ID: 1084958251

View in Genome Browser
Species Human (GRCh38)
Location 11:72702912-72702934
Sequence TGGAATTCCTTCGGAACAAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 66}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084958251_1084958259 17 Left 1084958251 11:72702912-72702934 CCGGTTGTTCCGAAGGAATTCCA 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1084958259 11:72702952-72702974 GCCTGCTCTGCAAGAGCCAGGGG 0: 1
1: 0
2: 0
3: 17
4: 248
1084958251_1084958262 23 Left 1084958251 11:72702912-72702934 CCGGTTGTTCCGAAGGAATTCCA 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1084958262 11:72702958-72702980 TCTGCAAGAGCCAGGGGCGTGGG 0: 1
1: 0
2: 0
3: 20
4: 154
1084958251_1084958257 15 Left 1084958251 11:72702912-72702934 CCGGTTGTTCCGAAGGAATTCCA 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1084958257 11:72702950-72702972 CCGCCTGCTCTGCAAGAGCCAGG 0: 1
1: 0
2: 1
3: 6
4: 173
1084958251_1084958261 22 Left 1084958251 11:72702912-72702934 CCGGTTGTTCCGAAGGAATTCCA 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1084958261 11:72702957-72702979 CTCTGCAAGAGCCAGGGGCGTGG 0: 1
1: 0
2: 2
3: 15
4: 250
1084958251_1084958264 25 Left 1084958251 11:72702912-72702934 CCGGTTGTTCCGAAGGAATTCCA 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1084958264 11:72702960-72702982 TGCAAGAGCCAGGGGCGTGGGGG 0: 1
1: 0
2: 0
3: 33
4: 381
1084958251_1084958263 24 Left 1084958251 11:72702912-72702934 CCGGTTGTTCCGAAGGAATTCCA 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1084958263 11:72702959-72702981 CTGCAAGAGCCAGGGGCGTGGGG 0: 1
1: 0
2: 2
3: 19
4: 212
1084958251_1084958258 16 Left 1084958251 11:72702912-72702934 CCGGTTGTTCCGAAGGAATTCCA 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1084958258 11:72702951-72702973 CGCCTGCTCTGCAAGAGCCAGGG 0: 1
1: 1
2: 0
3: 13
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084958251 Original CRISPR TGGAATTCCTTCGGAACAAC CGG (reversed) Exonic
901016486 1:6234861-6234883 AAGAATTCCTTCGGAAATACTGG - Intronic
903198671 1:21714146-21714168 AGGAATTCATTAGGATCAACAGG + Intronic
920729421 1:208468841-208468863 TGGAATTTCTTATGAACAGCTGG + Intergenic
922432409 1:225568833-225568855 TAAAATTGCTTCAGAACAACAGG + Intronic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1064907190 10:20359329-20359351 TGGAATTCCTCCAGACCATCAGG + Intergenic
1065268142 10:23998660-23998682 TGAATTTCATTCTGAACAACAGG + Intronic
1066774901 10:38877593-38877615 TGGAATTCTTTCGAAAAGACTGG + Intergenic
1068741738 10:60481275-60481297 TGGAAATCCTACTGAACGACTGG + Intronic
1073961676 10:108937998-108938020 TGGAATTCCTCCTGAAGAACAGG - Intergenic
1076875008 10:133211511-133211533 TGGACTTCCCTCGGAACAGCGGG + Exonic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1080883576 11:36345244-36345266 AGGAAGTCCTTTGGAACAGCAGG + Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084958251 11:72702912-72702934 TGGAATTCCTTCGGAACAACCGG - Exonic
1088083163 11:105945111-105945133 TGGAGTTCCTTAGGAAGAAGGGG - Intronic
1090942543 11:131400249-131400271 TGCAATTGCTTCGGGACAGCTGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1105202486 13:18192148-18192170 TGGGATTCCAGAGGAACAACAGG - Intergenic
1113760383 13:112842421-112842443 TGGAATTCCTTCCTGACAGCAGG - Intronic
1113997877 14:16103074-16103096 TGGAATTGATTGGGAACAAATGG - Intergenic
1124634260 15:31354815-31354837 GGGATTTCCTTCAAAACAACTGG - Intronic
1125356883 15:38825814-38825836 TGGAATTACTTCCCAACAAGTGG - Intergenic
1137923969 16:52521917-52521939 TGGGATTCCTTCAAATCAACAGG - Intronic
1140958453 16:79889447-79889469 TGGAATTCCTTTGATAGAACAGG - Intergenic
1143083074 17:4395903-4395925 TGGAACTGCTACGGAAGAACGGG - Intergenic
1161088935 19:2350664-2350686 TGGCATTGCTTCGGGAAAACTGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
936488484 2:112947824-112947846 TGTAATTACTTAGGAACAAAAGG - Intergenic
938762405 2:134437703-134437725 TGTAATTCTTTAGGAGCAACTGG - Intronic
939384604 2:141479375-141479397 TGGAGCTCCTCCCGAACAACTGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
1168780566 20:485854-485876 TGTAGTTCCTTTGGAATAACTGG + Intronic
1174052109 20:47774149-47774171 TGGAGTGCCTTTGGAACGACAGG + Intronic
1174791325 20:53481134-53481156 TGCAATTCATTCTGAACAGCAGG + Intronic
1176715464 21:10345862-10345884 TGGGATTCCAGAGGAACAACAGG + Intergenic
1179247600 21:39647178-39647200 AGGAAGTCCCTTGGAACAACAGG + Intronic
1180602884 22:17034091-17034113 TGGGATTCCAGAGGAACAACAGG - Intergenic
1182364281 22:29767434-29767456 TGGAGGTCCTGCGGAACAGCAGG - Exonic
1184595553 22:45511979-45512001 TGAAACTCCTCCGAAACAACAGG + Intronic
957975467 3:87437859-87437881 TGGCATGACTTCAGAACAACAGG + Intergenic
960871144 3:122251175-122251197 TGGAATTCCTAAGGAGCAAGAGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962016798 3:131449199-131449221 TGAAATTCCTTCTGAACCTCTGG + Intergenic
977325772 4:95572848-95572870 TGCAATTCCTTGGCAACTACTGG - Intergenic
979037412 4:115740999-115741021 TGCTATTCCTTGGGAACATCTGG - Intergenic
981960651 4:150534019-150534041 TGGTATTCATCCTGAACAACAGG - Intronic
983269133 4:165540239-165540261 TGAAATTCCTTAGGAACTATCGG - Intergenic
988153424 5:27417014-27417036 TGGACTTCCTTAGGAAAAGCAGG - Intergenic
988939198 5:36125172-36125194 TGTGATTCCTTAGGAACTACTGG - Intronic
990432387 5:55749047-55749069 TGGAAACCCTTCTAAACAACTGG + Intronic
1001324347 5:170710703-170710725 TGGAATCCCTTGAGAACAACTGG - Intronic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1014014281 6:116511890-116511912 TGGGATTCTTTCTGAACAATAGG + Exonic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1019380633 7:720732-720754 TGAAATTCCTTGGGAAAAAGAGG - Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1021052011 7:15997240-15997262 TAGAAACCCTTAGGAACAACAGG + Intergenic
1023502295 7:40863760-40863782 TGGAATTCTTGAGGTACAACGGG + Intergenic
1023583686 7:41707048-41707070 TGAAATTCATTGAGAACAACAGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1035291748 7:157843870-157843892 TGGCATTCCTTCCAGACAACTGG + Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1060070219 9:120540583-120540605 TGGAATTCAATGTGAACAACTGG + Intronic
1203677896 Un_KI270756v1:38686-38708 TGGAATTCTTTCGAAAAGACTGG - Intergenic
1185532335 X:832032-832054 TGGAATTCCAAGGGAACCACAGG + Intergenic
1190584362 X:51923587-51923609 TGGAAGTCCTGCGGAACAGCAGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1191818844 X:65279991-65280013 TGGAATATTTTCAGAACAACTGG - Intergenic
1199862086 X:151810241-151810263 TGGGATTCATTCGGACCAAAGGG - Intergenic