ID: 1084956096

View in Genome Browser
Species Human (GRCh38)
Location 11:72692532-72692554
Sequence CTGATAAGGAACCCTATATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084956093_1084956096 3 Left 1084956093 11:72692506-72692528 CCTTTGGAAAATTCTAGAGCATT 0: 1
1: 0
2: 2
3: 27
4: 253
Right 1084956096 11:72692532-72692554 CTGATAAGGAACCCTATATTGGG 0: 1
1: 0
2: 0
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084956096 Original CRISPR CTGATAAGGAACCCTATATT GGG Intronic
902899225 1:19502684-19502706 CAGATCAGGAACCCTATACAGGG - Intergenic
907421626 1:54351668-54351690 CTGTTGAGGAACCCTGTCTTAGG - Intronic
909081447 1:71117455-71117477 CTGCTAAGGAAGCCAAAATTAGG + Intergenic
909168595 1:72262148-72262170 CTGAGAAGGAACCTTTTACTCGG + Intronic
911421528 1:97647297-97647319 CTTATAAGTAATCTTATATTTGG + Intronic
915153196 1:153852008-153852030 CTGCTAGGCAACCCTAAATTGGG - Intronic
1063281989 10:4639870-4639892 CTGTTAGGGAACCCTTTATTAGG + Intergenic
1064977025 10:21127410-21127432 CTGATGAGGAACCTTATAAATGG + Intronic
1074924369 10:118052481-118052503 CAGATGAGGAAACCTAAATTTGG - Intergenic
1080447462 11:32350881-32350903 CTGAGAAGTCACCCTAGATTAGG - Intergenic
1084956096 11:72692532-72692554 CTGATAAGGAACCCTATATTGGG + Intronic
1085501247 11:77026964-77026986 CTGAGATGTAACCCTATCTTTGG - Intergenic
1085953714 11:81365213-81365235 CTAATAAGAAACCCTGTATATGG + Intergenic
1086000231 11:81974708-81974730 ATGCTAAGGAACCATATTTTGGG - Intergenic
1087718107 11:101632390-101632412 CAGAGAAGGAACTTTATATTGGG + Intronic
1092310441 12:7345914-7345936 CTTTTAAAGAACCATATATTGGG + Intergenic
1093205954 12:16249569-16249591 GTGATAAGGTAACCTATTTTTGG - Intronic
1100399536 12:94216916-94216938 CTGGTAAGGAGTCCTATACTGGG + Intronic
1100656254 12:96648886-96648908 CTGATCAAGAACCCTGTTTTCGG - Intronic
1101800298 12:108016136-108016158 CTGATAAGCAAACCCTTATTAGG + Intergenic
1107484312 13:40811715-40811737 CTGCTTAGGAACACTTTATTGGG - Intergenic
1107734628 13:43385675-43385697 ATGATAAACAACCATATATTTGG + Intronic
1112905719 13:104418474-104418496 CAGATATGGAAGCATATATTTGG - Intergenic
1115087917 14:29539322-29539344 CTGATCCTGACCCCTATATTGGG - Intergenic
1116102785 14:40464025-40464047 CTGATAAGGGAACCTACATGGGG + Intergenic
1116261581 14:42635109-42635131 CTAATAAGTTATCCTATATTGGG + Intergenic
1116419700 14:44718861-44718883 CTGATAGGGAACCTGATATGGGG + Intergenic
1118550215 14:66941551-66941573 CAGATCAGGAACCCTATACAGGG + Intronic
1125018689 15:34963307-34963329 ATGAGAATTAACCCTATATTTGG + Intronic
1126085667 15:45009101-45009123 CAGATCAGGAACCCTATACAGGG - Intergenic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1128873777 15:71185195-71185217 CTTATAAGGAATCCTGTATCTGG - Intronic
1133626715 16:7576786-7576808 CTGAGAAGGAAACATAGATTTGG - Intronic
1139566908 16:67783569-67783591 CTAATAAGGAACCTGATATGTGG - Intronic
1203156726 17_GL000205v2_random:11120-11142 GTGTTATGGAATCCTATATTAGG + Intergenic
1156552201 18:38029411-38029433 CTGATGAGAAAGCCCATATTAGG - Intergenic
1166132194 19:40752440-40752462 CTGCTTAGGAACCCAATTTTTGG + Intronic
928538682 2:32264030-32264052 CTGATGAGAAACCTGATATTTGG - Intronic
928635991 2:33247410-33247432 CTGATCTAGAACCCTAAATTTGG - Intronic
933440862 2:82312007-82312029 CTGATAAATAACCCTATACTTGG + Intergenic
939304993 2:140400411-140400433 CTGATAATGTACCCTCTATTGGG + Intronic
939794889 2:146630700-146630722 CTGATCAGGAACATTATAATTGG - Intergenic
941858388 2:170253420-170253442 CTGAAAAGGAACTCTTGATTCGG - Intronic
942001630 2:171653627-171653649 CTGATGATGAACCCAAGATTGGG - Intergenic
945202686 2:207298842-207298864 CTCATAAGGAAACCCATATTAGG + Intergenic
947205894 2:227660881-227660903 CTGAGAAGGAATTCTATACTGGG + Intergenic
948507658 2:238440708-238440730 CTGATAGAGAGCCGTATATTTGG + Intronic
1175382542 20:58573729-58573751 CTGATGAGGAAACTTATACTTGG - Intergenic
1180523502 22:16232354-16232376 GTGATAAGGAATCCTTTATGAGG + Intergenic
951262641 3:20529075-20529097 CTGATAAGGTCCCCTAGATAGGG - Intergenic
952446365 3:33384738-33384760 CTTATAAGAAAGCCTATGTTGGG + Intronic
953304079 3:41810376-41810398 CTCATAAAGAACCCTAGATGAGG - Intronic
955728685 3:61960338-61960360 CTGAAACGGAACCCTTTGTTAGG + Intronic
958736635 3:98016612-98016634 CTGTAAAGGCACCCTTTATTTGG + Intronic
959792868 3:110385637-110385659 CTTATAAGGAACCCTGTCATTGG - Intergenic
959822147 3:110748683-110748705 CTCATAAAGAACCCGAGATTAGG - Intergenic
965488139 3:169303856-169303878 CTGAGAAGGAACTGTTTATTTGG - Intronic
966201354 3:177361949-177361971 CTAGCAAGGAACCTTATATTTGG + Intergenic
966231023 3:177652226-177652248 CTGATAAGGAACTCAACATCAGG - Intergenic
970293368 4:14601392-14601414 CTGAGAAGGCACCCTAAATGTGG + Intergenic
970797938 4:19936826-19936848 CTGCTAAGGAAACCTAAACTAGG + Intergenic
971777389 4:30984386-30984408 TGGATTAGGAAACCTATATTTGG + Intronic
975364205 4:73509723-73509745 CTGGTAAGCATCCTTATATTCGG + Intergenic
975720222 4:77242066-77242088 AAGATAATGAACCCTATCTTGGG - Intronic
981067645 4:140502018-140502040 CTGATCAGGAACCCAAATTTAGG - Intergenic
982521128 4:156417838-156417860 CAGATAAGGGAACCTATATACGG + Intergenic
986414882 5:7518667-7518689 CTCATCAGGAAGCCTAGATTGGG - Intronic
987211388 5:15687198-15687220 TTTATAGGAAACCCTATATTTGG + Intronic
987506977 5:18785511-18785533 CAGTTATGGAACCCTATCTTGGG - Intergenic
996380893 5:122861682-122861704 CTGAAAAGGGACACCATATTGGG - Intronic
999272836 5:150307609-150307631 GTGATCAGGATCCCTATATCAGG + Intronic
999305406 5:150516111-150516133 CTGAAAAGTAGCCCTATCTTTGG - Intronic
1001358403 5:171055714-171055736 CAGATCAGGAACCCTCTATAGGG + Intronic
1004636671 6:17475303-17475325 CTGAAAAGGAACTTGATATTTGG + Intronic
1012221868 6:96658253-96658275 CTGTAAAGGAACTTTATATTTGG - Intergenic
1015082407 6:129243675-129243697 CTGATAAGATAACCTGTATTGGG - Intronic
1015683911 6:135838112-135838134 CTGATAATGAAGGCTATAGTTGG + Intergenic
1020956367 7:14744433-14744455 CAGATTAGGAACCCTGTATGAGG - Intronic
1026999068 7:74639203-74639225 CTGACAAGGAAACTTATGTTTGG - Intergenic
1028132479 7:87192459-87192481 GCAATAAGGAAACCTATATTTGG + Intronic
1028549629 7:92045641-92045663 TTGATAAGAAACCCAAGATTTGG + Intronic
1037406708 8:18550091-18550113 CTGATAAGGGTCACTCTATTGGG - Intronic
1038129148 8:24709737-24709759 CTGATCAGGAATCCTATGTTTGG + Intergenic
1041702841 8:60810676-60810698 GTGACAAAGAAGCCTATATTTGG + Intronic
1041709950 8:60885301-60885323 ATAATAAGTAACACTATATTGGG + Intergenic
1041746231 8:61211793-61211815 ATAATAAGAACCCCTATATTGGG - Intronic
1042036364 8:64538685-64538707 CCAAAAAGGAACCTTATATTAGG - Intergenic
1044346408 8:91109402-91109424 TGGATAAGGCATCCTATATTAGG - Intronic
1045027342 8:98100275-98100297 CTGAAATGGAATCCTTTATTTGG + Intergenic
1047815989 8:128463264-128463286 CTTATTATGAACCCTATGTTGGG + Intergenic
1051554268 9:18365054-18365076 CAGATAATGTACCCTATATAGGG + Intergenic
1055279510 9:74658078-74658100 TTGAGAAGGTACCCTATATCAGG - Intronic
1058159439 9:101552012-101552034 CTGAGAAGGAATCTTTTATTTGG + Intronic
1203496712 Un_GL000224v1:158524-158546 GTGATATGGAATCCTATGTTAGG + Intergenic
1203509335 Un_KI270741v1:100446-100468 GTGATATGGAATCCTATGTTAGG + Intergenic
1191763109 X:64665058-64665080 CTCATAAAGAACCCTAGCTTGGG - Intergenic
1194999609 X:100630210-100630232 CTAATAAGGAACCAGATTTTGGG - Intronic
1198272258 X:135065979-135066001 CTGATAAGGACCCTTCCATTTGG - Intergenic