ID: 1084955874

View in Genome Browser
Species Human (GRCh38)
Location 11:72691325-72691347
Sequence CCCTGGGCATGGAAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 602
Summary {0: 1, 1: 0, 2: 7, 3: 57, 4: 537}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084955874_1084955881 -2 Left 1084955874 11:72691325-72691347 CCTCCTTCCTTCCATGCCCAGGG 0: 1
1: 0
2: 7
3: 57
4: 537
Right 1084955881 11:72691346-72691368 GGATCCACACGTCCCTTTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084955874 Original CRISPR CCCTGGGCATGGAAGGAAGG AGG (reversed) Intronic
900093537 1:930904-930926 CCCTGGGCAGTGAACGAGGGCGG - Intronic
900218801 1:1496072-1496094 CCCTGGCCATGGCTGGAAGCAGG - Exonic
900265621 1:1755717-1755739 CCCTGGGCACGGAGGGCTGGGGG + Intronic
900684672 1:3940498-3940520 CCCTGGGCAGCGAATGCAGGAGG + Intergenic
900859073 1:5212226-5212248 CCATGGGGAGGGAAGGAGGGAGG + Intergenic
900934500 1:5756580-5756602 TCCTGGGGAGGGAAGGAACGTGG + Intergenic
900967635 1:5970046-5970068 CCCTGGGCCTGGCAGGAAGGCGG - Intronic
901190339 1:7406202-7406224 TCCTGGGCATGGCAGAGAGGGGG + Intronic
901216505 1:7558307-7558329 CCCCAGGCATGGCAGGAAGAGGG + Intronic
901260449 1:7866781-7866803 CCCTGGGGATGAAATGATGGTGG - Intergenic
901423889 1:9168969-9168991 CCCTGTGGATGGAAGGAAGTAGG - Intergenic
901551336 1:9997781-9997803 CCCGGGGCCTGCACGGAAGGCGG - Intronic
901648495 1:10729161-10729183 CCCTCGGCGTTGAAGGCAGGTGG + Intronic
901843310 1:11966743-11966765 ACATGGGCATGGAGGGAGGGAGG - Intronic
902180169 1:14682128-14682150 GCCAGGGCCTGGAAGGAAGGGGG - Intronic
902205876 1:14867737-14867759 CCCTGGGCATGGAGGCATTGGGG + Intronic
902232673 1:15037539-15037561 CCCGGGGCATGGAAAGCAAGGGG + Intronic
902263344 1:15243725-15243747 CCCAGGGCAGGGAGTGAAGGGGG - Intergenic
902896941 1:19485578-19485600 GCCGGGGCGGGGAAGGAAGGTGG - Intergenic
903803283 1:25985874-25985896 CCCTTGGCATGAGAGGAAGGTGG - Intronic
903953476 1:27009974-27009996 GCCTTGGCATGGGAGAAAGGAGG - Intronic
904068308 1:27772793-27772815 CCCTGGGGATGGAAGTAGAGAGG + Intergenic
904130860 1:28274138-28274160 ACCTGGGCCCGGAAGGTAGGGGG - Exonic
904604486 1:31691341-31691363 CCCTGGCCAGGGAATGAACGGGG - Intronic
904906759 1:33902981-33903003 CCCTGTGTCTGGCAGGAAGGAGG - Intronic
905347843 1:37323489-37323511 CCCTGGCCATGGAAGGCACTTGG + Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
906204648 1:43980251-43980273 CACTGGGCATGGCAGGAAGGGGG - Intronic
906247073 1:44283886-44283908 ACCTGGGCATTCAAGGAAGGTGG - Intronic
907113804 1:51950896-51950918 CCATGGGAATGGAAGGAAACTGG + Intronic
907159149 1:52358623-52358645 CCCTGGGCAAGAAGGGAATGGGG - Intronic
907633442 1:56107523-56107545 ACCTGGTCATGAAGGGAAGGAGG + Intergenic
907685370 1:56606319-56606341 GTCTGGACATAGAAGGAAGGAGG + Intronic
908024657 1:59938145-59938167 CTCTGGACATTGAATGAAGGGGG + Intergenic
908170256 1:61497412-61497434 CACAGGGCATGAAAGGAAGCTGG + Intergenic
908450254 1:64247492-64247514 CCTTGGGCAGGGAAGGAGGGTGG + Intronic
908474328 1:64472803-64472825 CCCTAGGGATGGAGTGAAGGTGG - Intronic
909218827 1:72927929-72927951 ATCTGGGCAAGGAAGGAAGTAGG - Intergenic
909512366 1:76468875-76468897 ACATGTGAATGGAAGGAAGGAGG + Intronic
911951424 1:104177820-104177842 CCCTGTGAATGGAAGCAAGGTGG + Intergenic
912703908 1:111897954-111897976 CCGTGTTTATGGAAGGAAGGTGG - Intronic
912977854 1:114346259-114346281 CCCTGGGCCAGGAGGGAAGGGGG - Intergenic
914858164 1:151366903-151366925 CCCTGAACAGGGAAGGAAGCAGG + Exonic
915444616 1:155967616-155967638 CCCTGGGCCTGGAAGGGAGAAGG - Intronic
915448877 1:155990793-155990815 GTCTAGGCCTGGAAGGAAGGAGG + Intronic
915465580 1:156095999-156096021 CCCTGGGCAGTGTGGGAAGGTGG - Intronic
916339431 1:163712708-163712730 GCCTGGGCATGGTATGAAAGTGG + Intergenic
918013020 1:180605116-180605138 CCCTGGGCCTGAGATGAAGGGGG - Intergenic
918514435 1:185346924-185346946 CTCTGGGCAGGGAGGGGAGGTGG - Intergenic
919861687 1:201742879-201742901 CCCTGAGCTTGGGAGGAATGAGG + Intronic
922003508 1:221504529-221504551 ACCTGGGCATGGAGGGGAGAGGG - Intergenic
922233312 1:223704727-223704749 CCCTGTGCCTGGAAGGAGGGAGG + Intronic
922803668 1:228375178-228375200 GGATGGGCATGGAAGGAACGTGG - Intronic
922889064 1:229046553-229046575 CGCAGGGCGTGGAAGGAAGAGGG - Intergenic
923731113 1:236551169-236551191 CTGTGGGCAAGGAATGAAGGCGG - Exonic
924031912 1:239894345-239894367 CCCTGGGCATGCCGGCAAGGCGG - Intronic
924787090 1:247209149-247209171 TCCTGGGCAAGGCGGGAAGGTGG - Intergenic
1062894584 10:1093047-1093069 CCTTAGGCTGGGAAGGAAGGCGG + Intronic
1062907029 10:1186224-1186246 CCCTGGGCATGGGAAGAAGTGGG - Intronic
1062916375 10:1243747-1243769 CGCTTTGCCTGGAAGGAAGGAGG - Intronic
1064265204 10:13820385-13820407 CTCTGGGCTGGGAAGGCAGGCGG + Intronic
1064519854 10:16189668-16189690 CCCTGGGCATGAAAATGAGGAGG - Intergenic
1065786520 10:29220686-29220708 ACCTAGGGAGGGAAGGAAGGGGG - Intergenic
1066676772 10:37896237-37896259 CCCTGTGAATGTAAGGAATGTGG + Intergenic
1066682885 10:37952287-37952309 CCCTATGCATGCAAGGAATGTGG - Exonic
1067280643 10:44869474-44869496 CCTTGTGGAAGGAAGGAAGGAGG + Intergenic
1067367439 10:45646851-45646873 CCCTGGGCAAGAAATGGAGGAGG - Intronic
1067453437 10:46396756-46396778 CCCTTGGCAAGGAATAAAGGGGG + Intergenic
1067583797 10:47463010-47463032 CCCTTGGCAAGGAATAAAGGGGG - Intronic
1067633801 10:47988358-47988380 CCCTTGGCAAGGAATAAAGGGGG - Intergenic
1067860489 10:49842057-49842079 CCCTGGGACAGGAAGGAAAGGGG + Exonic
1068941279 10:62683614-62683636 GACTGGGGAAGGAAGGAAGGTGG - Intergenic
1069204625 10:65666489-65666511 CCCTGGGCTTAGAGGGAAGGTGG - Intergenic
1069540929 10:69293255-69293277 CCCTGGGCATGTTAGGCAGGTGG + Intronic
1069675314 10:70242426-70242448 GTCAGGGCCTGGAAGGAAGGAGG + Intergenic
1069694569 10:70377077-70377099 CCTTGTGCATGGCAGGAAGTGGG + Intronic
1070322523 10:75365064-75365086 CCCAGAACCTGGAAGGAAGGAGG + Intergenic
1070795835 10:79215775-79215797 CCCAGGGCATGGAAGGGAGATGG + Intronic
1071555160 10:86595921-86595943 CCCTGGGAAAGGAAGGAATGAGG + Intergenic
1071675063 10:87647666-87647688 CCCTGAGTGTGGAAGAAAGGAGG - Intergenic
1073008696 10:100343546-100343568 CCCAGGGCTTGGAAGGAGGATGG - Intergenic
1073297467 10:102449998-102450020 CCCTCGGCTTGGCAGGAAGGCGG + Exonic
1074966636 10:118496555-118496577 CCCAAGGGATGGAAGGCAGGTGG - Intergenic
1075211298 10:120493567-120493589 CCCAGGGCATGGAAGGCAGCGGG - Intronic
1075412963 10:122242455-122242477 CCATGGTCACGGGAGGAAGGAGG - Intronic
1075426034 10:122342330-122342352 ACCTGGGCCTGGAAGGATGGGGG + Intergenic
1075816221 10:125266672-125266694 CACTGCCCATGGAAAGAAGGAGG - Intergenic
1076121793 10:127942117-127942139 CACTTGCCATGGAAGGAAGCTGG + Intronic
1076164255 10:128268979-128269001 CCCAGGCCATGGAGGCAAGGGGG + Intergenic
1076254615 10:129012212-129012234 ACATGGGGATGGAAGGATGGGGG + Intergenic
1076529972 10:131137500-131137522 CCCTGGACACGGCAGGCAGGAGG - Intronic
1076616224 10:131756645-131756667 CCCTGGGCATGGTGGGGAAGTGG - Intergenic
1076880010 10:133235560-133235582 CCCAGGGGCTGGGAGGAAGGAGG + Intergenic
1076891858 10:133288615-133288637 CCCTGGGCAAGGAGGGGAGCTGG + Intronic
1076915906 10:133423132-133423154 CCGTGGGCAAGGGAGGAAGGGGG + Exonic
1076924604 10:133475999-133476021 TCCTGGGCTGGGAAGGAAGTGGG + Intergenic
1076936048 10:133567999-133568021 CTGTGGGCAAGGGAGGAAGGGGG + Intronic
1077501199 11:2910502-2910524 CCCTGGGTGTGGAAGCCAGGGGG + Intronic
1077930165 11:6722655-6722677 CCATTGGCCTGGAAGTAAGGTGG - Intergenic
1078840572 11:15073118-15073140 CCCACGGCAGGGAAGGAGGGGGG - Intronic
1079092653 11:17491891-17491913 CACTGGGCCGGGCAGGAAGGGGG - Intergenic
1079092846 11:17493066-17493088 CCCTGGGTATGGAAAGGAAGTGG - Intergenic
1079828269 11:25227172-25227194 CCCAGAGCATGGAATAAAGGAGG + Intergenic
1080563214 11:33483510-33483532 CACTGGGCATGGCAGGCACGAGG + Intergenic
1080641986 11:34163644-34163666 CCATGGGCTTGGCAGGTAGGAGG - Intronic
1081571485 11:44294098-44294120 CCCTGGGCAGGGGAGGAAAAAGG + Intronic
1081911045 11:46700316-46700338 CCCTGGGGAAGGCAGGAAGAAGG + Intronic
1083335600 11:61920006-61920028 CCTGGGGCATGGAGGGGAGGGGG - Intronic
1083474316 11:62906162-62906184 CGGTGGGAGTGGAAGGAAGGTGG + Intergenic
1083618655 11:64038308-64038330 CCCTGCGCAGGCAAGGAAGCCGG - Intronic
1084116344 11:67045011-67045033 CACTGGGCAGGGAACCAAGGTGG + Intronic
1084955874 11:72691325-72691347 CCCTGGGCATGGAAGGAAGGAGG - Intronic
1085039757 11:73319974-73319996 TCCAGGGCAAGGAGGGAAGGTGG + Intronic
1085214647 11:74818175-74818197 CCCTGGGAAGGAAAGGAAGAGGG + Intronic
1085411481 11:76293353-76293375 CCCTTGACAGGAAAGGAAGGAGG - Intergenic
1085505385 11:77055959-77055981 CCCTGGGGATGGTGGGGAGGTGG + Intergenic
1085717886 11:78889325-78889347 CCCTGGGCTTGGAGGGAAACTGG - Intronic
1085778094 11:79383998-79384020 CCATGGGGAAGAAAGGAAGGGGG - Intronic
1086209187 11:84297721-84297743 CTGGGGGCATGGAAGGAAGTCGG - Intronic
1087208076 11:95417925-95417947 ACCTGGGCAGGTAAGGAATGAGG - Intergenic
1087237037 11:95731566-95731588 TACTGGGCATGCAAGTAAGGTGG - Intergenic
1089134085 11:116235406-116235428 CCCTGTGCTGGGAGGGAAGGAGG + Intergenic
1089213829 11:116823543-116823565 ACCTCAGCATGGAAGGGAGGAGG + Intergenic
1089561969 11:119347746-119347768 CCTTGGGGATGGAAGCAAAGAGG + Intergenic
1089760405 11:120718588-120718610 TCCTTGAGATGGAAGGAAGGAGG + Intronic
1090175703 11:124647564-124647586 CTCAGGGCATGGATGGAGGGAGG - Intronic
1090393344 11:126403659-126403681 CCCTGGTCATGCAAGGAAGATGG + Intronic
1090653572 11:128825954-128825976 CCCAGGGCATGGAAGGACCCTGG + Intergenic
1090960457 11:131551894-131551916 CACTGGGCATGGCAGAAAAGAGG + Intronic
1091110009 11:132957254-132957276 GCCTGGAGGTGGAAGGAAGGAGG - Intronic
1091303527 11:134523105-134523127 GAGTGGGGATGGAAGGAAGGTGG + Intergenic
1091370863 11:135056711-135056733 CCCAGGGCGTGGCAGGAAGCAGG - Intergenic
1091725935 12:2846379-2846401 CCCTGGGCATGGTTAGAGGGTGG - Intronic
1091766058 12:3120601-3120623 CGCTGGGCATAAAAGGAAAGAGG - Intronic
1091903442 12:4164366-4164388 ACCTGAGAATGGAAGCAAGGAGG - Intergenic
1091917778 12:4281853-4281875 GGCTGAGCAGGGAAGGAAGGAGG - Intronic
1092053069 12:5487066-5487088 CCCATGTCATGGAAGGAGGGTGG - Intronic
1095974710 12:47931391-47931413 GCCTGTGCATGCAAGGAGGGAGG + Intronic
1096532210 12:52249219-52249241 CTCTGGGCATGGGGGGAGGGAGG - Intronic
1096615635 12:52831699-52831721 CCCTGGCCTTGGAGGGGAGGTGG - Intronic
1100262178 12:92942606-92942628 CCCTGGGCATAGATGCAAGATGG + Intergenic
1100297175 12:93273939-93273961 CCCTGGGAATGGTGGGAGGGAGG - Intergenic
1100373628 12:93992301-93992323 CCCTGGGAATGGGGGGAATGTGG + Intergenic
1101915099 12:108889717-108889739 CCTTGGGCTGGGAAGGTAGGGGG + Intronic
1102378990 12:112447264-112447286 GCCTGGGCAGGGAAGCAAAGGGG - Intronic
1102539472 12:113608261-113608283 CCTTGGGGTTGGAAGGAATGTGG - Intergenic
1102759642 12:115374471-115374493 ACATGGGGAAGGAAGGAAGGAGG + Intergenic
1104766328 12:131332763-131332785 CCCTGGGCCTGGCAGGAGCGTGG + Intergenic
1104813079 12:131629834-131629856 CCCTGGGCCTGGCAGGAGCGTGG - Intergenic
1104903722 12:132202723-132202745 CAGTGGCCAGGGAAGGAAGGGGG + Intronic
1104926746 12:132317774-132317796 ACCAGGGCAGGGAAAGAAGGAGG + Intronic
1106315172 13:28587002-28587024 CCCTGGGCAAGGCAGAAAGGTGG + Intergenic
1106533551 13:30617850-30617872 CGCTGGGCCTGAAAGGACGGTGG - Exonic
1107348002 13:39483805-39483827 CCCTCCCCATGGAAGGAAGAGGG - Intronic
1107800572 13:44104510-44104532 CCCTGGGCAGGCAAGGAGAGGGG - Intergenic
1108179772 13:47829231-47829253 CCCTGGGAATGGAGGTAAGCTGG - Intergenic
1108345161 13:49538605-49538627 TCCTGGACTGGGAAGGAAGGAGG + Intronic
1111777570 13:92684071-92684093 CCCTGGGGAGGAAAGAAAGGAGG - Intronic
1112088081 13:96052993-96053015 CCCCGGGTCGGGAAGGAAGGAGG + Intronic
1113561296 13:111283575-111283597 CCCTGTGCATGGCAGAAAGGAGG - Intronic
1113619171 13:111701341-111701363 CCCTGAGGACGGAAGGCAGGGGG + Intergenic
1113624700 13:111786602-111786624 CCCTGAGGACGGAAGGCAGGGGG + Intergenic
1113881203 13:113627641-113627663 CCCTGGGCCTGTTAGGAAGCTGG + Intronic
1114327813 14:21607047-21607069 TCCTAGGGATGGAATGAAGGAGG + Intergenic
1114431944 14:22669439-22669461 TCCTGGACCTGAAAGGAAGGAGG - Intergenic
1114523509 14:23352997-23353019 CCCAGGGGAGGGAGGGAAGGGGG + Intergenic
1117000520 14:51366422-51366444 CCCTGTGCATGGAAGGAAAAAGG + Intergenic
1117736966 14:58777528-58777550 CCCTGGGCAGGGGTGGAAGCGGG - Intergenic
1117953928 14:61108296-61108318 GCCTAGGCAGGGAGGGAAGGTGG + Intergenic
1118057741 14:62099318-62099340 CACTGGGGATGGAAAGAAGTGGG + Intronic
1118324340 14:64771213-64771235 CCCTGGGCAGGGAGGCCAGGAGG - Intronic
1118780199 14:69002931-69002953 CCCTGAGGGTGGAAGGAAAGAGG - Intergenic
1119607642 14:76034545-76034567 CCCTGTGCAAAGAAGGTAGGAGG + Intronic
1120077319 14:80173296-80173318 CTCTTGGCAGGGAAGGAAGCAGG + Intergenic
1121407170 14:93726109-93726131 CCCTGGGCTTGGAGGGCAGCAGG + Intronic
1122355512 14:101120876-101120898 GCCTGTGCCTGGAAGCAAGGAGG + Intergenic
1122745786 14:103896568-103896590 CCATGTGGCTGGAAGGAAGGCGG - Intergenic
1122874884 14:104659450-104659472 CTCTGGGCTGGGAAGGAGGGAGG - Intergenic
1124575064 15:30900800-30900822 ACCTGGCCATGGCTGGAAGGTGG + Intergenic
1124605944 15:31170504-31170526 CCCTGGCCCTGGAAGTAGGGAGG - Intergenic
1124815634 15:32989252-32989274 CACTGGGGATGGAAGGTAGGTGG + Intronic
1126348048 15:47717355-47717377 CCCCGGGCACGGACGGCAGGAGG - Intronic
1126730876 15:51681345-51681367 CCCCGGGAATGGAACAAAGGAGG - Exonic
1126957010 15:53944403-53944425 CCTTGAGGATGGAAGGCAGGAGG - Intergenic
1127054104 15:55114060-55114082 CCATGGGCCCAGAAGGAAGGGGG + Intergenic
1127259789 15:57319533-57319555 CCCTGCGGAGGGAGGGAAGGAGG - Intergenic
1128114040 15:65094428-65094450 CCCAGGGGATGGAAGGGATGGGG - Intronic
1128161153 15:65423334-65423356 CCCTGAGCCTGGAACGGAGGTGG - Intergenic
1128218108 15:65948131-65948153 CCCTGGGCAGGGAGGGATGGTGG - Intronic
1128247050 15:66140253-66140275 CCCTGGGCAGGAAAGGAAAAGGG + Intronic
1128803653 15:70514319-70514341 CCTGGGGCATGGAAGGAGGCAGG - Intergenic
1128969001 15:72089534-72089556 CTCTGGGAAAGGAAGGGAGGAGG + Intronic
1129659235 15:77543678-77543700 CCCTGGGCATGGAAGTGCTGGGG - Intergenic
1129826915 15:78640532-78640554 CACTGGGCCGAGAAGGAAGGGGG - Intronic
1130010648 15:80151195-80151217 CCCTGGGGAGGGAATGAAGGTGG - Intergenic
1131231862 15:90665504-90665526 CCCTCCGCGTGGAAGGACGGGGG + Intergenic
1131895114 15:97019710-97019732 CCCTTAGTATGGAAGGAAGAAGG + Intergenic
1132330582 15:101009534-101009556 CCCTGAGCTTGCATGGAAGGAGG + Intronic
1132678906 16:1131704-1131726 CCCTAGGCCTGGAAGGAAGGTGG - Intergenic
1132933993 16:2471934-2471956 CCCTGGGGAAGTAAGGAGGGCGG - Exonic
1133056672 16:3148869-3148891 CCCTGGGATTGGAAGGCAGAGGG + Intronic
1133171617 16:3985650-3985672 CCCTTGGCTTGGAAGGTGGGAGG - Intronic
1134065529 16:11225771-11225793 ACGTGGCCATGGAAGGATGGGGG - Intergenic
1134189666 16:12111475-12111497 TCCTGCGCAGGGAGGGAAGGAGG - Intronic
1136070672 16:27785141-27785163 CCCCGGGAATGGAGGGAAGTGGG - Intergenic
1136686361 16:31997018-31997040 CCCTGAGCATGCAGTGAAGGAGG - Intergenic
1136786973 16:32940547-32940569 CCCTGAGCATGCAGTGAAGGAGG - Intergenic
1136882799 16:33913242-33913264 CCCTGAGCATGCAGTGAAGGAGG + Intergenic
1137492335 16:48943651-48943673 CTCTGGGGCTGGAAGGAGGGTGG + Intergenic
1137694163 16:50450018-50450040 AGCTGGGCCTGGAAGGCAGGTGG + Intergenic
1138216149 16:55207139-55207161 CCCTTGGCTTGGAAAGACGGGGG + Intergenic
1139260609 16:65589880-65589902 CCCTGGGGGTGGAAGGGAGGGGG + Intergenic
1140092923 16:71852037-71852059 CCTGGGGCAAGGAAGGAAGGGGG + Exonic
1140985684 16:80156287-80156309 CACTGGGCAAAGAAGGAAGAAGG + Intergenic
1141088266 16:81112047-81112069 CCCTGGGAACTCAAGGAAGGTGG - Intergenic
1141094883 16:81156078-81156100 ACCTGGGAAGGGAGGGAAGGAGG - Intergenic
1141840895 16:86573449-86573471 ACATAGGCATGTAAGGAAGGGGG + Intergenic
1203089210 16_KI270728v1_random:1202217-1202239 CCCTGAGCATGCAGTGAAGGAGG - Intergenic
1142561427 17:811634-811656 CCCAGGGCACCGAAGGAAGCCGG + Intronic
1142714959 17:1742292-1742314 TCCTGGGCTTGGAAGGTTGGGGG + Intergenic
1142967910 17:3592443-3592465 CCCTTGGCAAGGAGGGCAGGTGG - Intronic
1143315756 17:6032214-6032236 AGCTGGTCATGGAAGGAAGAAGG - Intronic
1143697217 17:8630018-8630040 CCATGGGCTTGGAAGGCGGGCGG - Intronic
1143770617 17:9166213-9166235 CCCTGGGAATACAAGGCAGGAGG - Intronic
1143772824 17:9179346-9179368 CCCAGGGCATGGGAGGAGTGGGG - Intronic
1143853151 17:9827995-9828017 CCCTGCCCATGGAACGAAGGAGG - Intronic
1143971257 17:10797649-10797671 CCTGGGGCATGGAATGAGGGAGG - Intergenic
1144028437 17:11299039-11299061 TCTTGGTCATGGAAGGAAAGGGG - Intronic
1144661846 17:17076105-17076127 GCCTTGGCATGGAAGGAATTGGG - Intronic
1144670935 17:17132220-17132242 CACTGGCCAGGGAGGGAAGGAGG - Intronic
1144792159 17:17866558-17866580 CCATGGACCTGGAAGGCAGGTGG - Intronic
1144967292 17:19085628-19085650 CCCTGGGGATGGAAAGAAATGGG + Intergenic
1144980628 17:19166438-19166460 CCCTGGGGATGGAAAGAAATGGG - Intergenic
1144987594 17:19211795-19211817 CCCTGGGGATGGAAAGAAATGGG + Intergenic
1146127192 17:30238703-30238725 TCCTGGGCATGGAAGGCAGGAGG + Intergenic
1146182539 17:30707391-30707413 CCCTGGACATGTAGGGAATGGGG + Intergenic
1146315764 17:31805702-31805724 ACTGGGGCATGGAAGGGAGGAGG + Intergenic
1146369232 17:32254573-32254595 TCCTGGGCGGGGAAGGAATGGGG + Intergenic
1146534708 17:33640026-33640048 CCCTGGGCTTCTAAGGGAGGAGG + Intronic
1146653353 17:34620815-34620837 AGCTGGGCATGGAAGGATGAGGG + Intronic
1147147321 17:38492687-38492709 CCCTGAGCATGCAGTGAAGGAGG - Intronic
1147307452 17:39573790-39573812 CCCCGGACAAGGAAGGGAGGCGG + Intergenic
1147658445 17:42104372-42104394 CCCTGGACAAGGCAGGATGGTGG + Intronic
1148734404 17:49857124-49857146 CCATGGGGAGGGAAGGAGGGAGG + Intergenic
1149062467 17:52438962-52438984 ACCTGAGCATGGAAGGTAGGAGG - Intergenic
1150250909 17:63704040-63704062 CACTGGGCCTGGAGGGAAAGGGG + Exonic
1150652597 17:67019688-67019710 CCCTGGGACTGTAAGGAAAGAGG + Intronic
1150847538 17:68675022-68675044 CCCTGGTAATGGAAGGTAGTGGG - Intergenic
1151149632 17:72073794-72073816 CACTGAGCATGGCAGGCAGGGGG + Intergenic
1151398184 17:73838859-73838881 CCCTGGTGATGGAAAGCAGGGGG - Intergenic
1152198096 17:78929299-78929321 CCCAGGGCAAGAGAGGAAGGAGG + Intergenic
1152418012 17:80175601-80175623 CCAAGGGGATGGAAGGGAGGAGG + Intronic
1152572045 17:81125186-81125208 CCCTGGGCAGGGATGGGGGGTGG - Intronic
1152826021 17:82465390-82465412 CCCTGGGCAGGGTAGGATGCCGG - Intronic
1152897426 17:82920853-82920875 CCCTGGGCATGGAAGCGAGGAGG - Intronic
1153009000 18:520951-520973 CCATGGGCAGGGGAGGAATGGGG - Intergenic
1153749289 18:8212159-8212181 GCCTGTGCCTGGTAGGAAGGAGG + Intronic
1156073070 18:33237171-33237193 CACTGGGCTTGGAATGAAGATGG - Intronic
1156125799 18:33903886-33903908 CCCTGGGCATAGAGGGAGGGTGG - Intronic
1158489677 18:57898643-57898665 CCCTGGGCAGAGAAGGAGAGAGG - Intergenic
1158538354 18:58328974-58328996 CCCTGAGCATGCAGGAAAGGGGG - Exonic
1158634967 18:59148318-59148340 TCTTGCGCCTGGAAGGAAGGCGG + Intronic
1158674681 18:59507439-59507461 CCCTGGGCATGGCATGAGGAAGG - Intronic
1158766079 18:60451421-60451443 CCCTGGTAATGGTAGGAAAGTGG - Intergenic
1159059586 18:63500698-63500720 CCCTTGGCCAGGAAGGAAGAAGG + Intronic
1159869028 18:73739907-73739929 CTCTGCTCATGGAAGGATGGAGG - Intergenic
1160338292 18:78062669-78062691 CCCTGGGGAAAGGAGGAAGGTGG + Intergenic
1160874589 19:1291148-1291170 CCCTGGGAGGGGCAGGAAGGTGG + Intronic
1161007890 19:1945410-1945432 CCCTGGGCAGGGCTGGCAGGGGG - Intronic
1161021824 19:2014596-2014618 TCCTGGGGATGGAAGAATGGAGG + Intronic
1161280815 19:3444592-3444614 GCCAGGGCAGGGCAGGAAGGAGG - Intronic
1161326068 19:3664866-3664888 CCCTGGCCATGGGAAGAAGTTGG - Exonic
1161719352 19:5894541-5894563 CCCTTGGCAGGGACGGCAGGCGG + Intronic
1162013992 19:7833856-7833878 CCCGGGCAATAGAAGGAAGGAGG + Intronic
1162187941 19:8921861-8921883 CCCTGGGAAGGAAAGGAAGCTGG + Intronic
1162523230 19:11194000-11194022 TCCTTGGCAGGGAAGGCAGGTGG + Exonic
1162619782 19:11832883-11832905 CCCTATGCATGTAAGGAATGTGG + Exonic
1162641717 19:12015500-12015522 CCCTATGCATGTAAGGAATGTGG - Exonic
1162715392 19:12628256-12628278 CCCTATGCATGTAAGGAATGTGG + Exonic
1162791607 19:13065875-13065897 TGCTGGGGATGGAAGGGAGGTGG + Intronic
1162846836 19:13399339-13399361 CTCTGAGCAAGGAAGGAGGGAGG - Intronic
1163318075 19:16555115-16555137 GGCTGGGCAGGGAAGGAAGCCGG - Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163458619 19:17423477-17423499 CCCTGGACCAGGAGGGAAGGTGG - Exonic
1163633100 19:18426933-18426955 CCCCGGCCCAGGAAGGAAGGAGG - Intronic
1163670870 19:18627739-18627761 CCCTGGGGCTGGAAGGAACAAGG - Intergenic
1164471927 19:28543515-28543537 CCCGGGGTTGGGAAGGAAGGGGG + Intergenic
1165245874 19:34498127-34498149 CCCTGCGCAGGGAAGGGAGCTGG - Intronic
1165543659 19:36514814-36514836 CCCTATGCATGTAAGGAATGTGG - Exonic
1165608372 19:37127571-37127593 CCCTATGCATGTAAGGAATGTGG + Exonic
1165729444 19:38135361-38135383 CTCCGGGCAGGGTAGGAAGGTGG - Intronic
1166255267 19:41599812-41599834 CCCTGGGAGTGGATGGGAGGAGG + Intronic
1166328328 19:42064903-42064925 CCCCAGGCATGGAGGGCAGGAGG - Intronic
1166714443 19:44957697-44957719 CCCTGGGCATGGGAGAAGGGTGG - Intronic
1166732527 19:45067232-45067254 CCCTGGGCCTTGCAGGAAGGAGG + Intronic
1166756510 19:45195598-45195620 CTCTGAGGAAGGAAGGAAGGAGG - Intronic
1167123312 19:47531995-47532017 CCCTGGGCGTGGGAGGGAGCTGG - Intronic
1167135592 19:47613401-47613423 GCCTGGGCTTGGAAGGCAGAGGG + Intronic
1167231442 19:48286867-48286889 CCCTGTGAATGAAAGGAAGGTGG + Exonic
1167475179 19:49696362-49696384 ACCAGGGCATGGAATGAATGAGG - Intronic
1168442717 19:56384467-56384489 CCCTATGCATGCAAGGAATGTGG - Exonic
925140108 2:1544264-1544286 CTCTGGGCAGTGAAGGGAGGTGG + Intergenic
926171146 2:10553222-10553244 CCTTGGGAATGGAAGGAACAGGG + Intergenic
926691012 2:15733415-15733437 CCCTAGGGATGCAAGGCAGGAGG - Intronic
928214665 2:29351439-29351461 CCCTGGACAATGAAGGGAGGAGG - Intronic
929584954 2:43107750-43107772 GCCCGGGCAGGGAAGGGAGGTGG - Intergenic
929881308 2:45839534-45839556 CCCTGGGAATGGCTGGGAGGAGG + Intronic
930065521 2:47324653-47324675 CCCTGGGCAGTGAGGGGAGGAGG - Intergenic
931620689 2:64206628-64206650 CCCAGGCCAGGGAAGGAACGTGG + Intergenic
934040499 2:88124236-88124258 CCCTGGGCATGCAGGGCAGGTGG + Intronic
935804099 2:106729458-106729480 CCCTGGACAAGGTGGGAAGGTGG + Intergenic
936558780 2:113518577-113518599 TAGTGGGCATGGAAGGGAGGGGG + Intergenic
937504999 2:122526988-122527010 ACCTGGGCATAGAAGGAGGAGGG - Intergenic
937912094 2:127080755-127080777 CCCAGGGCAGGGCAGGGAGGGGG + Intronic
937955280 2:127418685-127418707 CCCTTGGCCTGGAAAGAGGGAGG - Intronic
938254970 2:129850557-129850579 GCTAGGGAATGGAAGGAAGGTGG - Intergenic
938374318 2:130795852-130795874 CCCTGCTCAGAGAAGGAAGGAGG - Intergenic
939504593 2:143029964-143029986 CACTGGGCATGGAGGACAGGAGG + Intronic
939895558 2:147786964-147786986 CCCTGGCAGTGGTAGGAAGGTGG - Intergenic
940072563 2:149705326-149705348 GGCTGGGAAGGGAAGGAAGGAGG - Intergenic
941903437 2:170698912-170698934 CACTGGGGATGGGAGGAGGGTGG + Intergenic
942563101 2:177241021-177241043 CCCTGAGAATGACAGGAAGGTGG + Intronic
942860715 2:180607848-180607870 CCCTGAGCAAGGAAGACAGGTGG + Intergenic
943680025 2:190758683-190758705 CCATGGCCAGAGAAGGAAGGGGG - Intergenic
944882275 2:204025908-204025930 CCCTGGGCACAGGAGGACGGAGG - Intergenic
945406143 2:209451396-209451418 AGCAGGGCATGGAGGGAAGGGGG - Intronic
945514294 2:210743605-210743627 CACTGGGCTGGGAAGGTAGGTGG + Intergenic
945515051 2:210752969-210752991 ACCTGGTCAAGGAAGGAAGAAGG - Intergenic
945719457 2:213401234-213401256 CCATGGGCATGAAAAGAATGCGG + Intronic
946048768 2:216843289-216843311 CAGGGGGCCTGGAAGGAAGGGGG + Intergenic
947715966 2:232338977-232338999 CCCTGGTCATGGAATGAGGTTGG - Intronic
947736534 2:232458145-232458167 CCCTGGGGAGTGGAGGAAGGCGG + Intronic
948496466 2:238353152-238353174 ACCTGAGCAGGAAAGGAAGGGGG - Exonic
948570940 2:238916761-238916783 CTCTGGGACTAGAAGGAAGGTGG + Intergenic
948747657 2:240107926-240107948 CCCTGGGCCTGGTGGGCAGGAGG + Intergenic
948811143 2:240479031-240479053 CACTGGGAATGAGAGGAAGGAGG - Intergenic
948843514 2:240672101-240672123 CCCTGAGCAGGGAGGGGAGGTGG + Intergenic
948850719 2:240704106-240704128 GCCAAGGCATGGAAGGAACGGGG - Intergenic
1169180808 20:3565158-3565180 AACAGGGCATGGAAGAAAGGCGG - Intronic
1169681349 20:8217434-8217456 CCCTGAGGATGGAAGGAGGGAGG + Intronic
1170391876 20:15884120-15884142 CCCAGGGGATGGATGGATGGAGG + Intronic
1170431450 20:16280356-16280378 ACCAGGGGATGGAGGGAAGGAGG + Intronic
1171032675 20:21691488-21691510 GCCTGGAGATGGAATGAAGGGGG + Intergenic
1171119167 20:22553323-22553345 CCCCATGCATGGATGGAAGGAGG + Intergenic
1171188263 20:23138906-23138928 CCCTGGGTAAGGAGGGAAGCCGG + Intergenic
1171259721 20:23721764-23721786 CCATGTGCATGGAAAAAAGGAGG - Intergenic
1171268785 20:23797221-23797243 CCATGTGCATGGAACAAAGGAGG - Intergenic
1172025459 20:31945446-31945468 CCCTGAGCAAGGAAGGAGGGAGG - Exonic
1172699302 20:36843117-36843139 CGCTGGGGCTGGGAGGAAGGGGG + Intronic
1173522680 20:43711373-43711395 TCCTGGGTAAGGCAGGAAGGAGG - Intronic
1173537986 20:43830369-43830391 CACTGGGCATGGAAGGAGGGAGG - Intergenic
1174287575 20:49483610-49483632 CCCCGGGCTTGGAAGGGAAGGGG + Intergenic
1174339430 20:49886731-49886753 CCCTGAGCAGGGAGGAAAGGCGG - Exonic
1174881664 20:54285692-54285714 GCCTGGGCATGAAAGGTAAGGGG + Intergenic
1175672767 20:60920282-60920304 CCGTTGACAGGGAAGGAAGGTGG + Intergenic
1175687281 20:61040807-61040829 TCCTGGGCATGGAGGGAGTGGGG - Intergenic
1175727699 20:61331160-61331182 CACTGGGCATGGAAGGAGATGGG - Intronic
1175933262 20:62503375-62503397 GTCTGGGCATGGCAGGGAGGAGG - Intergenic
1176024428 20:62978564-62978586 CCCTGGGGGAGGAAGGAAGGAGG - Intergenic
1176090920 20:63318303-63318325 CTCTCGGGATGGCAGGAAGGTGG + Intronic
1178343212 21:31803508-31803530 CCCTTGGCATGAGAGGAAGTAGG + Intergenic
1178471696 21:32899293-32899315 CCCAGGTGATGGAAGAAAGGTGG + Intergenic
1178914818 21:36700238-36700260 CACTGGCGAAGGAAGGAAGGAGG - Intronic
1179050999 21:37888578-37888600 CCATGGGGATGGGAGGAAGGTGG + Intronic
1179116058 21:38493801-38493823 CACAGGACAGGGAAGGAAGGAGG - Intronic
1179173798 21:38992611-38992633 CCCTGATGATGGAAGGAAAGAGG - Intergenic
1179340035 21:40498453-40498475 CCCTAGGATTGGAAGAAAGGTGG + Intronic
1179629602 21:42668242-42668264 CCCTGGGGATGGCAGGAATGGGG - Intronic
1180006050 21:45021190-45021212 CCCTGGGAGTAGCAGGAAGGTGG + Intergenic
1180014009 21:45071262-45071284 CCCTGGGCATGACAGGAAGGGGG + Intergenic
1181722367 22:24785743-24785765 CCCTGGGCAGGCAATGAGGGAGG - Intergenic
1182411357 22:30189663-30189685 AGCTGGGCAAGGAATGAAGGAGG - Intergenic
1182764011 22:32745463-32745485 CCCTGGACAAGAAAGGAAAGAGG - Intronic
1183356247 22:37361379-37361401 TCCTGGGGGTGGGAGGAAGGTGG - Intergenic
1183359582 22:37376527-37376549 CTTTGGGCATGGAGGAAAGGAGG - Intronic
1183569188 22:38639489-38639511 CATTGGGCAAGGAAGGAGGGAGG - Intronic
1184692162 22:46122370-46122392 GCCTGGCCATGCAAGGACGGAGG - Intergenic
1185285363 22:49997529-49997551 CACTGGGGAAGGAAGGGAGGCGG - Intronic
949733783 3:7146533-7146555 GCCTGGGCTTGGAAGGAATCGGG - Exonic
950193478 3:10993272-10993294 CCCAGGGCATGGAGGGGACGCGG + Intronic
950362961 3:12462668-12462690 TCCTGGGCCTGGGAGGAAGTGGG + Intergenic
950435183 3:12975070-12975092 CACTGCGCCTGAAAGGAAGGTGG - Intronic
950569082 3:13788903-13788925 CCTAGGGCAGGGAAGGAAGTGGG + Intergenic
950575875 3:13831819-13831841 CCCTGGGCATCGAGAGAAGTTGG - Intronic
951622011 3:24612782-24612804 CCCTGGGCATTCAAGGAGGTTGG + Intergenic
951709318 3:25573175-25573197 GAGTGGGCAGGGAAGGAAGGCGG - Intronic
952569417 3:34696386-34696408 CCCTGGGAATGAAAGGACTGAGG + Intergenic
953885419 3:46712195-46712217 ACCTGGGCACGGAGGCAAGGGGG + Exonic
954149809 3:48651753-48651775 CGCAGAGCATGGAAGGAAGCAGG + Intronic
954295987 3:49674662-49674684 CACTGGGGTGGGAAGGAAGGGGG + Intronic
954413920 3:50383691-50383713 TCCTGGGCATAGAACCAAGGAGG - Intronic
954692312 3:52402147-52402169 CCCTGGGAATGGGAGGAACCAGG - Exonic
954790028 3:53125477-53125499 CACTGAGGAGGGAAGGAAGGTGG + Intronic
954881087 3:53836402-53836424 CCCTGGGGAGGAAGGGAAGGTGG - Intronic
955695584 3:61632805-61632827 CCATGGGCAGGGAGGGGAGGGGG - Intronic
955808350 3:62760088-62760110 CCCTGGGCATGGAGGAAGGGAGG - Intronic
956731657 3:72202011-72202033 AGCTGGGCATGGATGGAGGGTGG - Intergenic
957021715 3:75135577-75135599 CAGTGGGCATGGAAAGAACGTGG - Intergenic
958181996 3:90072234-90072256 GTCTGGGCATGGAAATAAGGGGG + Intergenic
959992138 3:112641542-112641564 TCCTCGGCATGGAAGGAAGCTGG + Intronic
960988610 3:123296194-123296216 CCCTGAGCATGCAACCAAGGTGG - Exonic
961322112 3:126083668-126083690 CCCTGAGCAGGCCAGGAAGGAGG + Intronic
961353861 3:126321627-126321649 CCCTGTGCATGGTGGGATGGTGG + Intergenic
962240008 3:133744291-133744313 CGCAGGGCATGGAAAGAAGATGG - Intergenic
962498346 3:135965553-135965575 CTCTGGCCAAGGCAGGAAGGGGG - Intergenic
964452661 3:156826586-156826608 CCCCGGGGCTGGGAGGAAGGCGG - Exonic
966537475 3:181050862-181050884 GCCTGGGCCTGGAGGGAGGGTGG + Intergenic
967204070 3:187103503-187103525 CCTGGGGCATGGAAGGCTGGAGG - Intergenic
968044224 3:195614749-195614771 TACTGGGCAAGGAAGGCAGGGGG + Intergenic
968236703 3:197035780-197035802 CCCTGGGGATGGGCGGGAGGAGG + Intergenic
968509109 4:987566-987588 CCCTGGCCCTGCCAGGAAGGCGG - Intronic
968878220 4:3285474-3285496 ACGGGGGCCTGGAAGGAAGGGGG + Intergenic
968911642 4:3479532-3479554 CCCTGGGGAAGGAGGGAATGTGG - Intronic
969254328 4:5992116-5992138 CCCTGGGCTTCAAGGGAAGGGGG + Intergenic
969345739 4:6568701-6568723 CTCTGTGCATGTAAGGCAGGAGG - Intergenic
969431117 4:7154883-7154905 CACTGGGGCTGGAAGGAATGGGG - Intergenic
969472747 4:7399272-7399294 CCCTGTGGATGGAAGGCTGGCGG + Intronic
969573592 4:8024159-8024181 CCCTGGCCTGAGAAGGAAGGAGG - Intronic
969969762 4:11033650-11033672 CCCGGGGCAAGGAGTGAAGGTGG + Intergenic
970640876 4:18064654-18064676 CCATGGGGAAGGAAGGAGGGAGG - Intergenic
971614066 4:28764638-28764660 GCCTGGGCATGGAGTGAAGAGGG - Intergenic
972618894 4:40726776-40726798 GCCAGGGGATGGTAGGAAGGAGG - Intergenic
973163710 4:47051135-47051157 CCCTGAGACTGGCAGGAAGGAGG + Intronic
974191770 4:58513755-58513777 TACTGGGGATGGAAGGAAAGAGG - Intergenic
975029661 4:69599765-69599787 GCCTGGGAAAGGAAGGAAGGAGG + Intronic
976149741 4:82079952-82079974 CCCTGGGGTTGGGTGGAAGGTGG - Intergenic
977147069 4:93456927-93456949 CCCTGGATATGGAAGGGTGGAGG - Intronic
977294995 4:95200336-95200358 CCCTGGCTTTGCAAGGAAGGAGG - Intronic
977726531 4:100302782-100302804 TCCAGAGCATGGAGGGAAGGCGG - Intergenic
978021542 4:103819543-103819565 CCTTGGGAATGGCAGGGAGGGGG + Intergenic
979749472 4:124260237-124260259 CCCTGTGCATTGCAGGATGGTGG + Intergenic
980873388 4:138635687-138635709 TCCTGGGGCTGGAAGCAAGGAGG - Intergenic
982398530 4:154940177-154940199 ACCTGGGCTTGGTGGGAAGGAGG + Intergenic
983649004 4:170020285-170020307 CTCAGGGCAGGGAAGGAAAGGGG - Intronic
984855200 4:184189178-184189200 CCATGGCCAGGAAAGGAAGGCGG - Intronic
985010111 4:185573614-185573636 TCCTGGGGATGGCAGGAAGATGG + Intergenic
985481452 5:113506-113528 CCCTGGGCAGGGCAGGAATTGGG + Intergenic
985948697 5:3206321-3206343 CCCTGGGGATGGAAGGAGCAGGG - Intergenic
986034167 5:3922446-3922468 CACTGGGTATGGAATAAAGGAGG + Intergenic
986251483 5:6062186-6062208 AGGTGGGCATGGAAGGAAAGGGG - Intergenic
989592028 5:43121138-43121160 CCCAGGTCTCGGAAGGAAGGGGG + Intronic
990344485 5:54858039-54858061 CCCTGTGAATGTAAGGAATGTGG + Intergenic
990448720 5:55916514-55916536 TTCTGGGCCTGGGAGGAAGGTGG + Intronic
991470017 5:66957878-66957900 CCCTGGGCAAGGAGGGAAGTAGG - Intronic
992126342 5:73646085-73646107 TCCAGGGCAGGGAAGGCAGGAGG - Intronic
992397225 5:76379123-76379145 CTCTTGGGATGGAAGGAGGGAGG + Intergenic
992616888 5:78553681-78553703 TCCTGGGGAAGGAAAGAAGGTGG - Intronic
995224224 5:109686114-109686136 ACGTGGCCATGGAAGGAAAGTGG - Intergenic
996141428 5:119913814-119913836 CCTTGGGAGTGGAAGGCAGGAGG - Intergenic
997264168 5:132485478-132485500 CCATGGGAAGGGAAGGCAGGTGG - Intronic
998371058 5:141661788-141661810 CTCTGGGGATGGAATGGAGGAGG + Exonic
998471328 5:142386228-142386250 CCATGGGGATGAAGGGAAGGAGG + Intergenic
998578081 5:143339700-143339722 CCCTCAGCCTAGAAGGAAGGAGG - Intronic
999262272 5:150245372-150245394 CCCTGGGCCTCCAAGGAGGGAGG - Intronic
999874502 5:155787529-155787551 CTCTGCGAATGGAAGGAATGTGG + Intergenic
1000944481 5:167403854-167403876 ACTTGGCCAAGGAAGGAAGGAGG - Intronic
1001092120 5:168749414-168749436 CCCTGGGAAGGCAAGGAAGATGG - Intronic
1002088593 5:176791484-176791506 CCCTGGGCTGGGAAGGACTGGGG - Intergenic
1002426969 5:179182198-179182220 CTCTGGGCATGCAAGCAGGGAGG - Intronic
1002587372 5:180258136-180258158 CCCTGTGAATGGAAGAAAGGTGG + Intronic
1002835536 6:861889-861911 CCAGGGTCATCGAAGGAAGGAGG + Intergenic
1002984277 6:2173442-2173464 TACAGGGCATGGAGGGAAGGAGG + Intronic
1004131929 6:12928750-12928772 CCCTGGGCAAGGCAGATAGGTGG + Intronic
1005005717 6:21285555-21285577 GGCTGGGGATGGAAGGAAGCAGG - Intergenic
1005599467 6:27411868-27411890 CCCTGGGCAAGTGAGGAGGGAGG - Intergenic
1006309908 6:33250120-33250142 CCCAGGCCATTGGAGGAAGGTGG - Intergenic
1006910343 6:37559384-37559406 CCCTGTGCAGGGGATGAAGGGGG - Intergenic
1007026255 6:38578138-38578160 CCCTGGCCAGGGAAGGTAGAGGG - Intronic
1007258474 6:40545302-40545324 CCCTGGACACAGAATGAAGGTGG + Intronic
1007367980 6:41407963-41407985 CTCTGAGCCTGGCAGGAAGGAGG - Intergenic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1009235720 6:61121499-61121521 GCCTGGGCATGGGAGGGAGGCGG + Intergenic
1010388043 6:75304961-75304983 ACCTGGGCATGGAAGGAGACTGG + Intronic
1011101572 6:83728169-83728191 CCCTGGGAAGGGAAGGAAAGAGG + Intergenic
1011706831 6:90008967-90008989 CCATGAGCATGGCAGGAAGGAGG + Intronic
1012412651 6:98976326-98976348 CCATGCACATGGAAGGAAGCAGG + Intergenic
1012655663 6:101816774-101816796 ACCTGGGTAGGGAAGGATGGAGG - Intronic
1012824253 6:104126882-104126904 CCCAGGGGATGGGAGGAGGGTGG + Intergenic
1013272920 6:108559821-108559843 CCCTGCTCGTGGAAGGGAGGAGG + Intronic
1013420544 6:109962735-109962757 CATTGAGAATGGAAGGAAGGTGG + Intergenic
1014082422 6:117302971-117302993 CCCAGGGCTTGGAAGGAATGAGG + Intronic
1014882521 6:126741341-126741363 ACCTGTGCATTGAAGGCAGGGGG - Intergenic
1015883516 6:137892973-137892995 CCCTGAGCATGGGAAGAAGAGGG - Intergenic
1016586022 6:145686981-145687003 CCATGGCCCTGGAAGGAAGATGG - Intronic
1017052059 6:150402415-150402437 CCCTGCACCTGCAAGGAAGGAGG + Exonic
1017158287 6:151341806-151341828 GCCTGGGACGGGAAGGAAGGAGG - Intronic
1017720619 6:157240909-157240931 CCCTGGGGAGGGAGGGAGGGAGG + Intergenic
1017756285 6:157532048-157532070 CCCTGGCCATGGAAGCACTGGGG + Intronic
1017796550 6:157850046-157850068 GCCTGGGCAAGGAGAGAAGGTGG + Intronic
1018013642 6:159693429-159693451 CCCAGGGCACGGGAGAAAGGAGG + Intronic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1018684900 6:166296781-166296803 ACTTGGGCATGGAAGGAACAGGG - Intergenic
1018707005 6:166470544-166470566 CCCTGGGGCAGAAAGGAAGGAGG + Intronic
1018712869 6:166509203-166509225 TCCTGGGCTTGGCAGGCAGGTGG + Intronic
1018834572 6:167473321-167473343 CCCTGGGCCTGCAAGGAATTTGG + Intergenic
1019278314 7:187641-187663 CAATGGGCCAGGAAGGAAGGAGG - Intergenic
1019294966 7:269252-269274 GCCGGGCCATGGAAGGAGGGCGG - Intergenic
1019326225 7:439591-439613 CCCTGGGCCTGGACCTAAGGGGG + Intergenic
1019384316 7:746223-746245 CCCTGGGCACGGCAGGCGGGGGG - Intronic
1019384456 7:746684-746706 CCCTGGGCAGGGTGGGCAGGGGG - Intronic
1019486739 7:1292894-1292916 CCCAGGGGAAGTAAGGAAGGAGG - Intergenic
1019612820 7:1945580-1945602 CCCTGGAGATGAAGGGAAGGAGG + Intronic
1022818663 7:33937564-33937586 ATCTGGGGCTGGAAGGAAGGGGG + Intronic
1023473642 7:40552688-40552710 CCATAGGCATGGAAGGAAAAGGG + Intronic
1023869310 7:44254336-44254358 CCTTGGGCGTGGAGGGGAGGTGG + Intronic
1023870376 7:44260206-44260228 GCCGGAGCATGCAAGGAAGGGGG - Intronic
1024517576 7:50272412-50272434 CACAGGGCATGGCAGGAAGGGGG - Intergenic
1026257320 7:68723863-68723885 CCCTGGGGCAGGGAGGAAGGGGG - Intergenic
1027139771 7:75648783-75648805 CCCTGGGAATGGGAGGCAGTGGG + Intronic
1027850918 7:83450979-83451001 CCCTGGTCATGGGAGGAACCAGG + Intronic
1028092655 7:86722559-86722581 ACATGGACATGGAAGGCAGGGGG + Intronic
1028894101 7:96021663-96021685 GGCTGGGCTTGGAAGGAATGAGG - Intronic
1029876905 7:103763907-103763929 CAGTGGGCATGGAAAGAAAGGGG + Intronic
1030116383 7:106065162-106065184 TCCTGGGCATGTGAGGAAGCTGG + Intergenic
1031942871 7:127807884-127807906 CCCTGGACATTTAATGAAGGTGG - Intronic
1032849570 7:135782590-135782612 GCCTTGGCAAGGAAGGAAGGGGG - Intergenic
1033578455 7:142709668-142709690 CCCTGAGCCTGCAAGGAATGTGG + Intergenic
1034270542 7:149801628-149801650 CTCTGGGCATGGGATGCAGGAGG + Intergenic
1034284554 7:149875893-149875915 ACCTGGGCAAGGAAGGAGGCAGG + Intronic
1034680631 7:152925303-152925325 CCCTGGGCCTGGGAGGCCGGTGG + Intergenic
1034819394 7:154202771-154202793 CTCAAGGCATGGAAGGAAGGAGG - Intronic
1034968367 7:155404876-155404898 CACTGGGCAGGGGAGGAAGCAGG + Intergenic
1035084831 7:156249176-156249198 CCATGAGTAAGGAAGGAAGGAGG + Intergenic
1035105677 7:156440196-156440218 CCCTGGGAATGGATGGAGTGTGG + Intergenic
1035371994 7:158385973-158385995 CTCAGGGCATGGGAGGAGGGAGG - Intronic
1035372084 7:158386244-158386266 CTCAGGGCATGGGAGGAGGGAGG - Intronic
1035373099 7:158391734-158391756 CCCTGGGGATGGGAGGAGGCAGG + Intronic
1036496989 8:9278578-9278600 GCCAGAGCCTGGAAGGAAGGCGG - Intergenic
1036681642 8:10878573-10878595 CCCTGGGCAAGCAAGGAGTGAGG + Intergenic
1037818442 8:22124159-22124181 CCTAGGGCTTGGAGGGAAGGAGG - Intronic
1038856057 8:31334617-31334639 GCCTGGGCAGGGAAGGAAACTGG + Intergenic
1039414181 8:37379450-37379472 ACATGGGCAAGGTAGGAAGGGGG - Intergenic
1039792658 8:40887987-40888009 CCCTGAGCATTGAAGGATGAGGG - Intronic
1039798641 8:40935949-40935971 CCCTGGTCCTGGAGGGAGGGTGG + Intergenic
1040279884 8:46034770-46034792 CCCTGGGCAACAAGGGAAGGAGG + Intergenic
1040391261 8:46952758-46952780 CACTGGGCACAGAAGGGAGGTGG - Intergenic
1040515564 8:48131192-48131214 CCTTGGGAATGGCAGGGAGGTGG + Intergenic
1040758054 8:50804797-50804819 GCCTGGGCATGGAGCGGAGGGGG - Intergenic
1042612334 8:70613037-70613059 CCCTGTGAAAGGAAGGAAGAAGG + Intronic
1044824388 8:96182573-96182595 CCCTGGGTTTGGAGGGAGGGTGG - Intergenic
1044837850 8:96313551-96313573 GCCTGGTCCTGGGAGGAAGGTGG + Intronic
1045381552 8:101632387-101632409 CCCTGTGGATGGATGGGAGGTGG - Intronic
1045468394 8:102489675-102489697 CCCTGGGCCCGGGAGGCAGGTGG + Intergenic
1047934734 8:129765792-129765814 TCCTGGGGATTTAAGGAAGGAGG + Exonic
1048180890 8:132193301-132193323 ACCTGGGCTTGGATGGAAGATGG - Intronic
1048319188 8:133385359-133385381 CCCTGGGCCTGCAAGGGTGGGGG - Intergenic
1048956761 8:139543769-139543791 CCCTGGGCCAGGTGGGAAGGAGG + Intergenic
1049212651 8:141393784-141393806 CACTGGACATGGGAGGCAGGAGG + Intronic
1049288267 8:141788278-141788300 AGCTGAGCAGGGAAGGAAGGAGG - Intergenic
1049587977 8:143440707-143440729 CCCTGGCCAATGGAGGAAGGTGG - Intronic
1049894070 9:97604-97626 TAGTGGGCATGGAAGGGAGGGGG - Intergenic
1049945344 9:589638-589660 CCCTGAGCCAGGAAGGAGGGAGG + Intronic
1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG + Intronic
1053073535 9:35114991-35115013 CCTGGGGCAAGGAAGGAAGTGGG + Intronic
1053381777 9:37654978-37655000 CCGGGGGCAGGGAAGGAGGGAGG - Intronic
1053420148 9:37972267-37972289 CTCTGGGCATGGGAGGAACTGGG - Intronic
1053735296 9:41097688-41097710 TAGTGGGCATGGAAGGGAGGGGG - Intergenic
1054693083 9:68333709-68333731 TAGTGGGCATGGAAGGGAGGGGG + Intronic
1054791415 9:69260186-69260208 ACCTGGACCTGGAAGAAAGGAGG + Intergenic
1054946306 9:70799539-70799561 CCCTGCACATGGAAACAAGGAGG - Intronic
1055427783 9:76213908-76213930 CCTTGGGCATGAAAGAATGGAGG - Intronic
1055441252 9:76338648-76338670 CTCTGGGCCTTGAAGGATGGGGG - Intronic
1056578409 9:87872808-87872830 CCCTGGGGCTGGGAGGAAGGTGG - Intergenic
1056799296 9:89680367-89680389 CCCTGGGGATGGGAAAAAGGTGG + Intergenic
1057298786 9:93864713-93864735 CCCTGGGTAGAAAAGGAAGGAGG - Intergenic
1057825759 9:98371088-98371110 GCCTGGGGATGGGAGGAGGGTGG - Intronic
1059341786 9:113601445-113601467 CCCTAGCCAGGGAAGGGAGGAGG + Intergenic
1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG + Intergenic
1059541498 9:115134872-115134894 CCCTGAGCATGGAGGGAGGAAGG - Intergenic
1059566263 9:115385683-115385705 CCCTGAGCCTGCAAGGATGGGGG - Intronic
1059915320 9:119093289-119093311 CTGTGGGGATGGAAGGATGGAGG + Intergenic
1060104582 9:120865829-120865851 CCCTGGGCAAGGGGGCAAGGAGG + Exonic
1060359451 9:122941127-122941149 CCCTGGGGTTGGTAGGTAGGAGG - Intronic
1061453996 9:130683991-130684013 CCCTTGGCATCCAAGGGAGGGGG - Intergenic
1061496513 9:130977903-130977925 CCCCAGGGATGGAAGGAAGCTGG + Intergenic
1061715898 9:132518722-132518744 CTCTGGGGATGGGTGGAAGGTGG - Intronic
1061722066 9:132557972-132557994 CCGTGGGCACGGGAGGGAGGTGG - Intronic
1062206819 9:135342093-135342115 CCCTGTCCATGGTAGGAAAGAGG - Intergenic
1062491152 9:136805535-136805557 CCCGGAGCATGGCAGGAGGGTGG + Intronic
1062544560 9:137055660-137055682 CGCTGGGCCTGGAGGGAAGCGGG - Intergenic
1186215984 X:7301717-7301739 CCGTGGGCTTGGGAGAAAGGAGG - Intronic
1189332654 X:40153076-40153098 TCCTGGGCAGGGCAGGAAGCTGG - Intronic
1190117293 X:47634598-47634620 CACTGGGCATGCAAGGGAGAGGG - Intergenic
1190619291 X:52269427-52269449 CCCTGGACAGGGTAGGAAGGTGG + Intergenic
1190642597 X:52495223-52495245 TCCCGGGCATGGGACGAAGGAGG + Intergenic
1190645076 X:52517644-52517666 TCCCGGGCATGGGACGAAGGAGG - Intronic
1190652712 X:52582714-52582736 TCCCGGGCAAGGGAGGAAGGAGG + Intergenic
1190775431 X:53548916-53548938 TCCTGGGGATGGAAGAAGGGTGG - Intronic
1192166866 X:68831981-68832003 CCCTGAGCCTGGATGGAAGGAGG - Intronic
1192181124 X:68916455-68916477 TCCTGGGGAGGGAAGGAAGCCGG - Intergenic
1193918619 X:87399055-87399077 CCATGGGCATGGGAGGAACCTGG + Intergenic
1195240590 X:102947929-102947951 TCCTGGGCATGACAGGAAGTGGG - Intergenic
1195481055 X:105345713-105345735 CCCTGGGCATGAAAAGAAGATGG - Intronic
1195708581 X:107756620-107756642 CCCTGGCCCTGAGAGGAAGGAGG - Intronic
1195933905 X:110107082-110107104 CCAGGGGCAGGGAAGGAAGAAGG + Intronic
1196097621 X:111816791-111816813 CCATTGTTATGGAAGGAAGGTGG + Intronic
1197918387 X:131561006-131561028 CCCTTTGCATGGAGGGAAGGTGG - Intergenic
1199698666 X:150361488-150361510 GCGTGGGCGTGGAGGGAAGGAGG + Intronic
1199715230 X:150503340-150503362 CCCAGGGCCTGGCAGGACGGGGG - Intronic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1201000379 Y:9466819-9466841 GCTTGGGCAGGGAAGGCAGGGGG + Intergenic
1202196676 Y:22305379-22305401 CTCAGGGCATGGAAGGGAGCCGG + Intergenic