGG + Intergenic
1045959704 8:107952889-107952911 CTTCAAAAGTGGTTCTTGGTAGG - Intronic
1048973399 8:139657625-139657647 CTGCAGAAGTGGGGGATGGATGG + Intronic
1049408777 8:142463299-142463321 CTGCAGAGGGCAGTCTTGGGGGG + Intronic
1049688616 8:143949233-143949255 CTGAAGAAGGGGGCCTGGGGTGG - Intronic
1051367685 9:16332786-16332808 CTGCTGAACTGGGTCTTGTTGGG - Intergenic
1052102835 9:24471337-24471359 TCACAGAAGTGGGTCTTGGCAGG - Intergenic
1055559055 9:77504393-77504415 CTTCAGAAGAGTGTCCTGGGTGG - Intronic
1058847153 9:108972193-108972215 CTGCTGATGTGGGCCTGGGGTGG + Intronic
1061910448 9:133719576-133719598 CTGGAGAGGTGGGTCCTGAGAGG + Intronic
1061953678 9:133950464-133950486 CAGCAGAGGTGGGTCCTTGGAGG - Intronic
1062279998 9:135747582-135747604 CTGCATAAGTGTCTCTTTGGGGG - Intronic
1062612387 9:137380755-137380777 CTTCAGTAGTGGGGCTGGGGGGG + Intronic
1186066908 X:5776185-5776207 TTGGAGGAGTGGGGCTTGGGTGG + Intergenic
1188779664 X:34265997-34266019 CTTCAGAAATAGGACTTGGGAGG - Intergenic
1189848609 X:45158040-45158062 CTGCAGGAGTGGGGATTGTGGGG + Intronic
1190444927 X:50514867-50514889 CTGCAGAAATGGGGGTGGGGTGG + Intergenic
1190804934 X:53826064-53826086 CTTAAGAAGTGTGTCTTGTGTGG + Intergenic
1195401169 X:104463075-104463097 CTGAAGAAGTGGTTCTTCTGAGG + Intergenic
1195877862 X:109561254-109561276 CTGCAGAAGTGGGTGGTGGTGGG - Intergenic
1198479863 X:137031361-137031383 GTGCAGAAGTGGCTGTTGAGGGG + Exonic
1201070851 Y:10146306-10146328 CTGCACCAGTGGCTCTTGGCCGG + Intergenic