ID: 1084963904

View in Genome Browser
Species Human (GRCh38)
Location 11:72733430-72733452
Sequence AGTCAGGGGCATGAGACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 199}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084963900_1084963904 2 Left 1084963900 11:72733405-72733427 CCTGAGGGCACAAGTAGGGTAAC 0: 1
1: 0
2: 1
3: 6
4: 96
Right 1084963904 11:72733430-72733452 AGTCAGGGGCATGAGACCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 199
1084963897_1084963904 13 Left 1084963897 11:72733394-72733416 CCATGAAGTGGCCTGAGGGCACA 0: 1
1: 0
2: 1
3: 9
4: 186
Right 1084963904 11:72733430-72733452 AGTCAGGGGCATGAGACCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 199
1084963894_1084963904 21 Left 1084963894 11:72733386-72733408 CCTGGGGACCATGAAGTGGCCTG 0: 1
1: 0
2: 2
3: 20
4: 176
Right 1084963904 11:72733430-72733452 AGTCAGGGGCATGAGACCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 199
1084963892_1084963904 29 Left 1084963892 11:72733378-72733400 CCACTAAGCCTGGGGACCATGAA 0: 1
1: 0
2: 0
3: 16
4: 139
Right 1084963904 11:72733430-72733452 AGTCAGGGGCATGAGACCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084963904 Original CRISPR AGTCAGGGGCATGAGACCCC AGG Intronic
900287138 1:1907188-1907210 AGTCAAGGGGCTGAGACCCTGGG - Intergenic
900601001 1:3502591-3502613 CGGCAGGTGAATGAGACCCCAGG + Intronic
900711327 1:4116459-4116481 ACTCAGGGGCTGGAGACCCCTGG + Intergenic
901130742 1:6961548-6961570 AGCCGGGGGCGTGAGAGCCCAGG + Intronic
902693048 1:18122290-18122312 AGGCTGAGGCATGAGAACCCTGG - Intronic
904485149 1:30819859-30819881 CGTGTGGGGCAGGAGACCCCTGG + Intergenic
904911322 1:33936513-33936535 AGTCAGGCTGATGAGAACCCGGG - Intronic
905632343 1:39525607-39525629 AGGCAGGGGCATGAGGCCAGTGG - Intronic
905665404 1:39760588-39760610 AGGCAGGGGCATGAGCCCAGTGG + Intronic
906939689 1:50245201-50245223 AGGCAGGGGCACGTGAACCCAGG + Intergenic
907269315 1:53281331-53281353 AATCAGGGGCCTGAAGCCCCAGG + Intronic
911749397 1:101479401-101479423 AGACAGAGGCATGACACCCTAGG - Intergenic
912713865 1:111968273-111968295 AGGCAGGGGCACGAGTCCTCAGG + Intronic
913163357 1:116165118-116165140 AGTGAGGGGCCTGAGGCCCAGGG - Intergenic
914751536 1:150538147-150538169 AGTCAGAGGCAGGAGAGCCCGGG - Intergenic
915263089 1:154693666-154693688 AGTCAGGAGTATGAGAGGCCAGG - Intergenic
917437227 1:175033756-175033778 AGTCAGGCCCATGTGCCCCCTGG - Intergenic
917500796 1:175583260-175583282 AGCCAGGGGAAGGAGAGCCCAGG + Intronic
919741143 1:200982402-200982424 TGTCAGGGGCTCGGGACCCCAGG + Intronic
920929260 1:210371454-210371476 TGTCAGGGGCAAGAAACCCATGG - Intronic
921207011 1:212858040-212858062 CCTCAGGTGCAGGAGACCCCGGG + Intergenic
922527623 1:226318021-226318043 AATCAAGGAGATGAGACCCCAGG - Intergenic
922902587 1:229148254-229148276 AGTCTGGGGCAGGACACTCCTGG - Intergenic
923165261 1:231355551-231355573 AGTGAGGAACATGAGATCCCTGG - Intergenic
924013357 1:239691945-239691967 ATCCTGGGGCAAGAGACCCCAGG + Intronic
924606663 1:245541248-245541270 AGGCAGGGGCAGGAGACCGAGGG + Intronic
1065994198 10:31041226-31041248 ACTCAGAGGCATGAGACTTCAGG + Intergenic
1067289391 10:44930147-44930169 AGCAAGGGGCAGGGGACCCCAGG - Intronic
1069195867 10:65550679-65550701 GGACAGGGGCATGAGCCCCCTGG + Intergenic
1069383222 10:67861475-67861497 AGGCTGAGGCATGAGAACCCAGG + Intergenic
1074526707 10:114269205-114269227 TTTCAGGGACATGAGAGCCCAGG - Intronic
1075098432 10:119489186-119489208 AGGCTGAGGCATGAGAACCCAGG + Intergenic
1076507572 10:130987969-130987991 AGGCAGGGGCTAGAGAACCCAGG - Intergenic
1076854779 10:133110717-133110739 AGACATGGGCATCAGACCACTGG - Intronic
1077186156 11:1236318-1236340 AGGGAGGGGCCTGAGACCCAGGG - Intronic
1077311303 11:1890128-1890150 ATTCAGGGCCATGGGGCCCCAGG - Exonic
1077321963 11:1946757-1946779 AGAGAGGGGCTTCAGACCCCAGG + Intergenic
1077581490 11:3420134-3420156 AGGCAGGGTCATGAGTCCCAGGG + Intergenic
1081639077 11:44740456-44740478 AGCCAGGGGCATGGGGCACCTGG + Intronic
1081779033 11:45697082-45697104 GGACAGGGGCATGAGAGCTCAGG - Intergenic
1084238404 11:67802963-67802985 AGGCAGGGTCATGAGTCCCAGGG + Intergenic
1084610422 11:70198942-70198964 AGTGAGGGGCATGAGATGACAGG - Intergenic
1084834004 11:71789862-71789884 AGGCAGGGTCATGAGTCCCAGGG - Intronic
1084843327 11:71877023-71877045 AGTGAGGGGCATGAAAGCTCTGG - Intronic
1084963904 11:72733430-72733452 AGTCAGGGGCATGAGACCCCAGG + Intronic
1085513727 11:77100513-77100535 ATTTAGGGGCACAAGACCCCTGG - Intronic
1086851528 11:91815070-91815092 CTTCAGGGGCCTGAGAGCCCCGG - Intergenic
1090636796 11:128694596-128694618 AGTCAAGGGCGAGAGACCTCGGG + Intronic
1091078264 11:132641368-132641390 AGGCAGGTGCAAGAGATCCCAGG + Intronic
1202804979 11_KI270721v1_random:2070-2092 AGAGAGGGGCTTCAGACCCCAGG + Intergenic
1091624198 12:2110124-2110146 AGTCAGTGGCATGTGCCTCCTGG - Intronic
1092150806 12:6247051-6247073 AGTCTTGGCCATCAGACCCCTGG + Intergenic
1095996982 12:48095716-48095738 AGGCAGGGGCAGAAGACCCTTGG + Intronic
1101555548 12:105805626-105805648 AGTCAGGCCAATGAGACCTCAGG + Intergenic
1101891721 12:108722411-108722433 CTGCAGTGGCATGAGACCCCTGG + Intronic
1104402796 12:128490497-128490519 AGTGAGGGGCAGGAGACTGCTGG + Intronic
1105279089 13:18952869-18952891 TGTCAGGGGCCTGAGAGCCTTGG + Intergenic
1105840226 13:24247857-24247879 AGCCAGTGACAAGAGACCCCGGG - Intronic
1107113312 13:36721039-36721061 AGTCAGGGGAGTGATACTCCTGG - Intergenic
1110049998 13:70884926-70884948 GGTCAGGGGAATGAGACCATAGG + Intergenic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1113776194 13:112946915-112946937 AGTCACGGGCCTGAGGACCCAGG + Intronic
1117095332 14:52291549-52291571 AGTCAGGTGCATGTGACCTGTGG + Intergenic
1124081419 15:26501621-26501643 GGTCAGAGTCATGAGGCCCCTGG - Intergenic
1125893220 15:43281335-43281357 AGTCAGGGGGATGGGCCCCTGGG - Intronic
1126657097 15:50990469-50990491 AGTCTGAGGCATGAGAACCTGGG - Intronic
1129221599 15:74134638-74134660 GGTCAGGGGCCTGAGGCCGCAGG - Exonic
1129678972 15:77647244-77647266 TGTCAGGGGCAGGACAGCCCAGG - Intronic
1131120937 15:89823076-89823098 AGTCAGGGGAATGGGGCACCAGG + Intergenic
1131612330 15:93978122-93978144 AGTCAGGGGCAGGAGTTCACTGG + Intergenic
1132404234 15:101532783-101532805 AGTCAGGTGCAGAGGACCCCCGG - Intergenic
1132584252 16:699433-699455 AGTCCAGGGCGTGTGACCCCAGG - Intronic
1133350059 16:5095413-5095435 AGGCAGGGTCATGAGTCCCAGGG + Intronic
1134473561 16:14550325-14550347 ACTCAGGAGCATCAGACACCAGG - Intronic
1134664709 16:16010506-16010528 ACTCAAGGCCATTAGACCCCAGG - Intronic
1135125111 16:19803041-19803063 TCTCAGGGGAATAAGACCCCAGG - Intronic
1135532018 16:23262996-23263018 AGGCTGAGGCATGAGAACCCAGG + Intergenic
1135532167 16:23264149-23264171 GGTGTGGGGCATGAGAGCCCAGG + Intergenic
1135922746 16:26665830-26665852 AGTCCTGGTTATGAGACCCCAGG - Intergenic
1137982771 16:53083960-53083982 AGCCAGGAGTTTGAGACCCCAGG - Intronic
1138011825 16:53388435-53388457 AGTTGGGAGAATGAGACCCCAGG - Intergenic
1138679251 16:58673171-58673193 AGGCTGAGGCATGAGAACCCAGG - Intronic
1140024919 16:71278532-71278554 AATCAGGGGGATGTGAGCCCTGG + Intergenic
1141610792 16:85180097-85180119 AGTCAGGGCAACCAGACCCCAGG - Intronic
1141628761 16:85275665-85275687 AGTCAGGGTGAGGGGACCCCAGG + Intergenic
1142621379 17:1167549-1167571 GGCCTGGGGCATGAGACCTCAGG - Intronic
1142980136 17:3666833-3666855 AGTTTGGGGCATGAGGACCCAGG - Intronic
1143315154 17:6026769-6026791 AGTCAAGGGCATGACACCCGTGG - Intronic
1146367413 17:32239672-32239694 AGTCTGAGGCCTGTGACCCCTGG - Intronic
1146512813 17:33465014-33465036 TGTCTGGGGCATAAGACACCAGG + Intronic
1147250923 17:39151972-39151994 AGTCAGGGGCCCGTGACCCAGGG - Intronic
1151313068 17:73305978-73306000 AGTCGGGGGCAGGAAACCCTCGG + Intronic
1151428194 17:74044889-74044911 AGTCTGGTCCATGAGACCCAAGG + Intergenic
1151563489 17:74883767-74883789 AGGCTGGGGCAGGAGAACCCAGG - Intronic
1151833130 17:76567474-76567496 TGTCAGCAGCATGAGAGCCCCGG + Exonic
1153948258 18:10035655-10035677 AGCAAGGGGCATGAGTCACCTGG + Intergenic
1154344060 18:13527841-13527863 GGTCTGGGGCTGGAGACCCCGGG + Intronic
1160019977 18:75172862-75172884 GGACAGGGAGATGAGACCCCAGG + Intergenic
1160870123 19:1274179-1274201 AGTCAGGGGGCTGTGACCTCAGG - Intronic
1161378211 19:3950808-3950830 AGAGAGGGGCGGGAGACCCCAGG + Intergenic
1162934235 19:13973154-13973176 AGTCAGGGGGATGAGAACTGGGG + Intronic
1163128858 19:15259451-15259473 AGCCAGGGCCATGAGCACCCAGG - Intronic
1163205354 19:15798488-15798510 ATTAAGGGGCAGGAGATCCCAGG + Intergenic
1164982808 19:32626919-32626941 AGTCCTGGGCATGAAACCCACGG + Intronic
1166870686 19:45868687-45868709 ACGCAGTGCCATGAGACCCCAGG + Intronic
1168425995 19:56239454-56239476 AGTCAGGGGGCTGAGAACCAGGG + Intronic
925455124 2:4009513-4009535 AGTAAAGGGTATGAGACCCTTGG + Intergenic
928317958 2:30260380-30260402 AGGCAGGGCCATGAGAACCAGGG - Intronic
930882954 2:56292685-56292707 ACACTGGGACATGAGACCCCTGG + Intronic
932409386 2:71536236-71536258 TGTCATGGGCATGAGACCAGAGG - Intronic
937222676 2:120350848-120350870 AGGCAAGGGGATGAGACCGCAGG + Exonic
937329847 2:121019594-121019616 AGGCTGGGGAGTGAGACCCCTGG + Intergenic
937768948 2:125696290-125696312 AGCCAAGGGCATGACAACCCAGG + Intergenic
940036918 2:149320797-149320819 AGTCACGGGCCTGGGACCCTGGG + Intergenic
948223816 2:236293453-236293475 AGTCTGGGGCAGCAGCCCCCAGG + Intergenic
1168927610 20:1595667-1595689 AGGAAGGGTCATGGGACCCCTGG - Intronic
1168935506 20:1661879-1661901 AGGAAGGGTCATGGGACCCCTGG - Intergenic
1172012296 20:31852597-31852619 GGTCAGGAGTTTGAGACCCCTGG + Intronic
1172215566 20:33233338-33233360 AGAAGAGGGCATGAGACCCCAGG + Intergenic
1172479344 20:35261713-35261735 AGTCAGCTTCAGGAGACCCCGGG - Intronic
1175647964 20:60692117-60692139 AGGCAGGGGCAGGAGACACAAGG + Intergenic
1175862109 20:62156132-62156154 AGTCAGTGGCTTGCGCCCCCCGG + Intronic
1176147901 20:63573604-63573626 AGTCAGGAGCCTGAGGCCCTGGG - Intronic
1179951531 21:44711407-44711429 AGGCAGGGGCATGGGAACTCGGG - Intronic
1180987165 22:19911828-19911850 AGACAGGGGCATGCAGCCCCAGG + Intronic
1181050581 22:20236584-20236606 GGTCAGGGTCAAGAGACCCTAGG + Intergenic
1182725965 22:32445824-32445846 ACTCAGGTGAATGAGAGCCCTGG - Exonic
1185218463 22:49616895-49616917 AGTCGGGGGCTGGAGACCACTGG - Intronic
949877440 3:8635396-8635418 AGTCAGGGGCTGGACAGCCCAGG + Intronic
950265115 3:11567917-11567939 AATCTGGGACATGAGCCCCCAGG - Intronic
950548878 3:13654776-13654798 GGTCAGGGGCATCAGGACCCAGG + Intergenic
950658473 3:14452047-14452069 AGTCAGGGGTACGAGGCACCAGG + Intronic
951343246 3:21514716-21514738 ATTCAGGCACATGAGAGCCCTGG + Intronic
953026172 3:39146512-39146534 AGGCAGGGGCATCTGATCCCAGG + Exonic
957054357 3:75432769-75432791 AGGCAGGGTCATGAGTCCCAGGG + Intergenic
961300486 3:125918943-125918965 AGACAGGGTCATGAGTCCCAGGG - Intergenic
961829894 3:129618078-129618100 AGGCAGAGGCAGGAGACCCCAGG + Intergenic
961888022 3:130109134-130109156 AGGCAGGGTCATGAGTCCCAGGG + Intronic
962233664 3:133689229-133689251 AGTCTGAGGCAGGAGAACCCAGG + Intergenic
964661633 3:159126214-159126236 AGTCCTGGGCATGTGACCCCAGG + Intronic
964738238 3:159938693-159938715 AGTGAAGGGCATGAAACCCATGG - Intergenic
968898061 4:3416471-3416493 GGTCATGGGCATTAGGCCCCAGG + Intronic
968977145 4:3827891-3827913 AGTCAGGGGCCTGGGCTCCCTGG - Intergenic
969784424 4:9443092-9443114 AGTGAGGGGCATGAAAGCTCTGG - Intergenic
969816811 4:9693178-9693200 AGGCAGGGTCATGAGTCCCAGGG - Intergenic
969865557 4:10074980-10075002 AGGCAGGAACATGAGCCCCCCGG + Exonic
974771477 4:66420151-66420173 AATCAGGGACATTAGACTCCTGG + Intergenic
975213122 4:71723714-71723736 AGTCATGGGCATTGGAACCCTGG + Intergenic
975878888 4:78878065-78878087 AGTCTGGAGCCTGAGACCACTGG - Intronic
986714192 5:10510939-10510961 AGTCGGGAGTTTGAGACCCCAGG - Intronic
989734321 5:44685307-44685329 AGTTAGGGGCATAAGACTTCAGG - Intergenic
993860638 5:93132681-93132703 AGTCAGGGGCAGGAGACAAATGG - Intergenic
996536799 5:124585813-124585835 AGTCAGGGCCATGGGTCTCCAGG + Intergenic
999198492 5:149799447-149799469 AGGGAAGGGCATGAGAGCCCTGG - Intronic
999777057 5:154820039-154820061 GGTCAGAGGGAGGAGACCCCTGG - Exonic
1001602960 5:172940826-172940848 AGTCTGGGGGATTAGTCCCCAGG - Intronic
1001774375 5:174317538-174317560 CGCCAGGGGCCAGAGACCCCTGG + Intergenic
1002544536 5:179930938-179930960 AGGCTGAGGCATGAGAACCCAGG + Intronic
1004184533 6:13410736-13410758 AGTCAGTGTCATGGGATCCCAGG + Intronic
1004650289 6:17601003-17601025 AGTCGCGGGCCTGGGACCCCGGG + Exonic
1005503511 6:26450489-26450511 AGTAGGGGGCATGAGAAGCCTGG - Intronic
1010505291 6:76649693-76649715 AGTCAAAGACATGAGACTCCTGG + Intergenic
1014029437 6:116683697-116683719 AGGCTGAGGCAGGAGACCCCGGG - Intronic
1016639215 6:146329435-146329457 AGTTAGGATCTTGAGACCCCTGG + Intronic
1017021527 6:150143580-150143602 AGTCAGGGACATGCGCGCCCCGG - Intronic
1017846099 6:158259923-158259945 AGTCAGGGGCATCACCCTCCTGG + Intronic
1019393383 7:802442-802464 AGTCAGTGCCGTGAGGCCCCGGG + Intergenic
1019686593 7:2385245-2385267 ACTCAGGGGCAGGGGACCCTGGG + Intergenic
1022792830 7:33705682-33705704 GGTAAGGGGCAAGAGTCCCCAGG + Intergenic
1023794511 7:43780617-43780639 AGGCAGGGGGAAGAGACCTCAGG + Intronic
1023849407 7:44141732-44141754 GGTCTGTGGCCTGAGACCCCCGG + Intergenic
1024092539 7:45956804-45956826 AAACTGGGGCATGAGACCACTGG - Intergenic
1026637015 7:72092839-72092861 AGGCAGGGGAAAGAGACCCGGGG - Intronic
1028209188 7:88052405-88052427 AGGCAGAGGCAGGAGAACCCGGG + Intronic
1028663878 7:93317446-93317468 AGGCTGAGGCATGAGAACCCAGG + Intronic
1029623685 7:101706491-101706513 GATCAGGGGGATGAGATCCCTGG + Intergenic
1029870442 7:103686061-103686083 CATCAGGGTCATTAGACCCCAGG - Intronic
1030102713 7:105960634-105960656 AGTCAGGGACAGGAGAGCCAAGG + Intronic
1030743202 7:113134421-113134443 AGTCAAAGGCCTGAGAACCCAGG + Intergenic
1033002774 7:137525413-137525435 ATTCTAGGGCATTAGACCCCAGG + Intronic
1033660207 7:143397506-143397528 AGTCAGGGGCTTCTGACCCAGGG + Intronic
1035829220 8:2676424-2676446 AGGCAGAGCTATGAGACCCCTGG - Intergenic
1036752447 8:11451828-11451850 AGGCAGAGGCAGGAGATCCCGGG - Intronic
1036834614 8:12051045-12051067 AGTGAGGGGCATGAAAGCTCTGG + Intergenic
1036856458 8:12297609-12297631 AGTGAGGGGCATGAAAGCTCTGG + Intergenic
1037704761 8:21309735-21309757 AGACAGGGGAATGAGACTCCAGG + Intergenic
1037730572 8:21520216-21520238 AGTCAGTGGCTTGAGAACCTTGG + Intergenic
1037915262 8:22769126-22769148 CATCAGTGACATGAGACCCCTGG + Intronic
1038450436 8:27635889-27635911 AGTCAGGGTGACTAGACCCCAGG + Intronic
1041094891 8:54340231-54340253 AGTCTGAGGCAAGAGAACCCGGG - Intergenic
1041256477 8:55983466-55983488 TGTCAGGGGGAGGAGACACCTGG - Intronic
1042605226 8:70539220-70539242 AGTTTGGTGCATGTGACCCCAGG - Intergenic
1049605615 8:143527957-143527979 AGGCAGGGTTATGAGCCCCCAGG - Intronic
1049861382 8:144901491-144901513 ACTGAGGGGCAGGAGCCCCCAGG - Intronic
1049956149 9:695067-695089 AGCCATGGGCAAGAGAGCCCTGG - Intronic
1052882845 9:33615310-33615332 AGTCAGAGGCATGGGACCAAAGG - Intergenic
1054770882 9:69082668-69082690 AGTGAAGGGCATGAGATTCCAGG + Intronic
1057082072 9:92180607-92180629 GGTCAGGGCCAGGAGACCCTTGG - Intergenic
1060223130 9:121774806-121774828 AGGCAGAGGCATGGGTCCCCAGG + Intronic
1061116724 9:128618115-128618137 AGTCAGAGGCAGGAGCTCCCGGG + Intronic
1061422533 9:130480044-130480066 AGCCAAGGGCCTGAGAGCCCCGG - Intronic
1061679430 9:132235738-132235760 TGTGATGGGCCTGAGACCCCGGG + Intronic
1062010038 9:134261960-134261982 TGTCAGGGTCATGAGACAGCTGG + Intergenic
1062444029 9:136585907-136585929 GGGCAGGGTCATGAGCCCCCAGG + Intergenic
1188175475 X:26983706-26983728 AGGCTGAGGCATGAGAACCCGGG - Intergenic
1190259525 X:48789417-48789439 AGTCAGGGGAAAGAGCCCCAGGG + Intronic
1191004175 X:55692846-55692868 AGGCAGGGGCATCACACACCGGG + Intergenic