ID: 1084960131

View in Genome Browser
Species Human (GRCh38)
Location 11:72712244-72712266
Sequence ACGGGGGTGGAGCCCCCAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 251}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084960117_1084960131 26 Left 1084960117 11:72712195-72712217 CCCCTGCGGTGGGTTCTTGTCCA 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1084960131 11:72712244-72712266 ACGGGGGTGGAGCCCCCAGGCGG 0: 1
1: 0
2: 2
3: 19
4: 251
1084960122_1084960131 2 Left 1084960122 11:72712219-72712241 CCAGCCAGCCTTGATGACTGGTG 0: 1
1: 0
2: 1
3: 18
4: 155
Right 1084960131 11:72712244-72712266 ACGGGGGTGGAGCCCCCAGGCGG 0: 1
1: 0
2: 2
3: 19
4: 251
1084960120_1084960131 6 Left 1084960120 11:72712215-72712237 CCAGCCAGCCAGCCTTGATGACT 0: 1
1: 0
2: 1
3: 23
4: 209
Right 1084960131 11:72712244-72712266 ACGGGGGTGGAGCCCCCAGGCGG 0: 1
1: 0
2: 2
3: 19
4: 251
1084960118_1084960131 25 Left 1084960118 11:72712196-72712218 CCCTGCGGTGGGTTCTTGTCCAG 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1084960131 11:72712244-72712266 ACGGGGGTGGAGCCCCCAGGCGG 0: 1
1: 0
2: 2
3: 19
4: 251
1084960123_1084960131 -2 Left 1084960123 11:72712223-72712245 CCAGCCTTGATGACTGGTGTGAC 0: 1
1: 0
2: 0
3: 10
4: 200
Right 1084960131 11:72712244-72712266 ACGGGGGTGGAGCCCCCAGGCGG 0: 1
1: 0
2: 2
3: 19
4: 251
1084960119_1084960131 24 Left 1084960119 11:72712197-72712219 CCTGCGGTGGGTTCTTGTCCAGC 0: 1
1: 0
2: 1
3: 14
4: 129
Right 1084960131 11:72712244-72712266 ACGGGGGTGGAGCCCCCAGGCGG 0: 1
1: 0
2: 2
3: 19
4: 251
1084960126_1084960131 -6 Left 1084960126 11:72712227-72712249 CCTTGATGACTGGTGTGACGGGG 0: 1
1: 0
2: 0
3: 16
4: 314
Right 1084960131 11:72712244-72712266 ACGGGGGTGGAGCCCCCAGGCGG 0: 1
1: 0
2: 2
3: 19
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084960131 Original CRISPR ACGGGGGTGGAGCCCCCAGG CGG Exonic