ID: 1084956810

View in Genome Browser
Species Human (GRCh38)
Location 11:72695981-72696003
Sequence CAGGGTAGGAACAGTTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084956803_1084956810 13 Left 1084956803 11:72695945-72695967 CCAAGACTGGTCTGGTCAGAGGG 0: 1
1: 0
2: 2
3: 11
4: 101
Right 1084956810 11:72695981-72696003 CAGGGTAGGAACAGTTTTTCTGG 0: 1
1: 0
2: 0
3: 16
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084956810 Original CRISPR CAGGGTAGGAACAGTTTTTC TGG Intronic
902416667 1:16243814-16243836 CAGGGCTGGGACAGTTGTTCGGG - Intergenic
904339002 1:29820825-29820847 CAGTTTAGGAACAGTTTTTTTGG + Intergenic
904884471 1:33726045-33726067 CAGGCCAGGAACACTTTGTCCGG + Intronic
906073646 1:43035986-43036008 CAGGGTGGGAGCAGTCTGTCCGG - Intergenic
907362537 1:53930566-53930588 AAGGGGAAGAACGGTTTTTCAGG - Intronic
908675886 1:66603192-66603214 CAAGGTATTAACAGTTTCTCAGG + Intronic
910078985 1:83316570-83316592 CAGGGTCAAAACAGTTTTTCTGG - Intergenic
910378631 1:86600887-86600909 AAGGGTATGAAAATTTTTTCTGG - Intergenic
911285700 1:95989449-95989471 CTGGTTTGGAAAAGTTTTTCTGG + Intergenic
911811080 1:102282952-102282974 CATTGTAAGAACAGTTTTTTTGG - Intergenic
912061997 1:105685726-105685748 CAGGATAGTAACAATTTCTCTGG + Intergenic
912190258 1:107330312-107330334 CAAGTGAGGAACAGTTTTTAAGG + Intronic
912524087 1:110267863-110267885 CAAGGAAGGGGCAGTTTTTCTGG - Intronic
915627011 1:157120201-157120223 CAAGGTAGTCACAGTTTCTCAGG + Intergenic
917046652 1:170867993-170868015 CAGGGCAGGAACAGTGGTGCTGG + Intergenic
920221033 1:204400897-204400919 CAGCTTTGGAACAATTTTTCAGG - Intergenic
921163636 1:212490659-212490681 CAGGGTAGGATTAGTTATTTAGG + Intergenic
924244999 1:242075239-242075261 GAGAATAGGAACAGCTTTTCTGG - Intergenic
924532612 1:244906011-244906033 AAGGGTAAGAACATTTTTTAAGG + Intergenic
924660810 1:246015076-246015098 CGGGGTAGGAACTGATTTTTAGG - Intronic
1066367854 10:34793882-34793904 CAGGGGATAAACAGTTTTTCAGG - Intronic
1066791483 10:39069323-39069345 CAGGTTGGAAACAGTCTTTCTGG + Intergenic
1066793202 10:39089150-39089172 CAGGCTGGAAACAGTCTTTCTGG + Intergenic
1067056906 10:43057792-43057814 CAGGGAAGTAACAGTATTTTTGG - Intergenic
1067184157 10:44012949-44012971 CAGGTCAGAAACTGTTTTTCAGG - Intergenic
1069053413 10:63818217-63818239 CAGGTTAGGTGCAGTTTTTTTGG + Intergenic
1070096974 10:73346914-73346936 CTGGATAAGAACAGTTTTTGTGG + Intronic
1072862166 10:99017941-99017963 TAGGGTAGTAAAAGTTTTTAAGG - Intronic
1072892333 10:99335003-99335025 CAGGGAAAGAACAGGCTTTCGGG - Intronic
1073463431 10:103679648-103679670 CAGGGTGGGACAAGTTCTTCTGG - Intronic
1078179423 11:8998466-8998488 CAGAGTAGGAAGAATTTTACAGG - Intronic
1084488658 11:69465738-69465760 CTGGGCATGAAAAGTTTTTCAGG + Intergenic
1084956810 11:72695981-72696003 CAGGGTAGGAACAGTTTTTCTGG + Intronic
1085930193 11:81072330-81072352 AAGGTCAGGAACAGTTTTTGAGG + Intergenic
1086724907 11:90169908-90169930 CAGGGTGGAAATAGTTCTTCAGG - Intronic
1086996734 11:93366439-93366461 CATGGCTGGAAAAGTTTTTCTGG - Intronic
1087285118 11:96256646-96256668 GAGGTTAGGAACTGTGTTTCTGG + Intronic
1088107579 11:106223916-106223938 CACGGTAGGAACATTTTGACCGG - Intergenic
1088381426 11:109197814-109197836 CAGGGTAGAATCAGTTTATCTGG + Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1089634535 11:119803863-119803885 CAGGGAAGGAAAGGTGTTTCTGG - Intergenic
1090235986 11:125147392-125147414 CAGGGTGGGAAGAGTCTTTAAGG + Intergenic
1091844533 12:3645667-3645689 CTGGGTAAGAACCGTTTTTTTGG + Intronic
1093195568 12:16126254-16126276 CAGGGAAAGAACTGGTTTTCTGG - Intergenic
1094018756 12:25891866-25891888 CAGGCTGGGCACAGTGTTTCAGG - Intergenic
1095073009 12:37880527-37880549 CAGTTTGGGAACAGTCTTTCTGG - Intergenic
1097945879 12:65366901-65366923 GAGAGTGGGAACAGTGTTTCAGG + Intronic
1099073829 12:78080488-78080510 AAGGGTAGGAAAAGTATCTCTGG - Intronic
1099631878 12:85159535-85159557 GAAGGTGAGAACAGTTTTTCCGG + Intronic
1101769831 12:107739206-107739228 CAAGGTTGGAACACTTTTTTTGG - Intronic
1103173448 12:118842401-118842423 CAGGATGGGAAGAGTGTTTCAGG - Intergenic
1104375281 12:128260569-128260591 CATGATAGGAAAAGTATTTCAGG + Intergenic
1105160745 13:17428754-17428776 CAGGTTTGAAACAGTCTTTCTGG + Intergenic
1105160897 13:17431134-17431156 CAGGTTTGAAACAGTCTTTCTGG + Intergenic
1105162720 13:17460170-17460192 CAGGTTTGAAACAGTCTTTCTGG + Intergenic
1105165268 13:17500269-17500291 CAGGTTTGAAACAGTCTTTCTGG + Intergenic
1105167978 13:17542950-17542972 CAGGTTTGAAACAGTCTTTCTGG + Intergenic
1105168781 13:17555702-17555724 CAGGTTTGAAACAGTCTTTCTGG + Intergenic
1105168900 13:17557572-17557594 CAGGTTTGAAACAGTCTTTCTGG + Intergenic
1105169980 13:17574569-17574591 CAGGTTTGAAACAGTCTTTCTGG + Intergenic
1105171648 13:17600569-17600591 CAGGTTTGAAACAGTCTTTCTGG + Intergenic
1105175897 13:17666509-17666531 CAGGTTTGAAACAGTCTTTCTGG + Intergenic
1105176359 13:17673816-17673838 CAGGTTTGAAACAGTCTTTCTGG + Intergenic
1105177006 13:17683680-17683702 CAGGTTTGAAACAGTCTTTCTGG + Intergenic
1105178489 13:17706645-17706667 CAGGTTTGAAACAGTCTTTCTGG + Intergenic
1105180515 13:17737923-17737945 CAGGTTTGAAACAGTCTTTCTGG + Intergenic
1105181219 13:17749123-17749145 CAGGTTTGAAACAGTCTTTCTGG + Intergenic
1105188324 13:17860098-17860120 CAGGTTTGAAACAGTCTTTCTGG + Intergenic
1105189516 13:17878624-17878646 CAGGTTTGAAACAGTCTTTCTGG + Intergenic
1105190224 13:17889679-17889701 CAGGTTTGAAACAGTCTTTCTGG + Intergenic
1105192806 13:17929621-17929643 CAGGTTTGAAACAGTCTTTCTGG + Intergenic
1107087375 13:36440295-36440317 CAGCACTGGAACAGTTTTTCTGG - Intronic
1107482564 13:40796767-40796789 CAGGGCAGGGACAGTGTCTCAGG - Intronic
1110588941 13:77231158-77231180 CAGTGTAGGACCAGTTTTATTGG - Intronic
1118860799 14:69661470-69661492 CAGGGAAGGAGCATTCTTTCAGG - Intronic
1119669623 14:76508560-76508582 GAGGGAGGGAACAGTGTTTCAGG + Intergenic
1122126426 14:99581016-99581038 CAGGGTAGGGGCTGTGTTTCAGG + Intronic
1122294648 14:100698357-100698379 CAGGGACGGAAAAGGTTTTCTGG - Intergenic
1122841172 14:104464245-104464267 GAGGGAAGGAACAGTGTGTCTGG - Intergenic
1123190530 14:106565287-106565309 CAGGGTGGGAACACCTTTTATGG - Intergenic
1125354831 15:38805930-38805952 CATGGGTGGAACAGTTTTTGGGG + Intergenic
1126548683 15:49903058-49903080 CAGAAAAGGGACAGTTTTTCTGG + Intronic
1131621377 15:94071676-94071698 TAGGGTATGCAGAGTTTTTCTGG + Intergenic
1131817192 15:96234033-96234055 AAGGGAAGGAATACTTTTTCTGG - Intergenic
1139058634 16:63220888-63220910 CATGGTCTGAATAGTTTTTCAGG - Intergenic
1141113577 16:81289828-81289850 AAGGGTAGAACCAGGTTTTCTGG + Intronic
1142941334 17:3382119-3382141 TAGGGTAGGAAGAGTATTTCAGG + Intergenic
1143996192 17:11008450-11008472 AAGGGTAGAAACCATTTTTCTGG + Intergenic
1144041730 17:11417711-11417733 CATGGTAGGAACAGAGCTTCTGG + Intronic
1146259859 17:31414303-31414325 CAGGGAAGGAACAGATGTCCTGG - Intronic
1146803723 17:35848433-35848455 TAGGGAAGGAACAGCTTTGCAGG + Intronic
1150127397 17:62646923-62646945 CTGGGTATGTACAGTTGTTCTGG + Intronic
1152063046 17:78093383-78093405 CAGGGTTGGAATAGTTTTACCGG - Intronic
1152520989 17:80856930-80856952 CAAGGTATGAGCAGTTTCTCTGG - Intronic
1154415311 18:14172828-14172850 CAGGGTAGGGCCAGTATTTCAGG + Intergenic
1155228777 18:23753802-23753824 CAGTGTACTTACAGTTTTTCAGG - Exonic
1156312569 18:35938219-35938241 CAGAGGAGGAAGAGGTTTTCAGG + Intergenic
1160741084 19:686139-686161 CAGGGCAGGAACAGGTCTCCAGG - Intronic
1163211107 19:15841001-15841023 AAGGGGAGGAACACTTATTCTGG - Intergenic
1164767770 19:30784875-30784897 GAGAGTAGGAACAACTTTTCCGG - Intergenic
1164794587 19:31015570-31015592 CAGGACAGGAACACTTTTCCTGG + Intergenic
1167819846 19:51917558-51917580 CTGGGTAAGCACAGTTTTCCTGG - Intronic
925715870 2:6783788-6783810 CAGTGTAAGAACAGATTTTCTGG + Intergenic
926665376 2:15516364-15516386 CAGGGTAGGAAAATGTTTACAGG - Intronic
927351711 2:22124458-22124480 CATGGTAAGACCAGTTATTCTGG + Intergenic
927638186 2:24831099-24831121 CAGGGCAGGAACAGTTTTCAGGG + Intronic
929471124 2:42193964-42193986 CAGGTCAGGCACAGTGTTTCAGG - Intronic
930390354 2:50753308-50753330 CTGGAGAGGAACAGGTTTTCAGG + Intronic
931197215 2:60064201-60064223 CTGGGTAGGAACAGACTTTTGGG + Intergenic
936035027 2:109104381-109104403 CGTGGAATGAACAGTTTTTCAGG + Intergenic
940137529 2:150455451-150455473 CAGGTTAAGAATAGTTTTCCTGG + Intergenic
940296020 2:152125235-152125257 GAGGGTAGGAAAGATTTTTCTGG - Intronic
940769612 2:157826143-157826165 CAGGCCAGGACCAGATTTTCTGG + Intronic
942291246 2:174473743-174473765 CATGGAAAGAACAGTTTTACTGG + Intronic
942518081 2:176774241-176774263 CAGGGATTGAACAGCTTTTCAGG + Intergenic
942904043 2:181159586-181159608 CACGGTAGAAATAGCTTTTCTGG - Intergenic
943299805 2:186183902-186183924 CAGAGTAGGAACAGTTTCGAGGG + Intergenic
947498718 2:230657221-230657243 CAGATTAGGAACAGATTTTGAGG + Intergenic
947653549 2:231807791-231807813 AGGGGGAGTAACAGTTTTTCTGG - Exonic
948392783 2:237624921-237624943 CAGGGTAGGGACAGTATTCTAGG - Intergenic
1170779782 20:19414200-19414222 CAGGAGAGGCACAGATTTTCTGG + Intronic
1174615091 20:51829268-51829290 CAGGCAAGGCACAGTATTTCAGG - Intergenic
1175796694 20:61775679-61775701 CAGGGTAGGCACATTATTTGTGG + Intronic
1176858010 21:13986436-13986458 CAGTGTAGGGCCAGTATTTCAGG - Intergenic
1176866576 21:14057742-14057764 CAGGGTAGGGCCAGTATTTCAGG + Intergenic
1176959500 21:15143305-15143327 TAGGGAAGGAACAGGTTTGCAGG - Intergenic
1178224586 21:30700471-30700493 CAGGGTTGGAACAGTTTGGAGGG - Intergenic
1179578517 21:42322719-42322741 AGGGGTAGGAACAGTTGTTGGGG + Intergenic
1183015656 22:34984291-34984313 CCAGATAGGAACTGTTTTTCTGG + Intergenic
1183611143 22:38907186-38907208 CATGGACTGAACAGTTTTTCAGG - Intergenic
1184664944 22:45983380-45983402 CTGGGTACAAACAGTTTCTCTGG + Intergenic
949123201 3:412798-412820 AGGGGTAAGAACAGTTTTTGGGG - Intergenic
950690983 3:14657587-14657609 CAGTGTAGCAACAGTTTTCAGGG - Intronic
951077959 3:18420070-18420092 CAGGGTAGGCACTGCTTTACAGG + Intronic
951290068 3:20864123-20864145 CAGGGTTGGAACAGTTTGGAGGG - Intergenic
952324615 3:32309758-32309780 CAGGGTATGAACATCTGTTCTGG - Intronic
953877536 3:46674865-46674887 CAGGCTTGGAAAAGGTTTTCTGG - Intronic
959254478 3:103991855-103991877 CAGGGGAGGAAAAGTTCTACTGG + Intergenic
959593836 3:108107381-108107403 AAGGTTTGGAAGAGTTTTTCTGG + Intergenic
966647561 3:182263402-182263424 GAAGGAAGGAAGAGTTTTTCAGG + Intergenic
967298757 3:187991370-187991392 CAGAGTTGGAAGAGTATTTCAGG - Intergenic
967352383 3:188527883-188527905 GAGGATAGCAACAGTGTTTCTGG + Intronic
975421349 4:74167660-74167682 AAGGGAAGGAAGAGTGTTTCAGG + Intronic
977902935 4:102443239-102443261 GAGGGTAGTAACTGATTTTCAGG - Intergenic
977910864 4:102534442-102534464 CAGGAGAGGAACATTTTTTCAGG + Intronic
979934916 4:126680177-126680199 CTGGGTAAGACCAGATTTTCTGG - Intergenic
979977143 4:127210889-127210911 CAGGGTAGGATCTGATTTTCTGG - Intergenic
981159585 4:141481971-141481993 CAGTGTAGAAACAGTGATTCAGG + Intergenic
990353255 5:54939714-54939736 CAGGGTTAGAACAGTTTTCCTGG + Intergenic
997358372 5:133278913-133278935 CAGGGTAGTAACAGCCTTCCTGG + Intronic
997835608 5:137190694-137190716 CAGGGTGGGAAAAGGATTTCAGG - Intronic
1000896233 5:166858795-166858817 CAGGGTTGGAAAAATTTATCTGG + Intergenic
1001131012 5:169063454-169063476 AAGGGTAGGGACAGATTTCCTGG + Intronic
1001860627 5:175051703-175051725 CAGGGCTGGAACCCTTTTTCTGG + Intergenic
1003461274 6:6330973-6330995 CAGTGTAGGCACAGGTCTTCTGG + Intergenic
1005491426 6:26350897-26350919 CAGGTTAGAAACATATTTTCGGG + Intergenic
1006746716 6:36347777-36347799 CAGGGAAGGAGCCGTATTTCAGG + Intergenic
1006939742 6:37743893-37743915 CTGGGCAGAAACAGTTCTTCAGG - Intergenic
1007703268 6:43776500-43776522 CAGGGTAGAGACAGTTTCCCAGG - Intronic
1007956179 6:45919622-45919644 CAGAGTAGAAACAGTTGTACTGG - Intronic
1008812228 6:55517202-55517224 CAGGGTAGGTTAAATTTTTCAGG - Intronic
1009448836 6:63777258-63777280 CAGGGTAGGCTCTGTCTTTCAGG + Intronic
1009645847 6:66400168-66400190 AAGGGTTGGCACAGTTTTTTAGG + Intergenic
1011834974 6:91420723-91420745 CAGGGTTGGAACAGTTTGGAGGG + Intergenic
1013727875 6:113122328-113122350 TAGGGAAGGAACAGTATTTAAGG + Intergenic
1014544981 6:122724055-122724077 CTTGGTAGGAGCAGTTTTGCAGG + Intronic
1015820659 6:137257199-137257221 CAGGGCAGGAACATTATTGCTGG - Intergenic
1016268956 6:142266054-142266076 CTGGATAAGAACAGTGTTTCAGG - Intergenic
1018111023 6:160537032-160537054 CAGAGTCAGAACAGTTTTCCAGG + Intronic
1020728799 7:11853452-11853474 CAAGGTAGAAACTTTTTTTCAGG + Intergenic
1023458764 7:40370290-40370312 CAGGGAAGGATCAGTTTTGAGGG + Intronic
1025194342 7:56921010-56921032 CAGGGTAGGAGCTGTATTTCTGG - Intergenic
1025677610 7:63655943-63655965 CAGGGTAGGAGCTGTATTTCTGG + Intergenic
1026128650 7:67602164-67602186 CAGGGTGGGAAAGGTTATTCTGG - Intergenic
1027296758 7:76781844-76781866 CAGGGTCAAAACAGTTTTTCTGG - Intergenic
1029270246 7:99373290-99373312 CAGGGTGGGAATAGTGTTCCAGG + Intronic
1029684054 7:102133307-102133329 CAGGGCAGGATCAGCTTGTCAGG - Intronic
1029913154 7:104176622-104176644 ATGGCTAGGAATAGTTTTTCAGG + Intronic
1031545874 7:123050923-123050945 AAGGGTTGGAACAGTTTGTAAGG - Intergenic
1032517257 7:132516152-132516174 CAGGGTACAACCAGTTTTTTAGG - Intronic
1033528201 7:142237526-142237548 CAGAGTAGGAACAGAGTTTAGGG + Intergenic
1037166608 8:15838150-15838172 CAGGCTAGGAAGATATTTTCAGG - Intergenic
1037517173 8:19644380-19644402 GAGGTTAAGAACTGTTTTTCAGG - Intronic
1038956521 8:32474299-32474321 TATGGTAAGAAGAGTTTTTCTGG + Intronic
1039786528 8:40839056-40839078 CAGGGAAAGAACATTATTTCAGG - Intronic
1040133552 8:43826177-43826199 CAGGTTGGAAACAGTTTTTTTGG + Intergenic
1045451582 8:102332052-102332074 CAGGGAAGGCACAGCTTTGCAGG - Intronic
1045832094 8:106474743-106474765 AAGGGTTGGAAAAGCTTTTCTGG - Intronic
1045983191 8:108216644-108216666 CAGGATAGGAACAATTGTTTTGG - Intronic
1048194808 8:132323546-132323568 CAGGCTAGGAGCAGGTTTTGGGG - Intronic
1051020405 9:12535702-12535724 CAGGGTTGGAACAGTTTGGAGGG - Intergenic
1051304451 9:15693619-15693641 GAGGTAAAGAACAGTTTTTCTGG + Intronic
1055358560 9:75463770-75463792 CAGGGTAGGACTTATTTTTCTGG + Intergenic
1057110255 9:92463109-92463131 CAGGGTGGGAACAGAAATTCCGG - Intronic
1057512382 9:95691571-95691593 CAGAGTAGGAAAAGGTTTTGTGG + Intergenic
1058643289 9:107107672-107107694 CAGTGTAGTATCAGTGTTTCCGG - Intergenic
1059772129 9:117436912-117436934 CAAGGAAGAAACAGTTTCTCTGG - Intergenic
1060079316 9:120627166-120627188 CATGGTAGAAACAGTTTTGGGGG + Intronic
1186971991 X:14856663-14856685 TAGGGTTGGAAAACTTTTTCTGG - Intronic
1188505581 X:30880137-30880159 CAGAGTAGCAACAGGTTTTGTGG + Intronic
1190626642 X:52343741-52343763 CAGGGTAGGTGCAGGTTTTGGGG + Intergenic
1190701369 X:52992088-52992110 CAGGGTAGGTGCAGGTTTTGGGG - Intronic
1196475981 X:116087150-116087172 AAGGTTGGTAACAGTTTTTCTGG - Intergenic
1198636314 X:138704528-138704550 GTGGGTAAGAATAGTTTTTCTGG + Intronic
1199226468 X:145381093-145381115 CAGGGTAGGAACCCTATTTGTGG + Intergenic
1199356666 X:146870386-146870408 CAGTGTAGGAAGATTTTGTCAGG + Intergenic
1201756526 Y:17492563-17492585 CACGGTAGAAACAGTTGCTCTGG - Intergenic
1201845026 Y:18413422-18413444 CACGGTAGAAACAGTTGCTCTGG + Intergenic