ID: 1084956187

View in Genome Browser
Species Human (GRCh38)
Location 11:72692881-72692903
Sequence ATGTATGTGCAGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 352}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084956176_1084956187 25 Left 1084956176 11:72692833-72692855 CCAGGACAGCATGTGCAGTGATG 0: 1
1: 0
2: 1
3: 25
4: 154
Right 1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG 0: 1
1: 0
2: 3
3: 32
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084956187 Original CRISPR ATGTATGTGCAGAAGGTGGA GGG Intronic
903273329 1:22205726-22205748 ATGAATGAACAAAAGGTGGAAGG - Intergenic
904049106 1:27627411-27627433 ATCTATGTGCAGACGGATGAGGG - Intronic
906287603 1:44597908-44597930 TTGTATGTGAAGGAGGTAGACGG - Intronic
909162549 1:72172081-72172103 ATGAATCAGCAGTAGGTGGAAGG + Intronic
910434630 1:87192806-87192828 ATGTGTGTGGTGAAGGTTGATGG + Intergenic
911320984 1:96413736-96413758 AGCTATCTGCAGAAAGTGGATGG + Intergenic
912349226 1:108996165-108996187 AGGTATGTGTGGGAGGTGGAAGG - Intronic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
915124515 1:153654313-153654335 TTGTATGTGCAGTAGTTGGATGG + Intergenic
915269303 1:154742291-154742313 GTGTGTGGGCAGTAGGTGGATGG - Intronic
915515307 1:156409304-156409326 ATGTATGAGCAGGGGATGGAAGG + Intronic
916273754 1:162971648-162971670 ATTTAAGTGCACAAGGTGGGTGG + Intergenic
918170283 1:181989765-181989787 ATATGGGTGCAGATGGTGGAAGG - Intergenic
918213035 1:182368398-182368420 ATGTTTGAGGAAAAGGTGGAAGG + Intergenic
918393151 1:184087553-184087575 TTCTATGTGTAGAACGTGGAGGG + Intergenic
919200825 1:194353258-194353280 ATGTATGTGGTGATGGTGAATGG - Intergenic
919282533 1:195509738-195509760 ATTTATGTGGAGATGGTGAAAGG - Intergenic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920720581 1:208382987-208383009 ATGTAAGTGGAGAGAGTGGAAGG + Intergenic
920827039 1:209431935-209431957 CTGTCTGTGCAGCAGGTGCAAGG + Intergenic
921535100 1:216339468-216339490 ATGTAAATGCAGAATGTGGGAGG + Intronic
922083184 1:222318213-222318235 ATGCATGTGGAGAAGGAGGGCGG - Intergenic
924209920 1:241754274-241754296 ATACATGTGCAGAACGTGCAGGG + Intronic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1063023462 10:2154148-2154170 ATGAATGGGCAGCAGGTGGTGGG + Intergenic
1063630374 10:7728143-7728165 AGGTATGTGAAGATGGTGTATGG + Intronic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1064470480 10:15630192-15630214 ATGTTTGTGCAGAATGAGAATGG - Intronic
1066051090 10:31636284-31636306 ATGGAGGTGCAGAGGGTTGAAGG + Intergenic
1068412438 10:56674737-56674759 ATACATGTGCAGAACGTGTAAGG + Intergenic
1068596118 10:58904901-58904923 ATGCACCTGCAGGAGGTGGATGG - Intergenic
1068710796 10:60131727-60131749 GTTGATGTGCAGAAGGTGGGTGG + Intronic
1070215478 10:74375126-74375148 ATTTATATGCAGAAAGTGTAAGG - Intronic
1071714387 10:88080574-88080596 GTGAATGTGCTGAAGATGGATGG + Intergenic
1071836037 10:89417879-89417901 ATGTACATGCAGAAGCTGAAGGG + Exonic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1072387833 10:94950236-94950258 TTGAATGGGCAGAAGCTGGAAGG + Intronic
1072478029 10:95782392-95782414 AGGTATGTCCAGAATGAGGAAGG + Intronic
1072497457 10:95976248-95976270 ATGGGTGAGCAGAAAGTGGAGGG - Intronic
1072619148 10:97068273-97068295 ATGTATGGCCAGGAGGGGGAGGG - Intronic
1072905479 10:99449339-99449361 AAGTCTAGGCAGAAGGTGGAAGG + Intergenic
1072946178 10:99811859-99811881 TTGTGTGTGCAGATTGTGGATGG + Intronic
1073939624 10:108680884-108680906 ATCTCTGTGCAGAAAGTGGCTGG - Intergenic
1074330338 10:112500780-112500802 ATGTATGGGCAAAGGGTGAAAGG - Intronic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1076585759 10:131546434-131546456 GTGCCTGTGGAGAAGGTGGAGGG - Intergenic
1077537557 11:3131754-3131776 ATGGATGGGAAGATGGTGGATGG - Intronic
1078201269 11:9185634-9185656 ATACATGTGCAGAACGTGCAGGG - Intronic
1080164347 11:29219053-29219075 ATACATGTGCAGAACGTGCAGGG + Intergenic
1080634552 11:34112209-34112231 ATGTGTGTGCTGCAGGTGGGTGG + Exonic
1080820233 11:35798852-35798874 ATATATGTATAGAAGGTGTATGG + Intronic
1081075504 11:38668038-38668060 TTATATGGGCACAAGGTGGAGGG + Intergenic
1081992631 11:47346068-47346090 ATGTATGTGGACGAGGTGGGGGG + Intronic
1083190860 11:61051375-61051397 GTGTCTGTGCAGAAGGGGGTGGG - Intergenic
1083689454 11:64398163-64398185 TGATCTGTGCAGAAGGTGGAAGG + Intergenic
1084005970 11:66323769-66323791 ATGCTTGGGCAGAAGATGGATGG + Intergenic
1084162202 11:67356027-67356049 AAGAAGGTACAGAAGGTGGATGG - Intronic
1084185107 11:67467409-67467431 GTGAATGTGAAGGAGGTGGAGGG + Intronic
1084799909 11:71536740-71536762 AAGTATGTGCAGAGGCTGGTAGG + Intronic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1085254847 11:75166626-75166648 ATGGATGAGTAGTAGGTGGATGG - Intronic
1085390675 11:76180555-76180577 GTGTATGTGCAGGAGGTGGTGGG + Intergenic
1088683033 11:112260699-112260721 ATGTATATTCAGAAGGGGCAGGG - Exonic
1089360267 11:117881124-117881146 ATGAATGTGGAGAAGTTGGTTGG - Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090751392 11:129749186-129749208 AAGTATGTGCAGGAGGCAGAAGG - Intergenic
1092105170 12:5916308-5916330 ATGTACATGCAGAACGTGAATGG + Intronic
1093756905 12:22862900-22862922 ACGTAGGGGTAGAAGGTGGAGGG + Intergenic
1095236487 12:39802322-39802344 ACGTATGTGAAGATGGTGGAAGG + Intronic
1096418013 12:51430483-51430505 ATGTGTGAGGAGAGGGTGGAGGG - Intronic
1097946933 12:65379222-65379244 ATGGATGGGTAGATGGTGGATGG - Intronic
1099899736 12:88693086-88693108 TCGTGTGTGCAGAAGGGGGAGGG + Intergenic
1100056632 12:90519578-90519600 ATGTATGTGGAGAGGGAGGATGG - Intergenic
1100176730 12:92039054-92039076 GTGTATCTGTAGAAGTTGGAAGG - Intronic
1100457204 12:94763995-94764017 ATGTATTTGTACAAGGTGGGTGG + Intergenic
1100861464 12:98811322-98811344 ATGGATGTGCAGAAGGAGTCTGG - Intronic
1100875119 12:98953593-98953615 AGGAATGTGCATGAGGTGGAGGG - Intronic
1101397368 12:104360138-104360160 ATGTATGTGTAGAGGTTGGGGGG - Intergenic
1101569168 12:105937215-105937237 ATGTTTGTGCATGAGGTGGGAGG - Intergenic
1101655411 12:106715979-106716001 ATGTCTGAGAAGCAGGTGGATGG + Intronic
1102060914 12:109930433-109930455 ATCCATGTGCAAAAGGTGGCTGG + Exonic
1102361993 12:112296138-112296160 GTGTAGGTGCAGCAGGTGGTAGG + Intronic
1102362002 12:112296199-112296221 ATGTAGGTGCAGACAGTGGTAGG + Intronic
1103006201 12:117422360-117422382 ATGTATGAATAGATGGTGGATGG - Intronic
1104555769 12:129798682-129798704 ATGAATGTGCAGAAGAGAGAAGG + Intronic
1107346781 13:39470032-39470054 ATGTATCTGCAGAACTTAGAGGG + Intronic
1107425690 13:40290360-40290382 TTGTGTCTGCACAAGGTGGAGGG - Intergenic
1107750199 13:43557276-43557298 ATGTATGGCCAGAAGGTGGTAGG + Intronic
1108707543 13:53003271-53003293 ATGTATGTGTAGGAGTTGGGTGG - Intergenic
1108761396 13:53570165-53570187 ATGGATATGCAGAAAGGGGAAGG - Intergenic
1110360130 13:74615367-74615389 ATGAATGTGTACCAGGTGGAGGG + Intergenic
1111738568 13:92173784-92173806 AAATATTTGCAGAATGTGGAAGG + Intronic
1111806997 13:93050493-93050515 ATGTATTGGCACAACGTGGATGG + Intergenic
1112111881 13:96310393-96310415 TTGGGTTTGCAGAAGGTGGAAGG + Intronic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1115646429 14:35371452-35371474 AAGTGTGTGCTGAATGTGGATGG + Intergenic
1116332873 14:43616999-43617021 ATATGTGTGCAGAATGTGCAGGG - Intergenic
1116412432 14:44640835-44640857 TTGTATGTGAAGGAGGAGGAAGG + Intergenic
1117363317 14:54999336-54999358 ATGCATGTGAAGATGGGGGAGGG + Intronic
1118666733 14:68077988-68078010 TTATATGTACATAAGGTGGAAGG + Intronic
1118763150 14:68892820-68892842 ATGGTGGTGGAGAAGGTGGAGGG + Intronic
1121396302 14:93626282-93626304 GTGTAGGTGCAGAAGCTGGAAGG - Intronic
1121894368 14:97632041-97632063 ATGCCAGTGGAGAAGGTGGATGG - Intergenic
1126004470 15:44243182-44243204 ATGTATGTGTAGGAGGCCGATGG - Intergenic
1126903604 15:53340228-53340250 ATACATGTGCAGAACGTGCAGGG + Intergenic
1127406610 15:58655349-58655371 AAGCATGGGCAGAAGGTGAAGGG + Intronic
1127818370 15:62632790-62632812 GTGGTTGTGCAGAATGTGGAGGG + Intronic
1128809980 15:70563699-70563721 AGGTAAGTGCTGAAGCTGGAAGG - Intergenic
1129785723 15:78308917-78308939 AGGTATGTGCAGAGGATGGGAGG - Intergenic
1131933100 15:97467975-97467997 ATGTATCTGCAGGAGGGGGATGG + Intergenic
1132451354 15:101970348-101970370 ATATAAATACAGAAGGTGGAGGG - Intergenic
1134475617 16:14570900-14570922 ATTTATGCCCAGAAGGTTGAGGG + Intronic
1135489757 16:22899194-22899216 ATGAGGGTGCAGATGGTGGAGGG + Intronic
1135513679 16:23111338-23111360 ATGAATGTGGAGAGGGAGGAAGG + Intronic
1138000019 16:53268529-53268551 ATTTATATGCACAAGGAGGAGGG - Intronic
1139380866 16:66529823-66529845 ATGGATGGGCAGAGGATGGATGG - Intronic
1139878395 16:70164516-70164538 ATGAATGGGCAAAAAGTGGAGGG + Intergenic
1140359169 16:74330300-74330322 ATGAATGGGCAAAAAGTGGAGGG - Intergenic
1140461891 16:75146576-75146598 ATGTATCTTCAGTAGGTGAATGG + Intergenic
1203137880 16_KI270728v1_random:1740859-1740881 GTATATGTGCAGAATGTGCAGGG + Intergenic
1143005797 17:3832739-3832761 ATATATCTGCAGAAGAAGGATGG - Intronic
1143346885 17:6256271-6256293 ATGTATGTGGAGAAGAGGGAGGG + Intergenic
1145805844 17:27728827-27728849 ATACATGTGCAGAACGTGCATGG + Intergenic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1147484756 17:40801861-40801883 ATGGAAGTGAAGAAGGAGGATGG + Intergenic
1150901983 17:69289591-69289613 ATGTATGTGTGGAAGTGGGAGGG + Intronic
1151278724 17:73055866-73055888 ATTTATGGACAGAAGATGGAAGG - Intronic
1151412978 17:73943277-73943299 ATGTATGTGCAGAGAGGGGCAGG - Intergenic
1152437772 17:80286669-80286691 ATGTGGGTGCAGGAGGTGGGGGG + Intronic
1153521281 18:5956377-5956399 ATGTATTTGCAGCAGATCGATGG - Exonic
1153823104 18:8849203-8849225 GTGTATGATCAGAAGTTGGAAGG - Intergenic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1156111912 18:33738577-33738599 CTGTCTGTGCAGAAACTGGAAGG - Exonic
1156132811 18:33998875-33998897 ATGTAAGTGAAGCATGTGGAAGG - Intronic
1157049273 18:44141930-44141952 ATGTATCTTCACATGGTGGAAGG - Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158190077 18:54817714-54817736 CTGACTGTGTAGAAGGTGGATGG - Intronic
1158464843 18:57680896-57680918 ATGTGAGAGCAGAATGTGGAAGG - Intronic
1158622617 18:59046218-59046240 ATGTATGTAAAGAACTTGGAAGG + Intergenic
1159112973 18:64081927-64081949 ATGGCTGTGATGAAGGTGGAGGG + Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160135826 18:76270939-76270961 AGGTATGGAGAGAAGGTGGACGG - Intergenic
1160588045 18:79923354-79923376 ATGCATGGGCAGGTGGTGGATGG + Intronic
1160681819 19:415181-415203 ATGGATGTGTAGATGGGGGATGG + Intergenic
1160681860 19:415434-415456 ATGGATGTGTAGATGGGGGATGG + Intergenic
1161641105 19:5423865-5423887 ATGTTTGGGCAGATGGTGGGTGG - Intergenic
1163382599 19:16978805-16978827 ATGGATGGGTAGATGGTGGATGG - Intronic
1163571257 19:18083697-18083719 ATGGATGGGTAGATGGTGGACGG - Intronic
1163609862 19:18295226-18295248 ATGAATGGGTAGATGGTGGATGG - Intergenic
1163609880 19:18295299-18295321 GTGGATGGGCAGATGGTGGATGG - Intergenic
1163779448 19:19238935-19238957 ATGGATGAGCAGAAGGCAGAGGG - Intronic
1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG + Intergenic
1165424009 19:35735833-35735855 GTGGATGTGAAGAAGGGGGATGG - Intronic
1165773261 19:38390282-38390304 ATGTACCTGCAGGAGGTGGGGGG - Exonic
1166040841 19:40201832-40201854 ATACATGTGCAGAACGTGCAGGG + Intronic
1166422681 19:42651070-42651092 CTGTATCTGCACATGGTGGAGGG - Intronic
1168414308 19:56159028-56159050 ATGAATGTACAGATGATGGATGG - Intronic
1168414333 19:56159147-56159169 ATGAATGTACAGATGATGGATGG - Intronic
1168414362 19:56159300-56159322 ATGAATGTACAGATGATGGATGG - Intronic
1168467076 19:56611556-56611578 ATCTCTGTGCAGAGTGTGGAAGG + Intronic
925090838 2:1154783-1154805 ATGTATGTGTTGGAGGTAGAAGG - Intronic
925260202 2:2522066-2522088 ATGGATGGGCAGATGGGGGATGG - Intergenic
925358552 2:3261341-3261363 ATGAATGAGCAGAAGGCTGAGGG + Intronic
925537988 2:4936848-4936870 ATGATGGGGCAGAAGGTGGAGGG + Intergenic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
926175598 2:10588921-10588943 ATGGAGGTGCAGAGGGTGGAGGG - Intronic
927277012 2:21270973-21270995 CTGGAGGTGCAGAAGCTGGAGGG - Intergenic
927882927 2:26701371-26701393 AGGGAAGTGGAGAAGGTGGATGG + Intronic
928635638 2:33243097-33243119 ATGTCTGGGCAGGAGCTGGATGG - Intronic
928685973 2:33749068-33749090 ATACATGTGCAGAAGGTGCAGGG - Intergenic
929376977 2:41299298-41299320 GTGTATGTGCAGGAGGTGGAGGG - Intergenic
930443418 2:51438199-51438221 CTGTGTGTGCAGTGGGTGGAGGG + Intergenic
931211457 2:60200640-60200662 ATATATGTGCAGAACGTGCAGGG + Intergenic
931914585 2:66939737-66939759 ACTTATGTGCAAAATGTGGAAGG + Intergenic
933257844 2:80100808-80100830 ATGTATGCTCAGAAGGTTGAAGG - Intronic
937118722 2:119427525-119427547 ATGAATGTGCATAAGGTGTCAGG - Intergenic
939394324 2:141608849-141608871 ATGTAATTGATGAAGGTGGATGG + Intronic
940726076 2:157338022-157338044 AAGTCTGTGCAGAAGGAGCATGG - Intergenic
940864018 2:158798890-158798912 ATGTATGTGAAAAAGCTGAAAGG - Intronic
941733674 2:168948310-168948332 ATGTTAGTGTAGAAGGTGTAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942309399 2:174641188-174641210 ATCCATGTGCAGAAGGATGAGGG + Intronic
943910277 2:193556442-193556464 ATGTATTTTCAGAAGGAGGTAGG - Intergenic
946045897 2:216820733-216820755 ATGTATCTTCACATGGTGGAAGG - Intergenic
947640668 2:231706293-231706315 ATGGATGCGCCGCAGGTGGAAGG + Intergenic
948004036 2:234592525-234592547 ATACACGTGCACAAGGTGGAGGG + Intergenic
948197512 2:236106633-236106655 ATGCATTTGGAGAAGGTGGCTGG + Intronic
1168787967 20:556298-556320 ACGTATATGGAGAGGGTGGAGGG + Intergenic
1170638823 20:18133873-18133895 TTGTTTGGGAAGAAGGTGGAGGG - Intergenic
1172623971 20:36336958-36336980 ATGTATTTGCTGTAGGAGGAGGG - Intronic
1172861457 20:38056541-38056563 ATGTATCTGCAGCAGGTGCCTGG + Intronic
1174829660 20:53800939-53800961 ATCTATTTGCAGAATCTGGAGGG + Intergenic
1175779238 20:61671835-61671857 ATGCATGGGTGGAAGGTGGATGG + Intronic
1175813334 20:61870512-61870534 AGGGACATGCAGAAGGTGGAGGG - Intronic
1175817413 20:61890569-61890591 ATGGATGTGCAGATGATGGATGG + Intronic
1177095269 21:16824412-16824434 ATGTATGTTCAGGAGCTGGTGGG + Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1178969396 21:37158445-37158467 ATGTTTGGGGTGAAGGTGGAAGG - Intronic
1179009571 21:37545920-37545942 ATGTAGGTCCACAAGGTGGATGG + Intergenic
1180552700 22:16553416-16553438 GTATATGTGCAGAATGTGCAGGG + Intergenic
1182107469 22:27699580-27699602 ATTAATGTGGAGAAGGTGCATGG - Intergenic
1183066703 22:35368482-35368504 ATGGATGAGGAGAAGGTTGAGGG - Intergenic
1183096102 22:35553212-35553234 CTGTGTGTGCAGAAGGTGGTGGG - Exonic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1183812826 22:40272222-40272244 CTGTCTGTGCACAAGGGGGAGGG - Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
952594413 3:34998773-34998795 ATTTACATGCAGAAGATGGAAGG - Intergenic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
953794729 3:45975874-45975896 AAACATGTGCAGAAGGAGGAAGG + Intronic
954347004 3:50008466-50008488 ATGTATGTTCAGATGGTATAGGG + Intronic
954463717 3:50642286-50642308 ATGGCTGTGCAGAAACTGGATGG - Exonic
954673111 3:52301160-52301182 ATGTTTGTGGAGATGGTGGCAGG + Intergenic
955203702 3:56876179-56876201 CTGCATGTGTAAAAGGTGGAAGG + Intronic
955837729 3:63076008-63076030 GTGTGTGTGTAGGAGGTGGAGGG + Intergenic
956022844 3:64950563-64950585 ATGTATGTACAGTGGGTGCAAGG - Intergenic
956177956 3:66491378-66491400 AGCTATGTGGAGAAAGTGGAAGG + Intronic
956444302 3:69310448-69310470 AATTATCTGCAGAAAGTGGAAGG + Intronic
957311431 3:78524350-78524372 ATTTATTGGCAGAAGATGGAAGG + Intergenic
957403914 3:79752549-79752571 AGGTGTGTGCAGAGGGTGAAAGG + Intronic
959496870 3:107061771-107061793 TTGTATGTGCACATGATGGAAGG - Intergenic
959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG + Intronic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
962035890 3:131651184-131651206 ATGTATGGGAAGAAAGGGGAAGG - Intronic
963410241 3:144918158-144918180 AGGCATGTGCAAAAGGTAGATGG - Intergenic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
963777519 3:149453897-149453919 ATGTATGTGCACAAAGGGAAGGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964739954 3:159954716-159954738 ATGTATGAACAGAAGGAGGCAGG + Intergenic
966912674 3:184568343-184568365 ATGTATCTGCAGGAGGCAGAGGG - Intronic
967144938 3:186598511-186598533 ATGTGTGTGAAGGAGGAGGAAGG - Intergenic
967519294 3:190410235-190410257 AAGTGTGTGCATAAGGTGGAAGG - Exonic
968598395 4:1497092-1497114 ATGGATGTGTAGATGATGGATGG + Intergenic
968598421 4:1497265-1497287 ATGGATGTGTAGATGATGGATGG + Intergenic
968598451 4:1497471-1497493 ATGGATGTGTAGATGATGGATGG + Intergenic
969100605 4:4765416-4765438 ATGGAAGTGGAGAAGGTGGCAGG - Intergenic
969186756 4:5480320-5480342 ATATATGTGCCCAAGGTGGTCGG + Intronic
969275497 4:6132902-6132924 ATGAATGTGTAGAAGTTGGCTGG - Intronic
969745390 4:9066896-9066918 AAGTTTTTGCTGAAGGTGGATGG - Intergenic
970542146 4:17090874-17090896 AGGTATTTGCAGAAGGTCCATGG - Intergenic
972412639 4:38808281-38808303 ATGTGTGTGCAGAAAGAGGTAGG + Intronic
972726288 4:41748658-41748680 ATGGATATGGAGAAGGTGGCTGG + Exonic
973204558 4:47545797-47545819 ATATATGTGTAGATGGTGGTAGG + Intronic
975497856 4:75054327-75054349 ATGGATGTTCAGAAGGAGGATGG - Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
978042769 4:104090694-104090716 ATATTTGTGCAGAAGCTGCAAGG + Intergenic
978420412 4:108526764-108526786 GAATATGTGGAGAAGGTGGAAGG - Intergenic
978445228 4:108773761-108773783 ATGTATGTACAGAAAGTAAAAGG - Intergenic
978498516 4:109384933-109384955 AGGTATGTGGACAAGTTGGAGGG - Intergenic
978566226 4:110085157-110085179 ATGTATGTGCATGCGTTGGAGGG + Intronic
982551934 4:156813040-156813062 ATGTGTGTGCGGGATGTGGAAGG + Intronic
983463964 4:168063254-168063276 AAGGATGTGGAGAAAGTGGAAGG + Intergenic
983763229 4:171440437-171440459 GTGTAGGGGCAGAAGGGGGATGG - Intergenic
984117444 4:175699642-175699664 ATGTATGTGTGGGGGGTGGAGGG + Intronic
985168615 4:187124478-187124500 TTCTGTGTGCAGGAGGTGGACGG - Intergenic
986822427 5:11482317-11482339 TTGTATGTGTAGGTGGTGGAGGG - Intronic
987415956 5:17662619-17662641 ATGTATATGTAGGAGGTGGCTGG + Intergenic
987540335 5:19246647-19246669 ATACATGTGCAGAACGTGCAGGG - Intergenic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
988232472 5:28498029-28498051 ACGTATGTCCAGGAGGTGGCGGG + Intergenic
989177638 5:38544337-38544359 GTGTATGTGAAGAGTGTGGAAGG - Intronic
990100751 5:52183409-52183431 ATACATGTGCAGAACGTGCAGGG - Intergenic
990254636 5:53954288-53954310 AGGTATTTGCAGATGATGGATGG - Intronic
990311488 5:54543229-54543251 ATGGAGGTGCAGAAGGCTGACGG + Intronic
992458084 5:76934603-76934625 ATAAAAGGGCAGAAGGTGGAAGG + Intergenic
992511307 5:77438338-77438360 ATGTATTTGCTGCAGTTGGAAGG - Exonic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994192914 5:96888301-96888323 ATGGATGTGCAGGAGGTGAATGG + Intronic
994295365 5:98082816-98082838 AAGTATGTGCATCAGGTGGGAGG - Intergenic
995269560 5:110205495-110205517 AGCTATGTGCAGAAGATGGCAGG + Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
997146832 5:131443562-131443584 AGGTTTGTGCAGAAGGAGAAGGG - Intronic
997280708 5:132642971-132642993 ATGTAGGAGAAGAAGGTGGTGGG - Exonic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1001160857 5:169311430-169311452 ATGTATGGGCCGCAGGGGGAAGG - Intergenic
1002805684 6:571996-572018 GTGTGACTGCAGAAGGTGGACGG + Intronic
1003476014 6:6483661-6483683 ATATATGTTCAGAAGTGGGATGG - Intergenic
1003692121 6:8365148-8365170 ATCTCTGTGCAGAGGGAGGATGG - Intergenic
1003794303 6:9582614-9582636 ATGTGTCTGCAAATGGTGGATGG + Intergenic
1004412285 6:15391921-15391943 ATGCTTTTGCAGAATGTGGAGGG + Intronic
1004902140 6:20204675-20204697 GTGTGTGTGCAGAGGCTGGAGGG + Intronic
1004942730 6:20577945-20577967 ATGGATGTCAAGAAGATGGATGG + Intronic
1005629909 6:27697538-27697560 ATGTATGTGCTTATGGTAGAGGG + Intergenic
1005959204 6:30684255-30684277 GTGTATGTGCAGAGCGAGGAAGG + Intronic
1006114806 6:31769908-31769930 ATCTAGGTGCTGAAGGTGGTGGG + Intronic
1008597748 6:53060354-53060376 ATCTAGGTTCAGATGGTGGAGGG - Intronic
1008868032 6:56238657-56238679 AGGTATCTGCTGAAGGTGGCAGG - Intronic
1008927562 6:56902913-56902935 GTGTGTGTGTAGAGGGTGGAGGG - Intronic
1009609216 6:65917520-65917542 ATGAATGTAATGAAGGTGGAGGG + Intergenic
1010575460 6:77524446-77524468 ATACATGTGCAGAAGGTGCAGGG - Intergenic
1010712582 6:79192516-79192538 ATGTCTGAGCAGAAGGTTGATGG - Intergenic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011203986 6:84871943-84871965 GTGTGTGTGCGGAGGGTGGAGGG + Intergenic
1011555968 6:88571859-88571881 ATGTATGTGAAGATGATGGAAGG + Intergenic
1012096640 6:94970862-94970884 GTGTATGTGGAGAAGGAAGAGGG + Intergenic
1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG + Intergenic
1012118087 6:95330297-95330319 GTGTATGTGCCCAAGGTGGTTGG + Intergenic
1013787771 6:113800904-113800926 GTGTAGGTGGAGAAGGGGGACGG + Intergenic
1014085341 6:117335922-117335944 ATACATGTGCAGAACGTGCAGGG - Intronic
1014140954 6:117941349-117941371 ATGAATGTACACAATGTGGAAGG - Intronic
1015146336 6:129991601-129991623 ATGTACTTGGAGAAGGTGGTAGG - Intergenic
1015373836 6:132487601-132487623 ATACATGTGCAGAACGTGCAGGG - Intronic
1015991206 6:138945315-138945337 ATGTGTGTGGAGAAGTTGGTGGG + Exonic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1018105749 6:160484532-160484554 ATGTATTGGCCAAAGGTGGAAGG - Intergenic
1018792856 6:167162688-167162710 ATGTATGGGCAGGAGGGGTATGG + Intronic
1019194030 6:170271004-170271026 ATGAAAGTGAAGAAGGTGGCCGG - Intergenic
1020506733 7:8999443-8999465 ATGCATGTGAAGAAGTTGTAGGG - Intergenic
1020890698 7:13874440-13874462 GTGTCAGTGCAGAATGTGGAAGG + Intergenic
1021200861 7:17727255-17727277 ATACATGTGCAGAACGTGAAGGG - Intergenic
1021733895 7:23623911-23623933 ATATATGTGCAGGATGTGCAGGG - Intronic
1024225136 7:47320763-47320785 AGGAATGTGCAGGGGGTGGAGGG + Intronic
1024945288 7:54801895-54801917 ATTTATATACAGGAGGTGGATGG - Intergenic
1027987884 7:85318128-85318150 ATGTAGGTGGATATGGTGGAAGG + Intergenic
1029192471 7:98781434-98781456 ATGAATGTGCACAAGGTCTAGGG + Intergenic
1029618479 7:101675116-101675138 CTGGATGTGCAGAAGGGGGTCGG - Intergenic
1030375162 7:108745657-108745679 ATGCACCTGCAGAAGGTGGTTGG + Intergenic
1030981602 7:116191529-116191551 ATCTATGGGGAGAAGATGGAGGG - Intergenic
1031999514 7:128255609-128255631 ATGTTTGGGCAGAAGGGAGAAGG + Exonic
1035380765 7:158439246-158439268 AGGCATGCGCAGGAGGTGGACGG - Intronic
1035495057 7:159317451-159317473 ATTTATGGGCAGAAAATGGAAGG - Intergenic
1037924144 8:22831608-22831630 ATGTGTGTGCAGAGGGTCCAAGG + Intronic
1038499164 8:28029186-28029208 AAGCGAGTGCAGAAGGTGGAAGG - Intronic
1039033355 8:33332905-33332927 AGATATGTGCAGATTGTGGATGG - Intergenic
1039789894 8:40867120-40867142 ATGCAGGTGCAGAAGGTCTAGGG - Intronic
1040420582 8:47236488-47236510 ATGTATGGGCAGAAGGTACATGG + Intergenic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1041811905 8:61921183-61921205 ATGTGTGTGCAGGAGGTGTACGG - Intergenic
1042489597 8:69381907-69381929 ATGTACCTGCAGGAGGTGGCTGG - Intergenic
1043457084 8:80423287-80423309 ATTTAAGGGGAGAAGGTGGAGGG - Intergenic
1043461534 8:80465230-80465252 AGGGATGTGGAGAAAGTGGAAGG + Intergenic
1043681220 8:83027092-83027114 GTGTATGTGTGAAAGGTGGATGG - Intergenic
1044254044 8:90039091-90039113 AAGTATGAGAAGAAGGTTGATGG - Intronic
1044381418 8:91538289-91538311 ATACATGTGCAGAACGTGCAGGG - Intergenic
1044822833 8:96168563-96168585 ATACATGTGCAGAACGTGCAGGG + Intergenic
1044832934 8:96267878-96267900 ATGTGTGGGCAGGAGGTGGCGGG - Intronic
1044844417 8:96366254-96366276 ATTTATGTGCAGAAAGTTTATGG + Intergenic
1046705405 8:117444456-117444478 TTGTGTTTGGAGAAGGTGGAAGG + Intergenic
1047454577 8:124997942-124997964 GTGTATGTGGAGAGGGCGGAAGG - Intergenic
1048626159 8:136187667-136187689 CTGTATCTGCAAAAGGTGGCAGG + Intergenic
1048989500 8:139752987-139753009 ATGGATGGGTAGAAGTTGGATGG - Intronic
1049350636 8:142162657-142162679 ATGGATGGGCAGAGGATGGATGG + Intergenic
1049632520 8:143666337-143666359 ATGTGTGTGCACACGGAGGAGGG - Intergenic
1049632573 8:143666582-143666604 ATGTGTGTGCACACGGAGGAGGG - Intergenic
1049632661 8:143666978-143667000 ATGTATGTGCACATGGAGGAAGG - Intergenic
1052328823 9:27246074-27246096 AGGTATGAGAAGAAAGTGGAGGG + Intergenic
1052361492 9:27565467-27565489 ATGTATCTGTATAAGGTTGATGG - Intronic
1052487819 9:29125384-29125406 ATACATGTGCAGAACGTGCAGGG - Intergenic
1053145476 9:35709060-35709082 ATGCATTTTCAGAAGGTGGGGGG + Intronic
1053198806 9:36138986-36139008 ATGGATGGAGAGAAGGTGGAGGG + Intronic
1053390924 9:37735535-37735557 CTGTAACTGCAGAGGGTGGAAGG - Exonic
1055058046 9:72041527-72041549 CTGTCTTTGCAGACGGTGGAAGG + Intergenic
1055092949 9:72381126-72381148 ATGTATCTGGAGCAGGTGGGTGG + Intergenic
1056125861 9:83536439-83536461 ATGAATGTGTAGATGATGGAGGG - Intronic
1056200758 9:84274080-84274102 CTGCATGACCAGAAGGTGGAAGG + Intergenic
1057004110 9:91541060-91541082 ATACATGTGCAGAACGTGCAGGG - Intergenic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1058940339 9:109807515-109807537 ATATATGTTCACATGGTGGAAGG + Intronic
1058983724 9:110193146-110193168 AAGTTTGTGAAGAATGTGGAGGG + Intronic
1059123642 9:111663313-111663335 ATGTGAGTGCTGAAGGTGAACGG + Intronic
1060896049 9:127218309-127218331 AGGTGTGTGCAGAGGGTGGGTGG - Intronic
1185532880 X:835728-835750 GTATATGTGCAGAATGTGCAGGG + Intergenic
1185993457 X:4916950-4916972 ATGTAGGGGCAGAATGTAGAAGG - Intergenic
1186181656 X:6979307-6979329 ATGTGTGTGGAGGAGGTGGTGGG - Intergenic
1186483403 X:9913547-9913569 TTGTGTGTGCAGAGGGTCGATGG + Intronic
1187254982 X:17634468-17634490 ATCTGTGTGCAGAAGCTGAAAGG - Intronic
1187887448 X:23902863-23902885 ATGTTTGTGCAGAGTGGGGATGG - Intronic
1190449508 X:50564248-50564270 ATATATGTCCAGGAGGTGGTTGG + Intergenic
1191074920 X:56442460-56442482 ATGCATATGCAGAAGGTGCAGGG - Intergenic
1192702639 X:73492070-73492092 ATATGTGTGCAGAATGTGCAGGG + Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194098350 X:89671916-89671938 ATACATGTGCAGAACGTGGAGGG + Intergenic
1194396557 X:93393977-93393999 ATACATGTGCAGAACGTGCAGGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1195438668 X:104875733-104875755 CTGTATGTGTGTAAGGTGGATGG - Intronic
1197341233 X:125268016-125268038 TTGTATGCACAGAAGGTGGTAGG - Intergenic
1198042696 X:132869813-132869835 ATGAATGGGCAAAAGCTGGAAGG + Intronic
1198135636 X:133747322-133747344 ATGTTTGTGCAGGTGATGGAAGG - Intronic
1198147736 X:133874402-133874424 ATATATGTGCATAAAATGGAAGG - Intronic
1199665200 X:150090944-150090966 GAGAATGTGGAGAAGGTGGATGG + Intergenic
1199769471 X:150965215-150965237 ATGTGTGTGCAGTTGGTGGGTGG + Intergenic
1200406479 Y:2817036-2817058 ATGAATGAGCAAAAGCTGGAAGG - Intergenic
1200451373 Y:3333294-3333316 ATACATGTGCAGAACGTGGAGGG + Intergenic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic