ID: 1084959427

View in Genome Browser
Species Human (GRCh38)
Location 11:72708676-72708698
Sequence GGCCAAAGGCCCACCAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084959421_1084959427 2 Left 1084959421 11:72708651-72708673 CCAAGAGTGAGGAGGCAGGCGCT 0: 1
1: 0
2: 1
3: 16
4: 185
Right 1084959427 11:72708676-72708698 GGCCAAAGGCCCACCAGGCCTGG 0: 1
1: 0
2: 0
3: 39
4: 230
1084959420_1084959427 3 Left 1084959420 11:72708650-72708672 CCCAAGAGTGAGGAGGCAGGCGC 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1084959427 11:72708676-72708698 GGCCAAAGGCCCACCAGGCCTGG 0: 1
1: 0
2: 0
3: 39
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084959427 Original CRISPR GGCCAAAGGCCCACCAGGCC TGG Intronic
900174522 1:1285932-1285954 GCCCAGACGCCCCCCAGGCCGGG + Exonic
900409385 1:2505972-2505994 GGCCACAGGCCCCCCAACCCGGG + Intergenic
900547500 1:3236881-3236903 GGCCAAGGGCCAGGCAGGCCGGG - Intronic
902407332 1:16191879-16191901 GGCCAAAGCCCTACCAGGGCAGG + Intergenic
902482435 1:16718880-16718902 GCCCTAGGACCCACCAGGCCGGG - Intergenic
904039511 1:27575848-27575870 GGCCCCCGGCCCGCCAGGCCGGG + Intronic
904298292 1:29538122-29538144 GCCCAAAGGGCTACCTGGCCAGG - Intergenic
904825468 1:33271286-33271308 GAGCAAAGGCCCCCCAGGCGAGG - Intronic
905626874 1:39495213-39495235 GGCCCTAGGGGCACCAGGCCTGG - Intronic
905910143 1:41647911-41647933 GGTCCCAGGCCCACCAGGCAGGG - Intronic
906551194 1:46667984-46668006 GTCCTAAGGCCCAGCAGCCCGGG + Intronic
907524781 1:55047794-55047816 GGCCACAGGCTGCCCAGGCCGGG - Intronic
907618576 1:55951400-55951422 GGCCAAAGGCCCAAGAGCCCTGG - Intergenic
908731643 1:67232322-67232344 GTCCAGAGCCCCACAAGGCCAGG + Intronic
910516975 1:88072970-88072992 GGACAAAGGCACACCAGACAGGG - Intergenic
911237018 1:95422473-95422495 GGCCCAAGGCCCAGCAGCCCTGG - Intergenic
912450826 1:109766509-109766531 GGCCAGAGCCCCACCAGCCCTGG - Intronic
914457284 1:147847724-147847746 TCCCACAGGCCCACCTGGCCTGG - Intergenic
922079670 1:222283619-222283641 GGCCATGGGCCCGCCTGGCCTGG - Intergenic
922721518 1:227902469-227902491 AGACAAAGGCCCAGGAGGCCGGG - Intergenic
1062854427 10:772577-772599 CCCCAAGGCCCCACCAGGCCTGG - Intergenic
1063230643 10:4062977-4062999 GGCCAATGGCCCAGCAGGACTGG + Intergenic
1063435009 10:6022382-6022404 GGCCACAGGTCCGTCAGGCCTGG - Intronic
1064317292 10:14270095-14270117 GGCCAAAGGCCCAAAAGCCTGGG - Intronic
1065031403 10:21590069-21590091 GACCACAGGCACACCATGCCTGG + Intronic
1065110600 10:22436762-22436784 GGCCGAGGGCCCAAGAGGCCGGG + Intronic
1067684295 10:48457706-48457728 TGCTAAAGCCTCACCAGGCCTGG - Intronic
1069563488 10:69448393-69448415 GGCCTAGGGGCCAGCAGGCCTGG - Intergenic
1069593954 10:69658491-69658513 GCCCAAAGGACCACAAAGCCTGG - Intergenic
1070743617 10:78919216-78919238 AGCCAAAGCTCCACCAGGACAGG + Intergenic
1073060365 10:100730096-100730118 GGCCGCAGGCCCAGGAGGCCAGG - Intergenic
1074348456 10:112711532-112711554 GGCCTGAAGCTCACCAGGCCCGG - Intronic
1074872531 10:117588317-117588339 TGCCAAAATCCCACCAGGGCTGG - Intergenic
1075198732 10:120383438-120383460 CACCAAAGGCTCCCCAGGCCTGG - Intergenic
1076785119 10:132745772-132745794 CGCCAGAAGCCCACCATGCCCGG - Intronic
1077123017 11:919285-919307 GGCCACATGCCCACCAAGTCAGG + Intergenic
1077186739 11:1238817-1238839 GGACAATGGCCCCCCCGGCCAGG - Intronic
1077239662 11:1503902-1503924 GGCCAAGGGCGCACCCGGCTGGG + Intergenic
1077243340 11:1523635-1523657 GGACAAAGGCCCACCATCCCAGG + Intergenic
1077443777 11:2580827-2580849 GGCCCAAGTCCCACCCCGCCTGG - Intronic
1077534993 11:3119744-3119766 GGCCACAGGGCCACCAGGTGGGG + Intronic
1077610885 11:3642501-3642523 GGTCCCCGGCCCACCAGGCCAGG + Intergenic
1078245158 11:9567612-9567634 GACCACAGGCGCACCATGCCCGG + Intergenic
1078996931 11:16711384-16711406 GACTATAGGCCCACCATGCCTGG - Intronic
1083310266 11:61780319-61780341 CACCAAAGCCCCACCTGGCCTGG - Intronic
1083623625 11:64060855-64060877 GGGCCAAAGCCCTCCAGGCCGGG + Intronic
1083762605 11:64826849-64826871 GGCCCAAGGCACAACAGACCAGG + Intronic
1083888866 11:65585824-65585846 GAGCCAAGGCCCACCAGGCAGGG + Intronic
1084604713 11:70165723-70165745 GGCAAAAGCCACCCCAGGCCAGG + Intronic
1084657805 11:70529127-70529149 AGCCAGTGGCACACCAGGCCAGG + Intronic
1084959427 11:72708676-72708698 GGCCAAAGGCCCACCAGGCCTGG + Intronic
1085022265 11:73217308-73217330 GGCCCAAGGCCCCGAAGGCCCGG + Intergenic
1085246818 11:75108631-75108653 GGCCAAAGGCCTCACAGCCCAGG + Intronic
1085249835 11:75135607-75135629 GGTCAAGGCCCCAGCAGGCCAGG - Intronic
1089271446 11:117304270-117304292 AACCAGAGGCCCAACAGGCCTGG + Intronic
1089352286 11:117828490-117828512 GGCCAACGGCCCAGCTGGACTGG - Intronic
1091330675 11:134728902-134728924 GGCCACGGGCCCCTCAGGCCAGG - Intergenic
1093620042 12:21277851-21277873 GGCCAGATTCCTACCAGGCCAGG + Intronic
1096416658 12:51420299-51420321 GTCCAAAGAGCCACCAGGGCCGG - Intronic
1098469264 12:70825138-70825160 GACTACAGGCCCACCACGCCTGG - Intronic
1100338074 12:93651519-93651541 GGCCAAAGGCCCAGGAGCCCTGG - Intergenic
1101246117 12:102885672-102885694 AGCAAAAGACCCCCCAGGCCTGG + Intronic
1101605667 12:106246775-106246797 CGTCAAAGGCCCACCTGGGCAGG + Intronic
1102904744 12:116665959-116665981 GGCCCAAGCCGCACCATGCCAGG + Intergenic
1105042756 12:132973823-132973845 AGGCAATGCCCCACCAGGCCTGG - Intergenic
1105213682 13:18272427-18272449 AGCCCCAGGCCCACCAAGCCTGG - Intergenic
1112894470 13:104282073-104282095 GGCCGAAGGCCCAAGAGCCCAGG - Intergenic
1113658232 13:112083974-112083996 GGACAGAGGCCCCCCAGGCCTGG - Intergenic
1118347721 14:64951841-64951863 GGGCCAAGGCCCTGCAGGCCTGG - Intronic
1119483740 14:74975264-74975286 GGCCAAGGGCCCAGCACTCCAGG - Intergenic
1119764703 14:77181250-77181272 GGCCACAGCCCCACCAGGGAGGG - Intronic
1121149105 14:91614518-91614540 GACTAAAGGCCCACCATTCCTGG - Intronic
1121149132 14:91614656-91614678 GACTACAGGCCCACCACGCCTGG - Intronic
1121318219 14:92974757-92974779 GGCAAAAGGCCCATGGGGCCTGG + Intronic
1122744732 14:103891046-103891068 GGGGCAAGGCCCACCTGGCCTGG + Intergenic
1123047811 14:105527072-105527094 GGCCCCAGGCCCACCTGTCCTGG - Intronic
1123058157 14:105582078-105582100 GGCCCCAGGCACACCTGGCCAGG + Intergenic
1123082251 14:105701007-105701029 GGCCCCAGGCACACCTGGCCAGG + Intergenic
1123403399 15:20006568-20006590 GGCCTAAGCCTCACCTGGCCTGG - Intergenic
1123512737 15:21013222-21013244 GGCCTAAGCCTCACCTGGCCTGG - Intergenic
1125501256 15:40241422-40241444 AGTCCCAGGCCCACCAGGCCTGG - Intronic
1126874442 15:53024907-53024929 GGCCAAAGGCCCTAGAGCCCCGG + Intergenic
1127253880 15:57271376-57271398 GGCCTGGGACCCACCAGGCCAGG + Intronic
1128521704 15:68379607-68379629 GGCCAAGGGCTCACCAAGGCTGG - Intronic
1128645943 15:69379152-69379174 GGCCAGAGGCACAACAGCCCAGG - Intronic
1129658713 15:77541467-77541489 GGCCAGTGCCCCAGCAGGCCCGG + Intergenic
1130363132 15:83208291-83208313 GGACAAAGGCGCTCCAGGCCTGG + Intergenic
1130744745 15:86639007-86639029 AGCAAAAGGCCCACCTGGCAAGG - Intronic
1130905638 15:88239189-88239211 GGCCAGAAGCCCTCCAGGCAGGG + Intronic
1132775050 16:1588864-1588886 GGCCACAGCCCTGCCAGGCCAGG - Intronic
1132797501 16:1732492-1732514 GCGCAAAGGCCCAGCTGGCCAGG + Intronic
1132809513 16:1790820-1790842 AGCCACAGGCGCTCCAGGCCCGG + Exonic
1133038901 16:3049555-3049577 GGCCAGAGACCCAGCCGGCCTGG + Intronic
1133045538 16:3086609-3086631 GGCCAAAGTCCCCTCAGGCCGGG - Intergenic
1133946806 16:10355675-10355697 TGACAAAGGCCTTCCAGGCCGGG - Intronic
1134584178 16:15396449-15396471 AGCCAGAGGTCCACCAGGTCAGG + Intronic
1138633662 16:58319498-58319520 GGCAAGAGGCCCCCTAGGCCTGG + Intronic
1139475132 16:67199254-67199276 GGCCAAGGGTGCACCTGGCCTGG - Exonic
1141257571 16:82416991-82417013 GGACAAAGGCTCACAAAGCCAGG + Intergenic
1141460646 16:84176813-84176835 GGGCAAAGGGGCACCAGGCAGGG + Intronic
1141573324 16:84947968-84947990 CTCCACAGGCCCAGCAGGCCAGG + Intergenic
1142518785 17:491146-491168 CGCCAAAGGCCCCCCAGCCCGGG + Intergenic
1142708060 17:1708969-1708991 GTCCAGATACCCACCAGGCCAGG - Intronic
1143632316 17:8146313-8146335 AGACACAGGGCCACCAGGCCAGG + Intronic
1144077794 17:11734578-11734600 GGGCAAAGCCTCTCCAGGCCCGG + Intronic
1144208067 17:12993222-12993244 GGGCAGAGGCTCCCCAGGCCTGG + Intronic
1144788472 17:17844679-17844701 GGCCAAAGGCCCATGGTGCCAGG + Intronic
1146909810 17:36641481-36641503 CGCCTAAGGCGCCCCAGGCCCGG - Intergenic
1147061190 17:37879868-37879890 GACCACAGGCACACCATGCCTGG - Intergenic
1147746127 17:42695716-42695738 GGGCACAGGCCGACCAGGCCGGG - Exonic
1147891465 17:43720552-43720574 GGCCACAGCCGGACCAGGCCAGG + Intergenic
1147987863 17:44316529-44316551 GGCCCAAGCCCCACCTGGCTGGG - Intronic
1148238734 17:45986202-45986224 GGCAAGAAACCCACCAGGCCTGG + Intronic
1148350633 17:46939531-46939553 GGGCAAAGGCCCACAAAGCCTGG - Intronic
1148410479 17:47462313-47462335 GACCACAGGCACACCATGCCTGG - Intergenic
1148562543 17:48614214-48614236 GGCCCAAGGCCTGGCAGGCCGGG - Intronic
1151351120 17:73532810-73532832 GGCCATGGCCCCACGAGGCCTGG + Intronic
1151624836 17:75270377-75270399 GGCTGAAGGCCCACCAGGCTTGG + Intronic
1152637986 17:81437973-81437995 GGCCAAAGGAGAACCAGGCCCGG - Intronic
1203159863 17_GL000205v2_random:39254-39276 GGCTAAAGGGCCACCTGGCCTGG + Intergenic
1156814557 18:41294200-41294222 GCCCAAAGGCCCAGCATACCTGG - Intergenic
1157743039 18:50110079-50110101 GGCCTGAGGCACAGCAGGCCTGG - Intronic
1157757489 18:50231676-50231698 GGCCAAATAGCCACCTGGCCTGG + Intronic
1160157240 18:76442993-76443015 GGCCCCAGCCCCACCAGGGCCGG - Exonic
1160543575 18:79638475-79638497 GGCCAAGGCCCCACCCGGCGCGG - Intergenic
1160800331 19:964680-964702 GGGCAAAGGCCCAGCAGCTCTGG + Intronic
1161576474 19:5057230-5057252 GGCCACAGGCACACGCGGCCTGG - Intronic
1161954140 19:7483420-7483442 GGGCAGAGGCTCACCAGGGCAGG + Intronic
1162917053 19:13880340-13880362 CGCCAGAGGTCCAGCAGGCCCGG + Intronic
1165014405 19:32870326-32870348 GGCCAAATGCCCATCAGGTTTGG + Intergenic
1165087969 19:33364547-33364569 GGCCACAAGCCCACCTGGCCTGG + Intergenic
1165782876 19:38444049-38444071 GGCCAAGGGCCCGGGAGGCCTGG + Intronic
1167249081 19:48391246-48391268 GGTGAGAGGCCCACCAGGGCTGG - Exonic
1167607178 19:50487671-50487693 AGGCAAAGGCCCACCAGGCAGGG + Exonic
1167621880 19:50565303-50565325 GGCCACAGGACCACAAGGCAAGG + Intronic
1167698212 19:51027168-51027190 GGCCAGGGGCCCACCTGGGCTGG - Intronic
1168670094 19:58234427-58234449 GGGAAAAGGCCCCACAGGCCAGG + Intronic
927878595 2:26674982-26675004 TGTCAGAGGCCCACCTGGCCCGG - Intergenic
927980193 2:27370199-27370221 GCCCAAAGGCGCTCAAGGCCCGG + Intronic
930029533 2:47049653-47049675 GGCCAGAAGCTCCCCAGGCCAGG - Intronic
931382601 2:61767327-61767349 GACTACAGGCCCACCAAGCCTGG - Intergenic
932599152 2:73112295-73112317 GGCTAAAGGCCTAACAGGGCGGG - Intronic
934300647 2:91774319-91774341 GGCCCCAGGCCCACCAAGCCTGG + Intergenic
934655588 2:96115460-96115482 GGCCAAAGCCCCACCATGGTCGG + Exonic
934959618 2:98659408-98659430 GCCCAAGGGACAACCAGGCCAGG + Intronic
937415914 2:121714385-121714407 GCCCAGAGGCCAACCAGGCTGGG - Intergenic
939245824 2:139622245-139622267 AGCCAAAAGCACACTAGGCCTGG - Intergenic
941580953 2:167294218-167294240 TGCCAGAGGCGCACCAGGCCGGG - Intergenic
941983195 2:171482898-171482920 GTCCAAATGCCATCCAGGCCAGG + Exonic
944524309 2:200602626-200602648 GGCTATAGGAACACCAGGCCAGG - Intronic
945319558 2:208406450-208406472 GGCTAAAGGCTCCCGAGGCCAGG - Intronic
947593904 2:231399288-231399310 GGCCACAGACCCATCAGGCCAGG - Exonic
948483230 2:238263475-238263497 GGCCAAAGTCACACGAGACCAGG - Intronic
948621836 2:239240188-239240210 GGCGCAGGGGCCACCAGGCCTGG + Intronic
948801692 2:240436111-240436133 GCCCAAAGCCCGGCCAGGCCCGG - Intronic
949066480 2:241993792-241993814 GGCCAAGAGCCCAGCAGGCAGGG - Intergenic
1169244640 20:4015735-4015757 GGCCAGGGCCGCACCAGGCCTGG - Intergenic
1170697121 20:18669208-18669230 GGCCAAAGGCCCCTCAGGAGTGG - Intronic
1170764959 20:19281977-19281999 GGCCAAGTCCCCACCAGGCAAGG - Intronic
1172167289 20:32907090-32907112 GGCCAAAGGCCTAGCAGGAGGGG + Intronic
1172448113 20:35003623-35003645 GGCCACAGGCCCACAGGGTCAGG + Intronic
1174361730 20:50033089-50033111 GGCCAAAAGGCAGCCAGGCCTGG - Intergenic
1174391648 20:50221579-50221601 GGCCAGAGGGCTATCAGGCCAGG - Intergenic
1174572214 20:51509889-51509911 GGCCTGAGGCCCACCTGTCCAGG - Intronic
1175055265 20:56192096-56192118 GGCAGGAGGCCCATCAGGCCAGG - Intergenic
1175247304 20:57589830-57589852 GGCCAGGAGCCCAGCAGGCCAGG - Intergenic
1179910070 21:44442855-44442877 GTCCCCAAGCCCACCAGGCCAGG + Exonic
1179974327 21:44855418-44855440 GGCCACATACCCACCAGGACAGG + Intronic
1180064597 21:45405929-45405951 GGACAGAGGCGCACAAGGCCCGG - Intronic
1180571924 22:16732126-16732148 TGGCAAAGTTCCACCAGGCCTGG + Intergenic
1180816514 22:18792818-18792840 GGCCCCAGGCCCACCAAGCCTGG - Intergenic
1180962966 22:19770613-19770635 GGCCTGAAGCCCACCAGGCCAGG - Intronic
1181121553 22:20670841-20670863 GGCCCCGGCCCCACCAGGCCCGG + Intergenic
1181202701 22:21227150-21227172 GGCCCCAGGCCCACCAAGCCTGG - Intronic
1181629382 22:24142588-24142610 GACCACAGGCCCACCAGGGAAGG - Intronic
1181699001 22:24609455-24609477 GGCCCCAGGCCCACCAAGCCTGG + Intronic
1182743618 22:32587618-32587640 CTCCAAAGGCCGACCAGGCCCGG + Intronic
1184959895 22:47921332-47921354 CGCACAGGGCCCACCAGGCCTGG - Intergenic
1185013530 22:48330517-48330539 GGCCTAAAACCCACCAGGCTTGG + Intergenic
1185330877 22:50251566-50251588 GCCCCAAGGCCCACCCGGCCCGG + Intronic
1185410462 22:50678937-50678959 GGCAAGAGCCCCTCCAGGCCAGG - Intergenic
1203224212 22_KI270731v1_random:68263-68285 GGCCCCAGGCCCACCAAGCCTGG + Intergenic
1203266614 22_KI270734v1_random:18529-18551 GGCCCCAGGCCCACCAAGCCTGG - Intergenic
949981948 3:9507705-9507727 GGCCAAGGGCCCACCTGGGCGGG - Intronic
952366918 3:32683089-32683111 GGGCAAAGGCATACCTGGCCGGG - Intergenic
952887393 3:38020057-38020079 GACCTATGCCCCACCAGGCCAGG + Intronic
953596779 3:44322778-44322800 GACTACAGGTCCACCAGGCCTGG - Intronic
954881065 3:53836317-53836339 GTCCTAAGCCCGACCAGGCCAGG + Intronic
957106266 3:75892279-75892301 TGGCAAAGTTCCACCAGGCCTGG - Intergenic
958494163 3:94820941-94820963 GTCCAGATGCCCACCAGGGCTGG - Intergenic
959583758 3:108006982-108007004 GGCCAGCGGCCCAGCAGACCAGG - Intergenic
959897177 3:111617874-111617896 GACCTAAGGCCTCCCAGGCCAGG + Intronic
964396691 3:156253366-156253388 GGCCAATGGCTCATCAGCCCTGG - Intronic
964612629 3:158630462-158630484 GGTCAAAGGCCCAAGAGCCCTGG + Intergenic
966900573 3:184481110-184481132 GAGCCAAGGCCCACCAGGTCGGG + Intronic
968167541 3:196479440-196479462 GACCACAGGCACACCACGCCCGG + Intronic
968435927 4:589213-589235 GGCCAAAGGCCCAGGAGCCCCGG + Intergenic
968891211 4:3369441-3369463 GCCCACAGGGCCACCAGGCTAGG - Intronic
969010493 4:4057978-4058000 GGCCACAGGCCCATGATGCCTGG + Intergenic
969648879 4:8451212-8451234 TGGCAAAGGACCACGAGGCCAGG - Intronic
972640823 4:40923554-40923576 TGCCAAGAACCCACCAGGCCAGG + Intronic
985829040 5:2214285-2214307 GGCCAGAGGCCCAGCCAGCCAGG + Intergenic
986558111 5:9032229-9032251 TGAGAAAGGCCCACCAAGCCTGG + Intergenic
990490593 5:56299372-56299394 GGGCAAAGGCAGCCCAGGCCGGG + Intergenic
992595570 5:78343994-78344016 GGCCAAAGGCCCAAAAGCCCTGG - Intergenic
993386502 5:87268387-87268409 GCCCCAGGGGCCACCAGGCCCGG - Exonic
998220928 5:140278421-140278443 GACTACAGGCCCACCATGCCTGG - Intronic
998371579 5:141665226-141665248 GGGCAATGGCCCAGCAGGCCAGG + Intronic
999262719 5:150247558-150247580 AGCCCAGGGCCCACCAGGACTGG - Intronic
999287691 5:150404097-150404119 GGTCAAAGGGCCACCCTGCCTGG - Intronic
1001398591 5:171433505-171433527 GGACAAATGCCCACCAGGTGTGG + Intronic
1001409168 5:171498055-171498077 GGCCCCAGGCTCACCACGCCTGG - Intergenic
1001772254 5:174305316-174305338 CACCAAAGGCCCTCCCGGCCTGG - Intergenic
1001994912 5:176149359-176149381 GGCCAAGGCCCCACCAGGCATGG + Intergenic
1002581042 5:180209466-180209488 CGCCAGAGGCCCACCAGGTGAGG - Intergenic
1003066839 6:2910977-2910999 TGCCAAATGTCCTCCAGGCCGGG + Intergenic
1004518995 6:16344618-16344640 GGCCAAAGGCCCAAGAGCCCTGG - Intronic
1005013778 6:21359120-21359142 GGCCCAACTCCTACCAGGCCTGG - Intergenic
1005944332 6:30584558-30584580 GGTGAATGGCCCACCTGGCCAGG - Exonic
1005963960 6:30713313-30713335 GGCCCAAGGCCGCCCAGGACCGG + Exonic
1006169432 6:32084662-32084684 GTCCTCAGGCCCACCACGCCTGG - Intronic
1011663130 6:89611090-89611112 GACAAAAGGTCCACCAGGGCTGG + Intronic
1016235078 6:141854772-141854794 AGCCATGGGCCCAACAGGCCAGG - Intergenic
1019149142 6:169992870-169992892 GGCCCATGGCCCGCCTGGCCGGG - Intergenic
1019738262 7:2660836-2660858 GGCCAAAGGACCCACAGGCCTGG - Intronic
1019739548 7:2665877-2665899 CGCCAGAGGACCCCCAGGCCGGG - Intergenic
1019748920 7:2716706-2716728 TGCCCAAGGCCCACCTGGACAGG + Intronic
1021106539 7:16645413-16645435 AGCCAAAGGTCACCCAGGCCAGG + Intronic
1023861815 7:44221274-44221296 GCCCCTGGGCCCACCAGGCCTGG + Intronic
1023907760 7:44534366-44534388 CGCCAGAGTCCCATCAGGCCAGG + Intronic
1024248621 7:47489557-47489579 GGCCCATGGCCCACAAGGCAGGG + Intronic
1025041265 7:55647671-55647693 GGCCAGAGCAACACCAGGCCAGG - Intergenic
1025253908 7:57370247-57370269 GGCCAAAGCCCCCCCACCCCTGG - Intergenic
1025826294 7:65013594-65013616 GGCCTGAGCCCCACCATGCCTGG - Intergenic
1025913852 7:65850054-65850076 GGCCTGAGCCCCACCATGCCTGG - Intergenic
1025975711 7:66367990-66368012 GGCCTGAGCCCCACCATGCCTGG + Intronic
1029269056 7:99365673-99365695 GGGAAAAGGCACACCTGGCCTGG + Intronic
1030321915 7:108178550-108178572 GGCCCAAAGCCCAGCAGGCAGGG - Intronic
1034446477 7:151116459-151116481 GGCCACAGGGGCACTAGGCCAGG + Intronic
1035273736 7:157735066-157735088 GGAGACAGGTCCACCAGGCCAGG - Intronic
1036688437 8:10926598-10926620 GGCACCAGGCCCCCCAGGCCAGG + Intronic
1038454978 8:27667140-27667162 GACCAAGGCCCCTCCAGGCCGGG - Intronic
1039953257 8:42188478-42188500 CGCCTAAGGCCGAACAGGCCTGG + Intronic
1043001762 8:74768460-74768482 GGCCAAAGGCCCCAGAGTCCCGG + Intronic
1043019605 8:74984386-74984408 GGCCAGAGGCCCGCCAGATCCGG - Intergenic
1043192994 8:77250356-77250378 GGCCAAGGGCCCAAGAGACCAGG - Intergenic
1045558456 8:103237675-103237697 GGCCCAAGGCCGACCAGGCATGG + Intergenic
1048797288 8:138162726-138162748 GGGCAAAGGCCCAGAAGGCTGGG + Intronic
1049001175 8:139826431-139826453 GGCCACAGCCCCAGCTGGCCAGG - Intronic
1056292798 9:85160697-85160719 GGCCAGAAGCCCACCAGGCAAGG + Intergenic
1056747029 9:89311550-89311572 GAACAAAGGCCCAACCGGCCCGG - Intronic
1057266209 9:93619698-93619720 CGCAACAGGCCCACCAGGGCTGG - Intronic
1060198529 9:121638625-121638647 GGCCAAAGGCCAGCAGGGCCAGG + Intronic
1061135805 9:128732659-128732681 GGCCAAAGGCGCTACTGGCCAGG - Intronic
1061500503 9:130998788-130998810 GGCCACGGGGACACCAGGCCGGG + Intergenic
1061592043 9:131603906-131603928 AGCCCAAGCCCCACCAGGCCAGG + Intronic
1061845729 9:133387050-133387072 GGCCAGAGCCCCAGCAGACCAGG - Intronic
1062002179 9:134221885-134221907 GGGCAAAAGCCCAGGAGGCCGGG + Intergenic
1062040516 9:134402289-134402311 GGCCAAAGGGCCCCCAGGGAAGG + Intronic
1062128938 9:134882328-134882350 GACCAAGTGCCCACCAGGGCAGG + Intronic
1062220698 9:135413620-135413642 GGCCACAGGGCCACCCGGCGTGG + Intergenic
1062416733 9:136454980-136455002 GGCCACAGGCCCTCCAAGCTTGG - Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1186510195 X:10124825-10124847 GACCAAATGCCAACCATGCCAGG - Intronic
1187244029 X:17538057-17538079 AGCCAAAGTCCCACTAGCCCTGG - Intronic
1189839848 X:45063576-45063598 GGCCAAAGGCTGCCCAGGGCAGG - Exonic
1191735551 X:64384724-64384746 GGCCGAAGGCCCTGCAGCCCTGG - Intronic
1198651105 X:138864611-138864633 AGCCAAAGGCCCATGTGGCCAGG + Intronic
1199067003 X:143431309-143431331 GACGAAAGGCCTACCAAGCCTGG + Intergenic
1199286509 X:146060193-146060215 GCTCAAAGGCACTCCAGGCCAGG - Intergenic