ID: 1084962699

View in Genome Browser
Species Human (GRCh38)
Location 11:72725662-72725684
Sequence AATCAGAGGGAGAGCAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 862
Summary {0: 1, 1: 0, 2: 6, 3: 69, 4: 786}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084962699_1084962707 23 Left 1084962699 11:72725662-72725684 CCCTCCCTGCTCTCCCTCTGATT 0: 1
1: 0
2: 6
3: 69
4: 786
Right 1084962707 11:72725708-72725730 CAGTACACAAATCTCCCAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084962699 Original CRISPR AATCAGAGGGAGAGCAGGGA GGG (reversed) Intronic
900805308 1:4763713-4763735 AAAGAGAGGGAGAGGAGGGAGGG - Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901319117 1:8329026-8329048 GAACAGAGGCAGAGAAGGGACGG + Intronic
901496346 1:9624538-9624560 AAGAAGAGGGAGAGGAGGGAGGG - Intergenic
901739792 1:11334639-11334661 AAGCAGAGAGAGAACAGAGATGG + Intergenic
902202202 1:14842073-14842095 AGTGAGAAAGAGAGCAGGGAGGG - Intronic
902464005 1:16603425-16603447 ACTCAGTGCCAGAGCAGGGAGGG + Intronic
902606536 1:17572391-17572413 CAACAGAGGGACAGCAGGAAGGG - Intronic
902784730 1:18725529-18725551 CAGAAGAGGGGGAGCAGGGAAGG + Intronic
902793579 1:18785469-18785491 CTTCAGAGGCAGAGCTGGGATGG + Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903157094 1:21453250-21453272 ACTCAGTGCCAGAGCAGGGAGGG - Intronic
903559227 1:24215511-24215533 AAGCAGAAGGAGAGGAGGGCAGG + Intergenic
903739981 1:25553052-25553074 TAGCCCAGGGAGAGCAGGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
903986796 1:27234668-27234690 AAACAGAGGAGGAGGAGGGAGGG + Exonic
904019977 1:27456387-27456409 AATCAGAGAAAAAGCAAGGAAGG + Intronic
904045826 1:27607559-27607581 AGACAGAGGGGGAGCAGGGTCGG + Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904856219 1:33499983-33500005 ATGCAGTGGGAGTGCAGGGAAGG + Intergenic
904883374 1:33717302-33717324 AAGTGGAGGGAGAGCAGGGAGGG + Intronic
905324747 1:37143385-37143407 GATTGAAGGGAGAGCAGGGAGGG + Intergenic
905356619 1:37389265-37389287 ATTCAGAGGGAGAGTGGGAAGGG - Intergenic
905587161 1:39129578-39129600 AGTCAGAGTAAGACCAGGGATGG + Intronic
905884962 1:41486781-41486803 AACCATAGGGAGAAGAGGGAAGG + Intergenic
905909710 1:41645384-41645406 AATAAGAGGGAGAGCCAGGTTGG - Intronic
906059174 1:42937124-42937146 AAGCACAGTGGGAGCAGGGAAGG - Intronic
906289366 1:44610006-44610028 AAGCAGGAGGAGGGCAGGGAGGG - Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907303567 1:53502315-53502337 AAGGAGAGGGAGAGAAGAGAGGG + Intergenic
907416143 1:54315288-54315310 AAACAGAGGTAGACCAGGCATGG - Intronic
907466913 1:54644299-54644321 AAAGAGAGGGAGAGCAGGGGAGG - Intronic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908596370 1:65692695-65692717 ACACAGAGGGAGAGAAGGGTTGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910058799 1:83063900-83063922 AAACAGAAGGAAGGCAGGGAGGG - Intergenic
911114784 1:94236493-94236515 AGACAGATGGAGAGAAGGGAAGG + Intronic
911126128 1:94342649-94342671 GCTCAGAGGGAGAGCAGGTCCGG - Intergenic
911142975 1:94525465-94525487 AAGTAGAGGGAGAGCAGAGGAGG + Intergenic
911228741 1:95336986-95337008 AAGCAGAGCCAGAGCAGGGCAGG - Intergenic
912563386 1:110566317-110566339 AAGCAGAGGCAGAGTAGTGAAGG + Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912888809 1:113505610-113505632 AATAAGGGACAGAGCAGGGAAGG + Intronic
913545157 1:119860647-119860669 ACTCAGTGCCAGAGCAGGGAGGG + Intergenic
913601898 1:120429193-120429215 ACTCAGTGCCAGAGCAGGGAGGG - Intergenic
913992526 1:143627824-143627846 ACTCAGTGCCAGAGCAGGGAGGG + Intergenic
914085145 1:144447410-144447432 ACTCAGTGCCAGAGCAGGGAGGG + Intronic
914333805 1:146697471-146697493 AGTCTGGGGGTGAGCAGGGAGGG - Intergenic
914355364 1:146880000-146880022 GAACAGAGGGAGCACAGGGAAGG - Intergenic
914363079 1:146952832-146952854 ACTCAGTGCCAGAGCAGGGAGGG - Intronic
914488599 1:148134307-148134329 ACTCAGTGCCAGAGCAGGGAGGG + Intronic
914588963 1:149089388-149089410 ACTCAGTGCCAGAGCAGGGAGGG + Intronic
914879713 1:151538049-151538071 AATCACTGGGGCAGCAGGGAAGG - Exonic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915141796 1:153772609-153772631 AAGAAAAGGGAGAGCAGGGAAGG - Intronic
915283210 1:154836776-154836798 ACTCAGAGGGAGCCCAGGGGCGG - Intronic
915451533 1:156008866-156008888 AATCAGAGGAAAATAAGGGATGG + Intergenic
915733663 1:158071255-158071277 AGGCAGAGGGAGAGCGAGGAGGG - Intronic
916330036 1:163605068-163605090 AATCAGAGGCAGAGCAGGTTTGG + Intergenic
916569503 1:166012961-166012983 AGTCAGAGTGAGAGCAGAAAGGG + Intergenic
916884559 1:169054333-169054355 AATAAGAGGCAAAGCATGGAGGG - Intergenic
916917660 1:169427256-169427278 ATATAGAGGGAGAGAAGGGAAGG - Intronic
917453815 1:175168907-175168929 AAGCAGAGAGAGAACAGGGAGGG - Intronic
917723712 1:177810804-177810826 AATCAGAGGAAGAGAGGGAAAGG + Intergenic
918112567 1:181469952-181469974 AGCCAGAGGGTGAGGAGGGAGGG + Intronic
918204897 1:182299868-182299890 AAGGAGAGAGAGAGCAAGGAAGG + Intergenic
918230932 1:182531047-182531069 AATCACAGGTAGAGAAGAGAGGG - Intronic
918241741 1:182626254-182626276 TCCCAGAGGGTGAGCAGGGAAGG - Intergenic
918400899 1:184162090-184162112 CATGAGAGGAAGTGCAGGGAGGG + Intergenic
918421261 1:184366297-184366319 AATCAGAGGAAGAGCAAGGAAGG - Intergenic
919920656 1:202164705-202164727 AGGCTGTGGGAGAGCAGGGAGGG + Intergenic
920231740 1:204475225-204475247 GGTGAGAGGGAGAGCAGGGCAGG - Intronic
920847611 1:209606992-209607014 AAAAAGAGTGAGAGCAGGCAGGG + Intronic
921031615 1:211339599-211339621 CAGAAGAGGGAGAGCAGGTAGGG - Intronic
921729618 1:218562642-218562664 AATCGCAGGGAAAGCTGGGAAGG - Intergenic
922217392 1:223531482-223531504 ATTCAGGAGGAGAGCAGGTAGGG - Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922740286 1:228010580-228010602 CCTGAGAGGGAGAGCAGGGCTGG - Intronic
922895758 1:229098843-229098865 ATTCAGAGTGAGAGTTGGGAGGG - Intergenic
923570624 1:235110319-235110341 AGTTAGAGGGAGAACAGGGGTGG - Exonic
923899148 1:238306139-238306161 ATCAAGAGAGAGAGCAGGGAAGG - Intergenic
923932466 1:238717784-238717806 AGTGAGAGGGAGAGGAAGGAAGG - Intergenic
924096647 1:240558638-240558660 AATCACAGGGCGTCCAGGGAAGG - Intronic
924554632 1:245108002-245108024 AGTCAAGGGGAGAGCATGGAGGG - Intronic
924836373 1:247651817-247651839 CAACAGAGAGAGAGCGGGGAGGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063559020 10:7109169-7109191 ACTCAGAGGGAAAGGCGGGAGGG + Intergenic
1063693071 10:8305702-8305724 AATAAGAAGGAGAGGATGGAGGG - Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065651186 10:27893828-27893850 ATTCTGAGGGACAGTAGGGATGG - Intronic
1066381544 10:34906170-34906192 CATCCGAGGGAAGGCAGGGAAGG - Intergenic
1067098748 10:43319577-43319599 AAGCAGAGGACGAGCAGGCAGGG - Intergenic
1067228656 10:44391815-44391837 GACCAGAGGAAGAGCAGGGCTGG - Intergenic
1067557897 10:47285076-47285098 AAGGGGAGGGAGGGCAGGGAGGG + Intergenic
1067729225 10:48797185-48797207 CATCAGAGTGAGAGCAGCCATGG + Intronic
1067828628 10:49597349-49597371 ACCCAGAGGGAGGGCAGGAAAGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1070092462 10:73301380-73301402 AAAGACAGAGAGAGCAGGGAGGG - Intronic
1070469433 10:76764123-76764145 AGTCAGAGGGAGAGCAGATGGGG + Intergenic
1070656654 10:78276211-78276233 AATCAGATGGCTATCAGGGAAGG - Intergenic
1071039298 10:81286998-81287020 AAACACATGGATAGCAGGGAAGG + Intergenic
1071203120 10:83243220-83243242 AATCAGAGGGATAGCAGTCAGGG + Intergenic
1071436993 10:85656596-85656618 AACTAGAGGAAGAGCAGGCATGG - Intronic
1071444366 10:85731922-85731944 AAAGAGAGAGAGAGAAGGGAAGG + Intronic
1071802236 10:89076649-89076671 AATCAGAGGAAGAATAAGGAAGG + Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072739810 10:97902569-97902591 AAATAGAAGGAGAGCTGGGAAGG + Intronic
1073290453 10:102410765-102410787 AGTCGGAGGGAGGGCAGGGCTGG - Intronic
1073306686 10:102508431-102508453 CATCAAAGGTAGAGCTGGGATGG - Intronic
1073393410 10:103198067-103198089 AAAGAGAGGGAGAGGAAGGAAGG + Intergenic
1075223960 10:120608679-120608701 AATCAGAGGCAAAACATGGAGGG + Intergenic
1075316736 10:121459232-121459254 AATCAGAGAGAAAGCAGGAGAGG - Intergenic
1075447296 10:122522003-122522025 AATAAGAGGGAGAGCCCGTAGGG + Intergenic
1075456694 10:122589512-122589534 AAGCAGAGGGAGAAGAGGAAAGG + Intronic
1075514507 10:123098287-123098309 AATCAGAGTGTCAGCAGGGTTGG - Intergenic
1075741208 10:124697622-124697644 AACCACAGGGAGATCAGGGCTGG + Intronic
1076402639 10:130193831-130193853 AGTCAGAGGGAGAGCATAGGGGG - Intergenic
1076528900 10:131131264-131131286 GGTCAGAGGGATAGGAGGGAGGG + Intronic
1076916588 10:133425527-133425549 ATTAAGAAGGAGAGCAGGAAGGG + Intergenic
1077514491 11:2993133-2993155 CATGAGAGGGAGAACAGGGCGGG - Intergenic
1077630857 11:3810117-3810139 ACTCAGAGAGAGAGAAGGGCTGG - Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1079325929 11:19492544-19492566 AATCAGAGGGTAAGCTGGAAGGG + Intronic
1079603365 11:22338367-22338389 AGTGAGAGTGAGAGAAGGGAGGG - Exonic
1079669340 11:23147485-23147507 AATGAGAGGGAGACATGGGAGGG - Intergenic
1079702050 11:23560241-23560263 AATGAGAGTGAGGGCAGGGTAGG - Intergenic
1080434393 11:32226237-32226259 AATGAGAGGAAGAGGAGGGTCGG - Intergenic
1080822102 11:35817315-35817337 TGTCAGTGGCAGAGCAGGGATGG - Exonic
1081457092 11:43234241-43234263 GTTCAGAGGAAGGGCAGGGATGG - Intergenic
1081579725 11:44343955-44343977 AAACACATGGAAAGCAGGGAAGG + Intergenic
1082071991 11:47946709-47946731 AAAGAGAGAGAGAGAAGGGAGGG + Intergenic
1082767186 11:57179576-57179598 AATCGGAGACAGAGGAGGGATGG - Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1082896703 11:58199239-58199261 AATGAGAGGTAAAGCAGGTATGG - Intergenic
1083211999 11:61193977-61193999 AATCAAAAGGAGCGCAGGGAGGG - Intergenic
1083592092 11:63901829-63901851 CACCAGAGGGAGAGCAGGGCAGG - Intronic
1084641706 11:70430174-70430196 CTGCAGAGGGAGAGGAGGGAAGG + Intronic
1084858829 11:72005180-72005202 ATTCCAAGGGAGGGCAGGGATGG + Intronic
1084949984 11:72659507-72659529 AATTAGAGCGCAAGCAGGGAGGG - Intronic
1084962699 11:72725662-72725684 AATCAGAGGGAGAGCAGGGAGGG - Intronic
1085259195 11:75194550-75194572 AATGAAAGGGGGAGGAGGGAGGG - Intronic
1085446495 11:76604326-76604348 AAAGGGAGGGAGAACAGGGATGG - Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085725611 11:78952223-78952245 AATCAGAGTGAAAATAGGGAAGG - Intronic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088245305 11:107812520-107812542 AAAAAGAGGGAGGGCAGGGCGGG + Intronic
1088392944 11:109335250-109335272 AATCAAAGTGAAAGCAGGGTTGG - Intergenic
1089871701 11:121679984-121680006 AATCAGAGTTTGAGCAGGCAGGG - Intergenic
1089873186 11:121695033-121695055 AAAGAGAGGGAGGGCAGGTAGGG + Intergenic
1090242909 11:125196572-125196594 ATTCAGAGGCAGTGCAGGGGAGG + Intronic
1090358192 11:126154718-126154740 AACTCAAGGGAGAGCAGGGAAGG - Intergenic
1090499094 11:127244261-127244283 AACCAGAGGATGAGCAGGAAAGG - Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091155555 11:133368278-133368300 AGGGAGAGGGAGAGGAGGGAAGG + Intronic
1091215868 11:133901267-133901289 TACCAAAGGAAGAGCAGGGAAGG + Intergenic
1091797157 12:3304018-3304040 AATCGCAGGGAGAGCAAAGAGGG - Intergenic
1091952188 12:4603461-4603483 AAACAGAGGGAGAGAAGGGAAGG - Intronic
1092104589 12:5912559-5912581 ATGCACAGGGAAAGCAGGGAGGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092726739 12:11493972-11493994 AATCAGAGTCAGAGCAGGGAGGG - Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092904703 12:13090895-13090917 GAGCGGAGGGAGTGCAGGGAAGG - Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094747135 12:33357848-33357870 AATAAGGGGGAAAGAAGGGAAGG - Intergenic
1095121477 12:38424575-38424597 AAGCTGAGGGAGAGAAGGCAGGG + Intergenic
1095502901 12:42860079-42860101 AAAGAGAGAGAGAGGAGGGAAGG - Intergenic
1095946567 12:47757259-47757281 AATGAAGGAGAGAGCAGGGAGGG - Intronic
1095947814 12:47763747-47763769 GATGGGAGGGAGAGGAGGGATGG + Intronic
1095962101 12:47842103-47842125 GGCCAGAGGGAGAGCTGGGAAGG + Intronic
1096408502 12:51360746-51360768 AATCAGATGGAGATCTGGGGAGG - Exonic
1096773249 12:53949747-53949769 CATCACAGGGAGCACAGGGAAGG + Intergenic
1097969393 12:65616233-65616255 AAAGAGAGAGAGAGGAGGGAGGG - Intergenic
1097976817 12:65695454-65695476 ACTGGGAGGGACAGCAGGGAAGG - Intergenic
1098167204 12:67710715-67710737 ACTCAGAATGAGAGGAGGGAAGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098716120 12:73830077-73830099 AGACTGAGGGAGAGAAGGGAGGG - Intergenic
1099804955 12:87507225-87507247 AGTCAGAGAGAGAGAAGGAATGG + Intergenic
1100233660 12:92635559-92635581 AATCACAGGGAAAACTGGGATGG + Intergenic
1100368915 12:93947218-93947240 CATAAGGGGGAGAGGAGGGATGG - Intergenic
1102037035 12:109776601-109776623 AATAAGAGGGAGGGCAGTGATGG - Intergenic
1102052163 12:109870626-109870648 AAGCAGAAGGAGAGGAAGGAAGG + Intronic
1102348499 12:112174938-112174960 AGCCAGAGGGAGGGCAGGGCAGG + Intronic
1102579941 12:113879889-113879911 AGGCAGAGGGTGAGCAGAGAGGG + Intronic
1104714375 12:131006638-131006660 ACCCAGAAGGAGAGCAAGGAGGG + Intronic
1104956883 12:132471095-132471117 AAGGAGAGAGAGAGAAGGGAAGG + Intergenic
1105626178 13:22115093-22115115 AATCAGAGTCAAAGGAGGGATGG + Intergenic
1106753212 13:32796093-32796115 AATCAGAGGCCAGGCAGGGAAGG - Intergenic
1107143413 13:37030244-37030266 AAACTGAGGGAGACTAGGGAAGG + Intronic
1107871670 13:44752228-44752250 AAGCAGAGGGAAAGCAGGAGAGG + Intergenic
1108447287 13:50522177-50522199 AAAGAGAGGGAGAGAGGGGAGGG + Intronic
1109249867 13:60006643-60006665 AAGGAAAAGGAGAGCAGGGAAGG + Intronic
1111324510 13:86675540-86675562 AATCAAAGTGTAAGCAGGGATGG + Intergenic
1111571061 13:90087057-90087079 AATAGGAGGGAGAGCAGAAAAGG + Intergenic
1111929869 13:94502284-94502306 GATGAGGGGGACAGCAGGGAGGG - Intergenic
1112465605 13:99642111-99642133 AATCTGAGGGATTGCTGGGAAGG + Intronic
1112474784 13:99721618-99721640 AATTAGAGGGGGAGGGGGGAGGG - Intronic
1113360778 13:109629384-109629406 AATCACAGGGGGAGAAAGGAAGG + Intergenic
1113457268 13:110457646-110457668 TGGCAGATGGAGAGCAGGGACGG - Intronic
1113576842 13:111401012-111401034 GCAGAGAGGGAGAGCAGGGATGG - Intergenic
1113744913 13:112737518-112737540 GACCAGAAGGAGAGGAGGGAAGG + Intronic
1113748985 13:112765428-112765450 AATCAGATGGAGTGAGGGGAAGG - Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115085271 14:29507842-29507864 AAGAGAAGGGAGAGCAGGGAGGG + Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1117734390 14:58754390-58754412 AATCAGGGGGAGAGAAGGCTAGG - Intergenic
1119801838 14:77452488-77452510 AATCAGATGGGGACCAGGGATGG + Intronic
1120022982 14:79551219-79551241 AATGAGAGGGAAAGAAAGGAAGG - Intronic
1120397981 14:83992579-83992601 AATCAGTAAGAGAGCTGGGAGGG + Intergenic
1121781947 14:96627716-96627738 AAGCAGAGAGAGAGAAGGGTGGG + Intergenic
1122088369 14:99322327-99322349 AACCAGAAGGAGAGGGGGGACGG + Intergenic
1122473432 14:101988206-101988228 AATCATAAGGAAAGCAAGGAAGG - Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122632993 14:103116184-103116206 ACTCAGAGGGTTGGCAGGGATGG - Intergenic
1123494106 15:20807259-20807281 TATCAGAGGCTGAGCAGGGTGGG + Intergenic
1123705803 15:22950390-22950412 CATCAGAGAGAGAGAAGGAAGGG + Intronic
1124059543 15:26276842-26276864 AAGGAGAGGTAGAGGAGGGAGGG + Intergenic
1124512415 15:30338525-30338547 AAACAGCAGGAGAGCTGGGAAGG + Intergenic
1124635576 15:31362701-31362723 GAGCAGATGGAGAACAGGGAAGG - Intronic
1124730499 15:32192226-32192248 AAACAGCAGGAGAGCTGGGAAGG - Intergenic
1125159209 15:36624196-36624218 AACCAGAGGATGAGCAGAGATGG - Intronic
1125164491 15:36686735-36686757 AAAGAGAGAGAGAGAAGGGAGGG + Intronic
1125431070 15:39593901-39593923 AAGCAGACAGAGAGGAGGGAAGG - Intronic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126963779 15:54028403-54028425 GATTAGTGGCAGAGCAGGGATGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127761708 15:62146187-62146209 AATCAGGGTGAGGGTAGGGAAGG - Intergenic
1128551534 15:68600907-68600929 AATCAGCAGGACAGCCGGGAAGG - Intronic
1128891605 15:71336999-71337021 AATCAGAGAGAGAGGGGAGAGGG + Intronic
1128912551 15:71529200-71529222 ACTCAGATGGTGGGCAGGGAGGG - Intronic
1129072740 15:72964537-72964559 ACTCAGTTGGAGAACAGGGAAGG - Intergenic
1130012909 15:80165808-80165830 AAGGAGAGTGAGACCAGGGAGGG + Intronic
1130025844 15:80269750-80269772 CAGCAGAGGGAGAGCTGGGATGG - Intergenic
1130325491 15:82876147-82876169 AATCAAAGGGAGAGAGGCGAGGG - Intronic
1131068758 15:89450855-89450877 ACGTAGAGGGAGAGAAGGGAAGG + Intergenic
1131430524 15:92384656-92384678 AACCAGAGGGAAAGAAGGGCAGG + Intergenic
1131721063 15:95169480-95169502 AATAAGAGGGAGTGGAGGGTGGG + Intergenic
1132062526 15:98704239-98704261 AATGAGAGGTAGGGGAGGGAGGG + Intronic
1202958947 15_KI270727v1_random:103595-103617 TATCAGAGGCTGAGCAGGGTGGG + Intergenic
1132698519 16:1212431-1212453 GGGCTGAGGGAGAGCAGGGAGGG + Intronic
1132950145 16:2557163-2557185 AATACGAAGGAGAGGAGGGAGGG - Intronic
1132964201 16:2643007-2643029 AATACGAAGGAGAGGAGGGAGGG + Intergenic
1133467405 16:6041110-6041132 CTGCAGGGGGAGAGCAGGGAGGG - Intronic
1134031534 16:10996125-10996147 ATTCAGTGGGGCAGCAGGGAGGG - Intronic
1134098279 16:11434045-11434067 AAGCAGAGGGAGGACAGGAAGGG + Intronic
1134356088 16:13483611-13483633 GATTAGAGGGAGAGGAGGGCTGG - Intergenic
1134609633 16:15598073-15598095 CAACAGATGAAGAGCAGGGAGGG + Intronic
1134908429 16:18002221-18002243 ACTCAGAGGGAAAGCGGGGAGGG + Intergenic
1135043421 16:19135459-19135481 AATCAGAAGGAGAGAAAGCAGGG + Intronic
1135277631 16:21127210-21127232 AGGCAGAGGGAGACCAGGCATGG + Intronic
1135758057 16:25114519-25114541 CATCATAAGGAGAGCAGAGAAGG - Intronic
1135892127 16:26366665-26366687 AAGCAGAGGGAGAGGGAGGAGGG + Intergenic
1136176706 16:28522071-28522093 AATGAGAGAGAGAAAAGGGAGGG - Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137303079 16:47172537-47172559 ACTGAGATGGAGAGCAGGTAGGG - Intronic
1137559916 16:49495894-49495916 TATCAAAGGGAGACCAGGCAGGG - Intronic
1137722538 16:50635947-50635969 AATCCGAGGGACAAGAGGGAGGG - Exonic
1137911829 16:52385317-52385339 AATAAGGGGGAGGGCAGTGAGGG + Intergenic
1137944324 16:52719167-52719189 AGTAAGAGGGTGAGCAGTGAAGG - Intergenic
1138054135 16:53814687-53814709 GGTCACAGGGAGAGCTGGGATGG - Intronic
1138199138 16:55076112-55076134 AATAAGAGGAGGAGAAGGGAGGG + Intergenic
1138223600 16:55274035-55274057 GGTCAGATGGAGAGCTGGGAAGG - Intergenic
1138246037 16:55467918-55467940 AATCAGAGGCAGATCTGGGTGGG + Intronic
1138415932 16:56871291-56871313 AGTCAGAGGGAAAGCAAAGAAGG + Intronic
1138434333 16:56988890-56988912 GGTAGGAGGGAGAGCAGGGAAGG - Intergenic
1138463416 16:57168055-57168077 AAGTGGAGGGAGAGGAGGGAGGG - Intronic
1138929145 16:61631201-61631223 TATGAGAGAGAGAGAAGGGATGG + Intergenic
1139092347 16:63663513-63663535 AATAACAGGGAGAGAGGGGAGGG - Intergenic
1139210030 16:65068014-65068036 GAGAAGAGGGAAAGCAGGGAGGG + Intronic
1139291447 16:65862062-65862084 AAAGAGAGGGAGAGAAGTGAAGG - Intergenic
1139443320 16:66979875-66979897 CATCTGAGGGAGAGCAGGGCTGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139876849 16:70153016-70153038 AATCAGATGAAGACCATGGAGGG + Intronic
1139949144 16:70660810-70660832 AATGAGAGGGATGCCAGGGATGG + Intergenic
1139978652 16:70835530-70835552 GAACAGAGGGAGTACAGGGAAGG + Intronic
1139999812 16:71013778-71013800 AGTCTGGGGGTGAGCAGGGAGGG + Intronic
1140707114 16:77641144-77641166 CAAGAGTGGGAGAGCAGGGATGG - Intergenic
1140962518 16:79930214-79930236 AATCAAAGGGAAAGAAAGGAGGG - Intergenic
1141304159 16:82845332-82845354 AATGTGAGGGAAAGCAGAGATGG - Intronic
1141773024 16:86102331-86102353 AAGGAGAGGGAGAGGAAGGAAGG - Intergenic
1142479998 17:213391-213413 CATCAGAGCCAGAGCAGTGAGGG - Exonic
1142606376 17:1083646-1083668 GAACAGAGGGAGAGGAGGGTGGG + Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1144457577 17:15431715-15431737 TATTAGAGAGAGAGAAGGGACGG - Intergenic
1144536091 17:16093384-16093406 AATGAGAAGGAAAACAGGGAGGG - Intronic
1144793670 17:17876728-17876750 CATCAGTGGGAGGGCAAGGATGG + Intronic
1145250791 17:21295869-21295891 GAGCAGAGAGAGTGCAGGGAGGG + Intronic
1145312413 17:21707872-21707894 AGCAGGAGGGAGAGCAGGGAAGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146277496 17:31524745-31524767 AATCAGAGGGGTGGCCGGGAAGG + Intronic
1146290198 17:31601224-31601246 AAGCAGAGGGAGAGAAGGCAAGG + Intergenic
1146427110 17:32750910-32750932 AATAAGAGAGAGAGCAGAAAAGG - Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146516670 17:33495081-33495103 AATGAGAGGGAGAGAAGTGAGGG + Intronic
1147250026 17:39147617-39147639 AGTCAAAGGAAGTGCAGGGAGGG + Intronic
1148031900 17:44627709-44627731 AATCAGAGGGCGGGCAGGGAAGG - Intergenic
1148353575 17:46958652-46958674 CATCAGAGGGAGTGGTGGGAGGG - Intronic
1148771184 17:50067792-50067814 CAGCAAAGGGAAAGCAGGGAAGG - Intronic
1149218254 17:54384422-54384444 AACTAGAGGGAGAGAAGTGATGG - Intergenic
1149862114 17:60127789-60127811 AATGAGAGGGAGCACAGGGCTGG + Intergenic
1149864818 17:60145486-60145508 AATCTGGGGGAGGGGAGGGAGGG - Intergenic
1149885296 17:60333648-60333670 AAAGGGAGGGAGAGAAGGGAAGG + Intronic
1150127928 17:62650552-62650574 AATAAGGGGAAGAGCTGGGAAGG - Intronic
1150225997 17:63524699-63524721 GAGCAGACGGAGAGGAGGGAAGG - Intronic
1151257458 17:72889967-72889989 AACCAGAGGCAGGGCAGGCATGG + Intronic
1151882885 17:76905444-76905466 GATCAGAGGGAGAGAGGGGTAGG + Intronic
1151960006 17:77400820-77400842 TATCAGGGCCAGAGCAGGGAGGG - Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152197160 17:78924762-78924784 AAAGAAAGGGAGAGGAGGGAGGG + Intronic
1152256883 17:79245044-79245066 AAGGAAAGGGAGAGGAGGGAAGG - Intronic
1152920347 17:83063436-83063458 GGTGAGGGGGAGAGCAGGGAGGG - Intergenic
1153618716 18:6956476-6956498 AATCAGAGCGGGGACAGGGAGGG - Intronic
1153738244 18:8095451-8095473 AATCAGAGAGAGGGGTGGGATGG + Intronic
1154178202 18:12103176-12103198 CATCAGAGGGAGAGCAAGAAAGG + Exonic
1154451636 18:14481717-14481739 TATCAGAGGCTGAGCAGGGTGGG + Intergenic
1155347759 18:24875519-24875541 TAGGAGAGGAAGAGCAGGGAAGG - Intergenic
1155630678 18:27888510-27888532 AAGCAGAGTGGGACCAGGGAAGG + Intergenic
1155718236 18:28973649-28973671 AAGAAGAAGGAGAGCAGAGAAGG - Intergenic
1156454316 18:37284472-37284494 AACCAGAGGGAGCCAAGGGAGGG - Intronic
1158118726 18:54025548-54025570 AGACAGATGGAGAGCAGGGTGGG + Intergenic
1159054908 18:63453766-63453788 AGTCAGACGGTGAGCAGGGCAGG - Intergenic
1159313815 18:66744417-66744439 GATCAGAGTGAGAGGAGGAAGGG - Intergenic
1159325986 18:66918378-66918400 AATGAGAGAGGGAGGAGGGAAGG - Intergenic
1160156340 18:76436698-76436720 AATGAGGGGGTGAGCTGGGAGGG - Intronic
1160760543 19:782074-782096 TCACAGAGGGACAGCAGGGAGGG - Intergenic
1161083958 19:2325397-2325419 GGTAAGAAGGAGAGCAGGGAGGG - Intronic
1161613093 19:5254568-5254590 AAGCAGAGGGAGAGTTGGGGAGG + Intronic
1162111790 19:8403624-8403646 CCACAGAGGGACAGCAGGGAGGG - Exonic
1162135742 19:8554343-8554365 AAACAGAGTGAGGGCAGAGAGGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163598833 19:18235875-18235897 AACCAGTGGGAGTGCGGGGAAGG - Intronic
1163964452 19:20731686-20731708 AAAAAGAGGGAGAGTAGAGATGG + Intronic
1164603534 19:29579627-29579649 GAGCAGATGGAGACCAGGGAGGG - Intergenic
1164654357 19:29910054-29910076 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164654382 19:29910134-29910156 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164654428 19:29910274-29910296 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164873946 19:31670080-31670102 AATCAGAGACAGAGCTGGAAAGG + Intergenic
1165323286 19:35099453-35099475 AATCAGGGTGAGTGCAGGGGAGG - Intergenic
1165939045 19:39406297-39406319 ATTCAGAGGGAGAAGAGGGTTGG - Intergenic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166343635 19:42152428-42152450 AGAGAGAGGGAGAGAAGGGAGGG - Intronic
1166856356 19:45784299-45784321 GATGAGAGGGAGAGATGGGAGGG + Intronic
1166983769 19:46648102-46648124 AATGAGAGGGAGAGCGGTGGAGG + Exonic
1167112797 19:47471891-47471913 ACTGAGAGGGAGAGCCGGGGAGG + Exonic
1167191342 19:47991935-47991957 GAGCAGAGTGAGAGCAAGGAAGG - Intronic
1167647384 19:50713086-50713108 CATCTGAGGGAGAGAAGGGAGGG + Intronic
1167696192 19:51016892-51016914 AATCAGCGGGAGAGGAGTGACGG + Intronic
1167792724 19:51691201-51691223 AAAGAGAGAGAGAGAAGGGAGGG + Intergenic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168220357 19:54956118-54956140 CAACAGAGGGAGAGAAAGGAAGG + Intronic
1168327185 19:55544460-55544482 AGTCCGAGGCAGAGCAGGGAGGG - Intronic
1168517208 19:57017916-57017938 GATCAGAGGGAGGGAAGGGGAGG - Intergenic
1168705153 19:58466635-58466657 AGTGAGAGGCAGAGCTGGGAAGG + Intergenic
1202679663 1_KI270711v1_random:40865-40887 ACTCAGTGCCAGAGCAGGGAGGG + Intergenic
925063967 2:914893-914915 AGTCATTGGGAGAGCATGGACGG - Intergenic
925063985 2:914979-915001 AGTCATTGGGAGAGCATGGACGG - Intergenic
925064005 2:915065-915087 AGTCATTGGGAGAGCACGGACGG - Intergenic
925380750 2:3424021-3424043 AAGGAGAGGAAGCGCAGGGATGG - Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925549928 2:5062354-5062376 ATTCAGAGGTAGAGCTGGGCTGG - Intergenic
925625925 2:5842048-5842070 AAGAAGAGGGAGAGGAGGGGAGG + Intergenic
925836549 2:7952196-7952218 AATCTGGCGGGGAGCAGGGAAGG - Intergenic
926391651 2:12400006-12400028 AAACAGAGGGAGAGGAGGCTTGG + Intergenic
927168577 2:20350298-20350320 AATCGGAGGGAGAACCGGGTCGG + Intronic
927396770 2:22661128-22661150 AATCAAAGGTACAGCATGGATGG + Intergenic
927484552 2:23479546-23479568 AAGCAGAGGGAGTGGAGGGAGGG - Intronic
927674841 2:25097790-25097812 AAACGAAGGGAGAGCAGGGGAGG + Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928107119 2:28477699-28477721 AAGCAGAGGGAGGCCAGGAAGGG + Intronic
928314798 2:30236813-30236835 AATCAGAGGGAGGGCAGACTGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928873618 2:36011316-36011338 AATGAGAGGCTGAGGAGGGATGG - Intergenic
929043876 2:37772251-37772273 AATCAGATGGAAAGCAGTGCTGG - Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930136260 2:47906175-47906197 AAAGAGAGGGAGAGAAGGGAGGG + Intergenic
930864096 2:56105884-56105906 AAGAAGAGAGAGAGCAGGGGAGG + Intergenic
931157691 2:59653961-59653983 AGCCAGAGGGAGAAAAGGGAAGG - Intergenic
931178850 2:59879848-59879870 AATGAGAGGGAGAGCGGGAAGGG + Intergenic
931382563 2:61767054-61767076 AATCAGAGTGCCAGCATGGATGG + Intergenic
931697025 2:64879023-64879045 CACCAGAGGCAGAGCATGGAAGG + Intergenic
932200179 2:69819747-69819769 AATCACAGGAGGTGCAGGGAAGG + Intronic
932468012 2:71935764-71935786 AAAGAGAGGGGAAGCAGGGAGGG + Intergenic
932626168 2:73297624-73297646 AAAAAGAGGGAGTGGAGGGAAGG - Intergenic
932770510 2:74498417-74498439 AAGTAGAGGGAGAGCCAGGAAGG + Intronic
932839876 2:75072183-75072205 GCACAGAGGGAGAGAAGGGAAGG + Intronic
933158934 2:79002966-79002988 CACCAAAGGGATAGCAGGGAAGG + Intergenic
933183530 2:79253638-79253660 AAACAGAGGGACAGCAAGGAAGG + Intronic
933265291 2:80174955-80174977 AAGCAGTGGGAGAGAAGTGAAGG - Intronic
935083569 2:99823042-99823064 AACCAGAGGGAAAGCATGAAGGG - Intronic
935346303 2:102111665-102111687 AATGAGAAGGAGAGCAGGAAGGG + Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936259587 2:110947608-110947630 AGGCAGAGGGGGAGAAGGGAAGG - Intronic
936285510 2:111178378-111178400 AATGAGTGGGTGACCAGGGAAGG - Intergenic
936458974 2:112697348-112697370 AAAGGGAGGGAGAGAAGGGATGG - Intergenic
936940606 2:117880124-117880146 ATTCAGAGGCAGAGCAAAGATGG - Intergenic
938214902 2:129503239-129503261 GATCAGAGGGTGAGAAGTGAAGG - Intergenic
938271795 2:129978953-129978975 AAACAGAGAGAGATGAGGGAGGG + Intergenic
938444208 2:131364853-131364875 AAACAGAGAGAGATGAGGGAGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938569185 2:132546631-132546653 AATCAGAAAGAGGGGAGGGAAGG - Intronic
938691304 2:133791992-133792014 AATCAGAGAAACAGCAGGGAGGG + Intergenic
938695174 2:133828388-133828410 AAAGAGAGGGAGTCCAGGGAAGG + Intergenic
938730399 2:134142678-134142700 AATCAGAAGCTGAGAAGGGAAGG + Intronic
939012119 2:136858909-136858931 AATGGGAGTGACAGCAGGGAAGG + Intronic
939415511 2:141891226-141891248 AAGCAGAGAGAGAGAAGGAAAGG + Intronic
939681827 2:145145391-145145413 AATGTGTGTGAGAGCAGGGAGGG + Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941069477 2:160939740-160939762 AGTCAGACTGAAAGCAGGGAAGG - Intergenic
941613831 2:167695892-167695914 AACCAGAGGGAAAGGAGGCAGGG + Intergenic
943559712 2:189446227-189446249 AGTCAGAGGGAAAACAGTGAAGG + Intronic
943639515 2:190343555-190343577 ATTCAGAGGGAGGGCCAGGAAGG - Exonic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
943785701 2:191876154-191876176 AGTGAGAGGGAGAGCTGGGGAGG + Intergenic
944099687 2:196010121-196010143 AAGAAGAAGAAGAGCAGGGAGGG - Intronic
944144697 2:196494478-196494500 AATCAGATGGGGAGAAGGCAGGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945493126 2:210478949-210478971 AAAGAGAAGGAAAGCAGGGAGGG - Intronic
945785189 2:214225421-214225443 GATCAGAGTGAAAGCAGGGAAGG + Intronic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946026738 2:216676450-216676472 AACGAGAGGAAGAGAAGGGAAGG - Exonic
946037688 2:216756770-216756792 AGCCAGAGGTAGAGCAGAGATGG - Intergenic
946093451 2:217250746-217250768 AGTCAGAGTGAAAGAAGGGAGGG + Intergenic
947740055 2:232480892-232480914 CTTCACAGGGAGAGCAGGGAGGG - Intronic
947927650 2:233935736-233935758 GGTCAGAGAGACAGCAGGGAGGG + Intronic
948000288 2:234562189-234562211 CATCAGGGGGAGACCATGGAAGG - Intergenic
948075690 2:235163709-235163731 AAGGAAAGGGAGAGCAGAGATGG - Intergenic
948397865 2:237661062-237661084 AAGCGGTGGGAGAGCAGAGATGG - Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169472862 20:5903236-5903258 AAAGAGAGGGAGAGGAGGGCCGG + Intergenic
1169476275 20:5933852-5933874 ACTCAGAAGGAGAGGAGGAAAGG - Intergenic
1169897679 20:10521854-10521876 GAGCAGAGGGAGTGCAGAGATGG + Intronic
1170747795 20:19116234-19116256 AATCAAAGGGAGGTCAGAGAGGG - Intergenic
1170984445 20:21244833-21244855 AATAAGCTGGAGAGCAGGGCTGG - Intronic
1171958606 20:31477542-31477564 AATCAGAGACAGAGCAGGCCTGG + Intronic
1172134309 20:32676694-32676716 CAGCAGAGGGAGTGCAGGCATGG + Intergenic
1172531197 20:35632383-35632405 AATCTGGGGAAAAGCAGGGAAGG + Exonic
1172554732 20:35831151-35831173 AATGAGAAGGAAAGGAGGGAGGG - Intronic
1172720788 20:36999452-36999474 AGGGAGAGGGAGAGGAGGGAGGG - Intronic
1172902928 20:38347958-38347980 AGGCAGAGGGAAATCAGGGAAGG + Intronic
1172965937 20:38835337-38835359 AATCAGAAGGGGTGCAGGGAGGG - Intronic
1173334978 20:42105271-42105293 AAAGTGAGGCAGAGCAGGGAAGG - Intronic
1173464420 20:43269648-43269670 AAGTAGAGGGAGAGAAGAGAGGG + Intergenic
1173600617 20:44292448-44292470 AAACAGAGAGAGAGAAGGGAGGG + Intergenic
1173849402 20:46208352-46208374 AGCCAGAGGCAGAGCAGGGATGG - Intronic
1174282089 20:49446870-49446892 CTTCAGAGGGAGATGAGGGATGG - Intronic
1174306031 20:49614937-49614959 AAACAAAGGGAGAACGGGGAGGG + Intergenic
1174767459 20:53267350-53267372 AGGGAGAGGGAGAGCATGGATGG + Intronic
1174817283 20:53697695-53697717 AAGGAAAGGGAGAGGAGGGAGGG + Intergenic
1174869007 20:54166227-54166249 CACCAGAGGAAGAGAAGGGAAGG + Intronic
1175748070 20:61475495-61475517 AGAGAGAGGGAGAGGAGGGAGGG - Intronic
1175838858 20:62014230-62014252 AGCCACAGGGAGAGAAGGGAAGG + Intronic
1175871821 20:62212871-62212893 AGCCGGAAGGAGAGCAGGGATGG + Intergenic
1175959142 20:62626258-62626280 AACCAGAGGAAGGGCAGGGACGG + Intergenic
1176037699 20:63048426-63048448 CATCAGAGGGCGTGCAGTGACGG - Intergenic
1176164379 20:63665055-63665077 ACTCCCAGGGATAGCAGGGAAGG - Intronic
1176361422 21:5999863-5999885 GATCTGTGGGAGAGCAGGGAAGG + Intergenic
1176444509 21:6808506-6808528 TATCAGAGGCTGAGCAGGGTGGG - Intergenic
1176822674 21:13673544-13673566 TATCAGAGGCTGAGCAGGGTGGG - Intergenic
1177115070 21:17075345-17075367 AATAAGAAGAAGAGAAGGGAGGG - Intergenic
1178036197 21:28585760-28585782 AATTATAGGGAGAATAGGGAAGG + Intergenic
1178109693 21:29357739-29357761 CATCACAGAGAGAGCAAGGATGG - Intronic
1178234076 21:30821710-30821732 AATCAAGGAGAGAGCTGGGAAGG + Intergenic
1178960970 21:37064600-37064622 ATTCAGAGGAGGAGCTGGGAAGG - Exonic
1179209383 21:39313037-39313059 AACCCGAGGGAGCGCGGGGACGG + Intronic
1179266131 21:39805369-39805391 AATCAGGTGGAGAGCAGGACAGG + Intergenic
1179352127 21:40621886-40621908 AAAGAGAGAGAGAGAAGGGAGGG + Intronic
1179762096 21:43538687-43538709 GATCTGTGGGAGAGCAGGGAAGG - Intronic
1179918380 21:44493236-44493258 AATCAGAGGATGATCTGGGAGGG - Intergenic
1180022303 21:45136076-45136098 GATCAGAGGGATCGGAGGGAGGG + Intronic
1180616471 22:17131535-17131557 AATCAGAGGGGGAGGAGGTAGGG + Intronic
1180844323 22:18973132-18973154 GAACAGGGGGAGGGCAGGGAGGG - Intergenic
1181057148 22:20265579-20265601 GAACAGGGGGAGGGCAGGGAGGG + Intronic
1181149121 22:20870142-20870164 AAGTAGAGGTAGGGCAGGGAGGG + Intronic
1181282202 22:21728039-21728061 AATGCCAGGGAGAGCGGGGAAGG + Intronic
1181418550 22:22779674-22779696 AAAAAGAAGGAGAGAAGGGAAGG + Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182797212 22:32999749-32999771 AACTAGAGGGAGGGCAGGGCAGG + Intronic
1182963594 22:34501106-34501128 GGTCAGAGGCAGAGCAGGTAAGG + Intergenic
1183770014 22:39916085-39916107 AATCTGGGGCAGAGCTGGGAAGG - Intronic
1184100078 22:42337352-42337374 AATGCAAGGGTGAGCAGGGATGG - Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184213655 22:43052025-43052047 AGGAAGAGGGAGAGGAGGGAAGG - Intronic
1184358095 22:43996005-43996027 GATGAGAGGCGGAGCAGGGAGGG - Intronic
1184658621 22:45955154-45955176 CAGCAGTGGGAGGGCAGGGATGG - Intronic
1185283869 22:49990568-49990590 CAACAGAGGGAGACCAGAGAGGG + Intergenic
950152211 3:10696597-10696619 AAGCAGAGGGAAGGCAGGGCAGG - Intronic
951003645 3:17593118-17593140 AAACTGAGGGAGAGAAGGCAGGG - Intronic
951279184 3:20726344-20726366 TATCAGAGGCTGAGAAGGGAAGG - Intergenic
951534098 3:23725994-23726016 AAAGAGAGAGAGAGGAGGGAGGG + Intergenic
951546366 3:23829977-23829999 AATAAGAAGGAGTGGAGGGAAGG - Intronic
951906192 3:27710207-27710229 AATCTGAGGGAGAGAAAGGTCGG - Intergenic
952020217 3:29009799-29009821 AATGAGTGAGAGAGAAGGGAAGG - Intergenic
952535075 3:34300636-34300658 TATGAGTGGGAGAGGAGGGAAGG + Intergenic
952753371 3:36843823-36843845 CAGCAGAGGGCGAGCAGGGAGGG - Intronic
952861614 3:37817448-37817470 AAACTGTTGGAGAGCAGGGAAGG + Intronic
952953014 3:38539303-38539325 AGTCAGAGGCAGAGCTGGGAAGG - Intronic
952979639 3:38724192-38724214 GATAAGAGGGAGGGCTGGGACGG - Intronic
953037621 3:39227069-39227091 AAAGAGAGGGAGAGGAGGGAGGG - Intergenic
953263890 3:41367365-41367387 ATTCAGAGGAGGAACAGGGACGG + Intronic
953476787 3:43212053-43212075 GACCAGTTGGAGAGCAGGGATGG + Intergenic
953582521 3:44169833-44169855 AATCAGAGGTAGAGCCAGGACGG + Intergenic
954049729 3:47964313-47964335 AATCAGGGAGAGAGCAGTGGAGG + Intronic
954297586 3:49682762-49682784 AATTTGAGGTAGAGGAGGGAAGG - Intronic
954367266 3:50153220-50153242 AATGGCAGGGAGACCAGGGAAGG - Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954943008 3:54392545-54392567 ATTCAGAGGGATAACAGGTATGG + Intronic
955055760 3:55454754-55454776 GTTCAGAGGTAGAGAAGGGAGGG - Intergenic
955362487 3:58287631-58287653 AATCAGAGCCTGAGCAGCGAAGG + Intronic
955365807 3:58308901-58308923 ATCCAGAGGGAGAGCAAGGTTGG + Intronic
955585605 3:60474152-60474174 AAGCAGACAGAGGGCAGGGAGGG + Intronic
955655544 3:61241171-61241193 AATCCAAGGGAGAGCAGGAGAGG - Intronic
955897631 3:63717533-63717555 AACCAGAGAGAGAGCAGCGTGGG - Intergenic
956111087 3:65870504-65870526 AATGAGAAAGAGAGCAGGGAAGG + Intronic
956560371 3:70568205-70568227 AATCAGGGTGTGAGCAGGAATGG - Intergenic
956643159 3:71433508-71433530 CATCAGAGAGAGGGCAGGCAGGG + Intronic
957163878 3:76645590-76645612 AATAAGAGAGTGGGCAGGGAGGG + Intronic
957717845 3:83954352-83954374 AATGAGAGGAAGAGAAGGAAGGG + Intergenic
957721122 3:84000531-84000553 ATTCAGAGGGAAAGGCGGGAGGG - Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960552000 3:118986196-118986218 ATTCAGCGGGAGAGGAGTGAGGG - Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960995186 3:123335944-123335966 AATGAGAGGGAGAGAAGAAAAGG + Intronic
961175866 3:124834595-124834617 AAAGAGAGAGAGAGAAGGGAAGG + Intronic
961674003 3:128554089-128554111 GATGAGAGGGAGAGAAGGTAAGG + Intergenic
961744006 3:129052040-129052062 GATCTGATGGAGAGCAAGGAGGG - Intergenic
961791691 3:129380982-129381004 TTTCAGAGGGAGAGTGGGGAGGG + Intergenic
962508353 3:136071964-136071986 AAACAGAGAGTGATCAGGGAGGG - Intronic
962665188 3:137647301-137647323 AATAAGAGAGAGGGAAGGGAGGG + Intergenic
962812129 3:138968600-138968622 AAGGAGAGGGAGAGGAGGGAGGG + Intergenic
963112906 3:141701469-141701491 AATTAGAGAGAGATCAGTGAGGG + Intergenic
963254446 3:143130820-143130842 AGGAAGAGGGAGGGCAGGGATGG - Intergenic
963300394 3:143591164-143591186 AATAAATGGGAGATCAGGGAAGG - Intronic
963333044 3:143937793-143937815 AAAGAGAGGGAGAGAAAGGAAGG - Intergenic
963359217 3:144248971-144248993 AATGAGAGAGAGAGAAAGGAAGG - Intergenic
963604984 3:147406011-147406033 ATTCACAAGGAGAGAAGGGAAGG + Intronic
963673692 3:148282045-148282067 AATCAGAAGGATACAAGGGATGG + Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
963989842 3:151640335-151640357 GAGCAGAGGGAAAGCAGGGTGGG - Intergenic
964365839 3:155950062-155950084 AATCAGAAATAAAGCAGGGAAGG - Intergenic
964373943 3:156031223-156031245 AAAGAGAGGGAGAGCAGGAAAGG + Intergenic
964619414 3:158706275-158706297 AAGCTGAGGGACAGCAGGGAAGG + Intronic
964804148 3:160588105-160588127 AAGCAGAGGGAGGACTGGGAAGG + Intergenic
966400518 3:179542693-179542715 AAAGAGAGGCAGAGAAGGGAGGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967018709 3:185503962-185503984 AATCTCAGGAAGGGCAGGGATGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968824873 4:2887805-2887827 AGACACAGGGAGAGCAGGGCTGG + Intronic
968984297 4:3866797-3866819 CATGTGAGGGACAGCAGGGATGG + Intergenic
969429478 4:7145775-7145797 TTTCAGAAGGAAAGCAGGGAAGG - Intergenic
969480593 4:7445013-7445035 GAGCAGAGGGAGGGCGGGGAGGG + Intronic
970024493 4:11608594-11608616 AATAATAGAGACAGCAGGGATGG - Intergenic
970075722 4:12217259-12217281 AATCAAAGCGCCAGCAGGGATGG + Intergenic
970225432 4:13852049-13852071 AATGAGAGGGAGAGAAGGAAAGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970690599 4:18615734-18615756 ACACAGAGGGAGAGAAAGGAAGG + Intergenic
971759591 4:30748231-30748253 AATCAGAGGCCGAGAAGGGGTGG + Intronic
971847887 4:31944458-31944480 AAGCAGAGGAAGAGCTGGTAAGG - Intergenic
972544896 4:40071172-40071194 AAGGAGAGGCAGAGTAGGGAAGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
972665442 4:41160650-41160672 GGTGAGAGGGAGACCAGGGAAGG - Intronic
972702746 4:41509717-41509739 AAACAGATGGAGAACATGGAAGG + Intronic
973634787 4:52851974-52851996 AGTCAGAGGGAGAGCAGGACAGG - Intergenic
975126307 4:70786232-70786254 TACCAGAGGGAGAGGAGGCAGGG + Intronic
975174963 4:71277618-71277640 AATGAGAGAGAGAGGAAGGAAGG - Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976716648 4:88129987-88130009 AAAAAGAGGCAGAGAAGGGAGGG + Intronic
977261848 4:94806589-94806611 AATAAAAGGGAAAGTAGGGAAGG - Intronic
977609437 4:99017011-99017033 AATTTGGGGGAGAGGAGGGAGGG + Intronic
977779935 4:100969121-100969143 AAACAGAGGCAGAGGTGGGAAGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979542901 4:121906617-121906639 GAACAAAGGGAGAGCAGGGAGGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982194803 4:152900154-152900176 AATGAGAGAGGGAGAAGGGAGGG + Intronic
983166422 4:164482351-164482373 AGTCAGAGGGAGGGTGGGGAGGG + Intergenic
983195856 4:164806005-164806027 AATTAGAAGGAGAACAGAGAAGG + Intergenic
983268148 4:165529620-165529642 AAAGAGGAGGAGAGCAGGGATGG - Intergenic
983868318 4:172794817-172794839 ACACAGAGGTAGAGTAGGGAAGG - Intronic
983885342 4:172975021-172975043 AACCAGAAGGAGAGAAGAGAGGG - Intronic
984726338 4:183025324-183025346 ATTCAGAGAGATAGCAGAGATGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985002031 4:185495018-185495040 AATAAAAGGGAGAGGAAGGAAGG + Intergenic
985850860 5:2388254-2388276 AAAGAGAGGGAGAGACGGGAGGG - Intergenic
985945749 5:3181617-3181639 AATCAGAGGTGGGGCAGGGTGGG - Intergenic
986240277 5:5954650-5954672 AAAGAGAAGGAGAGCAGGGTGGG - Intergenic
986241613 5:5965057-5965079 AATCTGAGGGACACGAGGGAGGG - Intergenic
986859175 5:11905383-11905405 AATCAGAGGGACAGGGGCGAAGG - Intergenic
987001586 5:13665502-13665524 AATCAGTGGGAGAACTGGGAAGG + Intergenic
987099752 5:14581706-14581728 AATCAGAGGCCGGGCAGGGGAGG - Intergenic
987366873 5:17156656-17156678 CATCAGAGTGAGATCAGGGAGGG - Intronic
988543818 5:32137709-32137731 ATCCAGAGGGAGAGATGGGAGGG + Intronic
988623748 5:32849354-32849376 AAGAAGTGGGAGAGGAGGGAGGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990210475 5:53478577-53478599 AAAGAGAGGGAGAAAAGGGAGGG + Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991619726 5:68533170-68533192 AAGCAGAGAGAAAGCGGGGAGGG + Intergenic
991702632 5:69330624-69330646 ACTCAGAGGGAGACCTGGAATGG - Intronic
992286259 5:75238422-75238444 AAACAGTGGGTGAGCAGGAAAGG - Intergenic
992401364 5:76414726-76414748 AATCAGTGCCAAAGCAGGGAAGG - Intronic
993026921 5:82657667-82657689 AAGAAGAGAGAGAGGAGGGAAGG - Intergenic
994790857 5:104224125-104224147 AATCAGATGGAGGGGAGGAACGG - Intergenic
994877756 5:105447204-105447226 AAGCAGGGGGGGAACAGGGATGG - Intergenic
995815003 5:116158156-116158178 AGACGGAGGGAGAGGAGGGAGGG - Intronic
996706344 5:126502215-126502237 AATTCGAGGCAGAGCAGGGTGGG - Intergenic
996752183 5:126900067-126900089 AATCAGAGAGTTAGCAAGGAGGG - Intronic
997511230 5:134455956-134455978 GCTCTGAGGGAGAGCAGTGAGGG - Intergenic
997585771 5:135042228-135042250 AATCAGAGAGAGAGGAGGTTTGG + Intronic
997766917 5:136513977-136513999 AAAGAGAGGGAGAGCAGGTTGGG - Intergenic
998040035 5:138945966-138945988 AAGCAAAGGGACTGCAGGGAAGG + Intergenic
998205919 5:140156874-140156896 GCTCTGAGGGAGAACAGGGAAGG + Intergenic
998225393 5:140322811-140322833 AAGCAGAGGGAGAAGAGGGGTGG - Intergenic
998660690 5:144233860-144233882 AAGGAGAGGGAGAAGAGGGAGGG + Intronic
998664710 5:144283366-144283388 AATCAGTGGGAGAGAAAGTATGG + Intronic
998673312 5:144378145-144378167 AAAAAGAGGGAGAGCACAGAAGG - Intronic
999338030 5:150740891-150740913 ACTCAGGGGGAAAGCTGGGAAGG + Intronic
999758664 5:154683525-154683547 AACTAGAGGGCGAGCAGGTAGGG - Intergenic
1000064574 5:157683575-157683597 AATGAGAGGAAGAGGAGGGGAGG - Intergenic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000507968 5:162145509-162145531 AGTGAGAGGCAGAGTAGGGATGG - Intronic
1000576060 5:162976381-162976403 CATCAGATGGAGAGAAGGTAAGG - Intergenic
1001142674 5:169158021-169158043 AAGAAGAGGGAGAGAAAGGATGG + Intronic
1001209268 5:169795074-169795096 AAACACAGAGACAGCAGGGAGGG - Intronic
1001368381 5:171168929-171168951 AAAAAGAGGGAGAGGAGGAAGGG - Intronic
1001454156 5:171848109-171848131 AAGGAGAGGGAGTTCAGGGAGGG - Intergenic
1001916987 5:175570001-175570023 AATCAGCAGGAGAGCAGGCTGGG - Intergenic
1002031353 5:176433028-176433050 AGGGAGAGGGAGAGGAGGGAGGG - Intergenic
1002077681 5:176718574-176718596 AAACAGAGGAGGAGCAGAGACGG - Intergenic
1002322592 5:178384563-178384585 AATCAGCGCAGGAGCAGGGAGGG - Intronic
1002542714 5:179916833-179916855 ATCCAGAGGGAGGGGAGGGAAGG - Intronic
1002765570 6:235866-235888 AGAGAGAGGGAGAGGAGGGAAGG + Intergenic
1003024464 6:2541947-2541969 AACCAGAGGGAGATGGGGGAAGG + Intergenic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003844437 6:10158136-10158158 AGGCAGAGGAAGAGCAGTGAGGG + Intronic
1003869079 6:10387639-10387661 AGCCAGGGGGAGAGCTGGGAGGG - Intergenic
1004129003 6:12901403-12901425 AAGCAGAGAGAAAGGAGGGAAGG + Intronic
1004140762 6:13014801-13014823 AATCTGAAGTAGAGCAGTGAAGG + Intronic
1004457966 6:15809107-15809129 AATGACAGGGGGATCAGGGATGG - Intergenic
1004785767 6:18965628-18965650 AATCAGGAGGATAGCAGGGGAGG + Intergenic
1004813067 6:19281074-19281096 AATCAAAGGGAGAGTGAGGAAGG + Intergenic
1004856312 6:19754110-19754132 AATGAGAGGTGCAGCAGGGACGG + Intergenic
1005483835 6:26280475-26280497 AATCAGAACCAAAGCAGGGAGGG + Intergenic
1006421212 6:33935363-33935385 AATGAGAGGGAGAGCCAGGCAGG - Intergenic
1006928487 6:37672880-37672902 AGGCAGAGAGGGAGCAGGGAGGG + Intronic
1007161130 6:39792535-39792557 AAGCAGAGGGAGAGAAGTGTGGG - Intronic
1007419162 6:41708925-41708947 CCTCAGAAGGAGAGCTGGGATGG + Intronic
1007699754 6:43759662-43759684 ACCCAGAGGAAGAGCAGGGGTGG + Intergenic
1007837643 6:44686513-44686535 ACTCAGTGGGAAAGGAGGGAAGG - Intergenic
1007981723 6:46166219-46166241 AAAGAGAGAGAGAGGAGGGAGGG - Intronic
1008320648 6:50108753-50108775 AAACATGAGGAGAGCAGGGAAGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009307585 6:62109805-62109827 AAAAAGAGGGAGAGAAGGAAAGG + Intronic
1010739570 6:79484064-79484086 GAACAGTGGGAGGGCAGGGATGG + Intergenic
1010823176 6:80440397-80440419 AATCACAGGAAGAGAATGGATGG + Intergenic
1011488025 6:87863174-87863196 AATCAGAGGGTGGGCAGAGACGG - Intergenic
1011936544 6:92785620-92785642 AAGGAGGGGGAGAGAAGGGAAGG + Intergenic
1012202312 6:96422089-96422111 TATCAGAGGCTGAGAAGGGAAGG - Intergenic
1012267878 6:97168804-97168826 ACTCAGAGGGAAAGCAGAAAGGG - Intronic
1012530482 6:100229411-100229433 AATCATGGGGAAAGCAGGGTTGG + Intergenic
1012840004 6:104318117-104318139 AATCTGGAGGAGAGGAGGGAAGG - Intergenic
1013290799 6:108717320-108717342 AAAGAGAAGGAGAGCAGGGGCGG + Intergenic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1013995807 6:116306557-116306579 AACCAGTGGAAGAGCTGGGAGGG - Intronic
1014042758 6:116849138-116849160 AAGGAGAGAGAGAGCAAGGAGGG - Intergenic
1014188653 6:118466023-118466045 ACACAGAGGGAGAGCGGGGAGGG + Intronic
1014214164 6:118736840-118736862 CATCAGAGGCAGAGAAGGGAAGG + Intergenic
1014627880 6:123751904-123751926 ATTCATAGTGAGACCAGGGAGGG + Intergenic
1014681586 6:124437494-124437516 AATCAGAAGGTGAGAAAGGAAGG - Intronic
1015546653 6:134368434-134368456 CATGAGAGCGAGAGCAGGCAAGG + Intergenic
1015675250 6:135738894-135738916 AATAAGACGGAGAGAAGAGAGGG + Intergenic
1018301592 6:162408927-162408949 AGGCAGAGGGAAAGCTGGGAGGG - Intronic
1019026273 6:168966156-168966178 ATTCAGTGGAAGAGAAGGGAAGG - Intergenic
1019032302 6:169024124-169024146 AAGCAGAGGGGCAGCGGGGAGGG + Intergenic
1019105550 6:169664350-169664372 CACCAGAGGTGGAGCAGGGAGGG + Intronic
1019135638 6:169905974-169905996 GAGCAGAAGGAGAGAAGGGAAGG + Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1020036064 7:4963741-4963763 CTTGAGACGGAGAGCAGGGACGG - Intergenic
1020499700 7:8901980-8902002 AATTAGTGGGAGAGCTAGGAGGG - Intergenic
1020891599 7:13885044-13885066 AATCAAGGTGTGAGCAGGGACGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022515969 7:30975155-30975177 AATCAGTGGCAGAGCAAGGCTGG - Intronic
1022519887 7:30999301-30999323 ACCCTGTGGGAGAGCAGGGAAGG - Intergenic
1022684546 7:32584072-32584094 AATCACAGCCATAGCAGGGATGG + Exonic
1023004200 7:35845348-35845370 AAGAAAAGGGAAAGCAGGGATGG + Intronic
1023079032 7:36510676-36510698 AATCAGTGACAGAGCAGGGAGGG + Intergenic
1023163882 7:37324108-37324130 CATCAGAGGCGGGGCAGGGAGGG - Intronic
1023203243 7:37721036-37721058 GCTCCGAAGGAGAGCAGGGATGG + Intronic
1023870388 7:44260259-44260281 AACCAGAGCCAGAGGAGGGAGGG - Intronic
1023912635 7:44566570-44566592 AATCAGCGGGAGGGCAGGGATGG - Intronic
1024812519 7:53229614-53229636 AATTATAGGGAGATCAGGGCAGG - Intergenic
1025652029 7:63478760-63478782 AAGAAAAGGGAAAGCAGGGATGG + Intergenic
1025875142 7:65474557-65474579 AAAGAGAGGGAAATCAGGGATGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026441188 7:70445920-70445942 AAGCACAGGAAGAGCAGGGCTGG + Intronic
1026967446 7:74449250-74449272 AAGAAGAGGGAGGGGAGGGAGGG - Intergenic
1027341547 7:77213614-77213636 AATGGGAGGGAGGGCAGTGAGGG - Intronic
1027516893 7:79153491-79153513 AGTCACAGAGAGAGCAGGAAAGG + Intronic
1028260862 7:88662873-88662895 AATCAGTGGGACAGAAGAGAAGG - Intergenic
1028569353 7:92269193-92269215 AATCAGTGGGATAGCATTGAGGG + Intronic
1029412822 7:100426798-100426820 AAGGAGAGGGGGAGGAGGGAGGG - Intronic
1029452178 7:100647350-100647372 CATGGGAGGGGGAGCAGGGAGGG - Intronic
1029514596 7:101017580-101017602 AATCTGAGGGAGAGCAGATTCGG + Exonic
1029693032 7:102195384-102195406 AATCAGATCGAGAGCTGGGTGGG + Intronic
1030872995 7:114780751-114780773 AATCAGAGAAGGAGCAGGGCAGG - Intergenic
1031007326 7:116488469-116488491 AACCAAAGGGAGGGGAGGGAGGG - Intronic
1031274697 7:119705159-119705181 AATTTGAGGGAGGGCAGGGTGGG + Intergenic
1031673933 7:124586470-124586492 AATTAGAGTGGTAGCAGGGATGG - Intergenic
1032159252 7:129498200-129498222 GATCTGAGGAAGAGCAGGGTGGG + Intergenic
1032490164 7:132318463-132318485 AAGGAGAGGGAAAGCAGGGAGGG - Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033905482 7:146196539-146196561 AGTCAGAGGGAAAGGAGGGAGGG + Intronic
1034319401 7:150165758-150165780 AGGTAGAGGGAGAGCAGGAATGG - Intergenic
1034397518 7:150838497-150838519 AATCAAATGGAGAGCAAGGCTGG + Intronic
1034442545 7:151093785-151093807 AGTTAGTGGCAGAGCAGGGACGG - Intronic
1034517802 7:151594206-151594228 GATCAGAGGAAGAGCAGGGCAGG - Intronic
1034571598 7:151960577-151960599 AATCAGAGGAAGAGCCTAGATGG + Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035602225 8:903325-903347 CATCAGTTCGAGAGCAGGGAGGG + Intergenic
1035692953 8:1571892-1571914 AATGAGATGGAGAGGAGAGAGGG + Intronic
1035731392 8:1856035-1856057 AAGCAGGGGGAGAGCTGGAATGG - Intronic
1036017404 8:4800572-4800594 CGTCAGAGGCAGAGCAGGGAAGG + Intronic
1036422167 8:8607370-8607392 TATCAGAGGTAGTGGAGGGAGGG - Intergenic
1036732889 8:11281856-11281878 AATAACAGTGAGAGCAGGAACGG - Intergenic
1037907868 8:22726045-22726067 ACTCAGAGTGAGAGCAGAGCTGG + Intronic
1038259358 8:25979534-25979556 AATAAAAGAGAGAGCAGGGCTGG + Intronic
1038488923 8:27955598-27955620 AAACAGAGACAGACCAGGGAGGG + Intronic
1038512067 8:28147353-28147375 AAGGAGAGGGAGTGCAGAGATGG + Intronic
1038578604 8:28727270-28727292 GCTCAGAGGGTGAGCAGAGATGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039175388 8:34798543-34798565 AATAAGAGGGAAAGGAAGGAAGG - Intergenic
1039569442 8:38575395-38575417 AATGAGAGGCAGAGCCAGGAGGG - Intergenic
1039892302 8:41693936-41693958 AACCCGAGGGACAGCGGGGAGGG - Exonic
1040001379 8:42579368-42579390 AAACAGAGCAAGAGCTGGGAAGG - Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041856544 8:62462266-62462288 AATTGGAGGGAGAGCAGGAGAGG + Intronic
1042665114 8:71195790-71195812 AGACAGAGGGAGAGAAGAGAAGG + Intergenic
1043009279 8:74861709-74861731 AGACAGAGGAAGAACAGGGAGGG + Intergenic
1043367790 8:79555629-79555651 AATAAAAGAGAGAGAAGGGAGGG - Intergenic
1043533113 8:81171976-81171998 GAGCAGAGAGAGACCAGGGACGG + Intergenic
1044262431 8:90142142-90142164 AAGGAGAGAGAGAGAAGGGAAGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046210025 8:111059935-111059957 AACCTGAAGGAGAGCAAGGAAGG + Intergenic
1046527860 8:115404367-115404389 AATCAGAGAGAGAGAGGGGCAGG - Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047021697 8:120782024-120782046 AATCACAGTGTGAGCAGGGTTGG + Intronic
1047096177 8:121628428-121628450 AAAGAGGGGGAGAGAAGGGAAGG + Intronic
1047404395 8:124573203-124573225 GATGAGAGGGAGAGGAGAGAGGG - Intronic
1047415654 8:124662769-124662791 AACCCGTGGGAGGGCAGGGAGGG - Intronic
1047648563 8:126895339-126895361 AATGAGAGGGGGACCAGGGCAGG + Intergenic
1048025904 8:130586385-130586407 GATCAGAGGGAGAGGAGAAAGGG + Intergenic
1048070253 8:131013324-131013346 GGGCAGAAGGAGAGCAGGGAGGG + Intronic
1048180977 8:132193884-132193906 AGCCAGAGGGAGAGCAGGGAAGG + Intronic
1048294005 8:133200931-133200953 GATGAGAGGGAGGGCAGAGAGGG - Intronic
1048332476 8:133480083-133480105 AAGAAGAGAGGGAGCAGGGAAGG + Intronic
1048601737 8:135925620-135925642 AATGAGCGGCAGAGCAGAGAAGG - Intergenic
1048852224 8:138656186-138656208 AAACAGAAGGAGAGTAGGGATGG - Intronic
1049370282 8:142261095-142261117 GAAGAGAGGGGGAGCAGGGAAGG + Intronic
1049370287 8:142261114-142261136 AAGGAGAGAGAGAGGAGGGAGGG + Intronic
1049690231 8:143955084-143955106 AGTCCCAGGGAGGGCAGGGACGG - Intronic
1049869817 8:144965848-144965870 AAGCAGTGGGTGAGCAGGGCTGG + Intergenic
1050406936 9:5319282-5319304 GAACTGAGGGTGAGCAGGGAAGG + Intergenic
1050413845 9:5394241-5394263 GAACTGAGGGTGAGCAGGGAAGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051560774 9:18438193-18438215 AATCATAGGAAGAGAAAGGAGGG + Intergenic
1051589693 9:18764612-18764634 GATCAAAGGCAGAGCAGAGAAGG + Intronic
1051748529 9:20318179-20318201 AGTCAGAGAGGGAGCAGGTATGG - Intergenic
1051818746 9:21139937-21139959 ATTCAAAGGTAGAGCAGAGAAGG - Intergenic
1052426553 9:28312343-28312365 AATGAGAGGGAGAGAAGAGGGGG + Intronic
1053131227 9:35616934-35616956 TATCAGACGGAGAGAGGGGAAGG + Intronic
1053359840 9:37477045-37477067 AATCAGAGTGGGTGGAGGGAGGG + Intergenic
1054790929 9:69255973-69255995 AAAGAGAGAGAGAGAAGGGAGGG - Intergenic
1054854358 9:69882263-69882285 AATCAGTGGCAGATCAGGCATGG - Intronic
1055189903 9:73505551-73505573 AATAAGAGGGAGAGAAGAAAGGG + Intergenic
1055752684 9:79524675-79524697 AATGGGAGGGCTAGCAGGGAGGG - Intergenic
1056585479 9:87924880-87924902 AAGAAGAGGGAGCGCAGGGCTGG + Intergenic
1056611401 9:88128063-88128085 AAGAAGAGGGAGCGCAGGGCTGG - Intergenic
1056664638 9:88571913-88571935 CATCAGAGGGCACGCAGGGAGGG + Intronic
1057131636 9:92658029-92658051 CATCAGATGGGGAGCAGAGAAGG + Intronic
1057278028 9:93686605-93686627 GTCCAGAGTGAGAGCAGGGAAGG + Intergenic
1057706839 9:97400579-97400601 ACTAAGAGTGAGGGCAGGGAGGG + Intergenic
1057849690 9:98555855-98555877 GAACTGAGGGAGAGCAGGGAAGG - Intronic
1058022486 9:100103648-100103670 AAGCAGGGGGAGAGGAGGGGAGG + Intronic
1058024440 9:100125551-100125573 AATGACAGGCAGAGAAGGGAAGG - Intronic
1058734841 9:107884667-107884689 AATATGAAGGAGAGCTGGGACGG - Intergenic
1058961106 9:109993729-109993751 AAACAGAGGGAGAGAAGAAAGGG - Intronic
1059136571 9:111812698-111812720 AGTCAGAGGTAGAGCAACGATGG + Intergenic
1059578584 9:115519159-115519181 AAGGAGAGGAAGAGAAGGGAAGG - Intergenic
1060759259 9:126234449-126234471 AACCAGAGAGAGAGGAGGCAGGG + Intergenic
1060874843 9:127075305-127075327 AGTCAGAGGGAGAGAAGAGGAGG + Intronic
1061230894 9:129315344-129315366 AACCAGAGAGAGAGGAGGGATGG - Intergenic
1061291722 9:129654154-129654176 AATAGGAGGCAGGGCAGGGAAGG - Intergenic
1061412930 9:130430916-130430938 ACTCAGAGGGAAAGCAGTCAGGG + Intronic
1062027240 9:134346256-134346278 AAGCCGCGGGAGGGCAGGGAGGG - Intronic
1062519360 9:136951229-136951251 AAACAGAGGGCTGGCAGGGAGGG - Intronic
1203524689 Un_GL000213v1:76021-76043 TATCAGAGGCTGAGCAGGGTGGG + Intergenic
1185645212 X:1610841-1610863 AGACAGAGGGAGAGGAGGGGAGG - Intergenic
1185701461 X:2233984-2234006 AATGAGAGGCATAGCAGGGAAGG + Intronic
1185877261 X:3711741-3711763 AGGCAGAGAGAGAGGAGGGAGGG + Intronic
1186400836 X:9258001-9258023 GCTCAGAGGGAGAGAAGGAATGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188634880 X:32417313-32417335 GCCCAGAGGGAGAGTAGGGATGG + Intronic
1188880975 X:35491764-35491786 AAAGAGAGGGAGAGGAGGGAAGG - Intergenic
1189301493 X:39955765-39955787 AAGCAGAGCAAGAGAAGGGAAGG - Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190212848 X:48461332-48461354 AGACAGAGGGACAGCATGGATGG - Intronic
1190279958 X:48923002-48923024 AATGAGAGAGAGTGCAGGGGTGG + Exonic
1190760228 X:53432468-53432490 AACCTGAGGGAGGGCAGGGCAGG + Intronic
1190762846 X:53450950-53450972 GAATATAGGGAGAGCAGGGAGGG + Intergenic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1192216713 X:69164509-69164531 ACGCAGAGGCCGAGCAGGGAGGG + Intronic
1192584530 X:72308739-72308761 TATCAGAGGGAGACTAGGCAGGG - Intergenic
1192678433 X:73225284-73225306 AGTTAGATGGAGAACAGGGATGG + Intergenic
1192848976 X:74933587-74933609 AATGAGGGGGAGAGATGGGAAGG + Intergenic
1193722526 X:85003866-85003888 TTTCAGACGGAGAGCAGAGAGGG - Exonic
1195269355 X:103215222-103215244 AAGCGGAGGGGGAGCAGGTAAGG + Exonic
1195278956 X:103310854-103310876 AAGCGGAGGGGGAGCAGGTAAGG - Exonic
1196020059 X:110982008-110982030 AAATAGAGGGAGAGCTGGGTGGG + Intronic
1196210160 X:112986923-112986945 ACTTAGAGGGAAACCAGGGAGGG - Intergenic
1197590304 X:128401603-128401625 AATAAGAGGAAAAGCAAGGAAGG - Intergenic
1197756983 X:130002479-130002501 AGACAGAGGGAGACCGGGGAGGG + Intronic
1197846026 X:130804083-130804105 TACCAGAGGGTGGGCAGGGAAGG - Intronic
1198100074 X:133415463-133415485 AATCAGCGGCAGAGCTGAGAAGG - Exonic
1198301558 X:135338848-135338870 ATTAGGAGGGAGAGTAGGGAAGG - Intronic
1198709692 X:139487887-139487909 AACAAGAGAGAGAGCAGGAAGGG + Intergenic
1198751048 X:139936597-139936619 TACCTGAGGGAGAGAAGGGAAGG + Intronic
1199427191 X:147716554-147716576 AATGAGGGGAAGAGCAAGGAGGG + Intergenic
1199555308 X:149101757-149101779 AATCAGAGAGAGAGCGTGGGAGG - Intergenic
1199993758 X:153005887-153005909 AGAGAGAGAGAGAGCAGGGAAGG + Intergenic
1200686468 Y:6264039-6264061 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1200688008 Y:6274209-6274231 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1200884310 Y:8253084-8253106 TCTCAGAGGGAGAGCTGGGAAGG + Intergenic
1200954411 Y:8929859-8929881 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1200992011 Y:9355286-9355308 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1200994666 Y:9375566-9375588 TCTCAGTGGGAGAGCTGGGAAGG - Intronic
1200997329 Y:9395912-9395934 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1200999843 Y:9464449-9464471 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1201002502 Y:9484758-9484780 TCTCAGTGGGAGAGCTGGGAAGG - Intronic
1201005161 Y:9505045-9505067 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1201007820 Y:9525372-9525394 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1201010436 Y:9545562-9545584 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1201047259 Y:9900493-9900515 TCTCAGTGGGAGAGCTGGGAAGG + Intergenic
1201060206 Y:10037746-10037768 TCTCAGTGGGAGAGCTGGGAAGG + Intergenic
1201597086 Y:15682220-15682242 AAAGAGAGAGAGAGGAGGGAAGG - Intergenic
1201894870 Y:18982535-18982557 ATGCAGTAGGAGAGCAGGGATGG - Intergenic
1201949495 Y:19548497-19548519 AAAGAGAGAGAGAGGAGGGAGGG - Intergenic
1202111485 Y:21426628-21426650 TCTCAGTGGGAGAGCTGGGAAGG + Intergenic
1202116959 Y:21477509-21477531 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1202232537 Y:22671248-22671270 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic
1202310619 Y:23524910-23524932 TCTCAGTGGGAGAGCTGGGAAGG + Intergenic
1202560183 Y:26145684-26145706 TCTCAGTGGGAGAGCTGGGAAGG - Intergenic