ID: 1084965386

View in Genome Browser
Species Human (GRCh38)
Location 11:72741771-72741793
Sequence CCACGTGCCCTGGGGGCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 203}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084965375_1084965386 12 Left 1084965375 11:72741736-72741758 CCCAGTGACACCAGCACTCAAGA 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1084965386 11:72741771-72741793 CCACGTGCCCTGGGGGCCGAGGG 0: 1
1: 0
2: 3
3: 15
4: 203
1084965377_1084965386 2 Left 1084965377 11:72741746-72741768 CCAGCACTCAAGATACAGACCCT 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1084965386 11:72741771-72741793 CCACGTGCCCTGGGGGCCGAGGG 0: 1
1: 0
2: 3
3: 15
4: 203
1084965376_1084965386 11 Left 1084965376 11:72741737-72741759 CCAGTGACACCAGCACTCAAGAT 0: 1
1: 0
2: 0
3: 11
4: 143
Right 1084965386 11:72741771-72741793 CCACGTGCCCTGGGGGCCGAGGG 0: 1
1: 0
2: 3
3: 15
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084965386 Original CRISPR CCACGTGCCCTGGGGGCCGA GGG Intronic
900365460 1:2310349-2310371 CCACGTGCCCTCGGGGTCGACGG - Intergenic
901302517 1:8209957-8209979 CCGCGTGCCCTGGGTGGCGGAGG + Intergenic
903127322 1:21256860-21256882 CCACAGGCCCTGTGGGACGAAGG + Intronic
903350288 1:22712704-22712726 CCACGGGCCCTGGGTGTGGAGGG + Intronic
903773244 1:25777328-25777350 CCAGGAGCCCTGGGGACCAAGGG - Intronic
904882969 1:33714621-33714643 TCACGTGCCTGGGGGGCAGACGG - Exonic
907436367 1:54451695-54451717 CCACATGCCCTGGGGGACAGAGG + Intergenic
915505994 1:156356913-156356935 CCAACTCCCCTGGTGGCCGACGG - Intronic
918449489 1:184644930-184644952 CCACTGGCCCCGGGGGCTGAGGG + Intergenic
920517833 1:206599682-206599704 CCAGGTGCCCTGGGGCCAGCTGG + Intronic
923541785 1:234893474-234893496 CCAGGTGCCCTGGGGACTGACGG + Intergenic
923946576 1:238894688-238894710 CCAGCTGCCCTGATGGCCGAAGG - Intergenic
1067344222 10:45426321-45426343 CCACGTGCCCTGGAGGTGGCCGG - Intronic
1067741401 10:48898361-48898383 CCAGCTGCCCTGGAGGCCCAGGG - Intronic
1073392778 10:103193098-103193120 CCATGGTCCCTGGGGGCCGGGGG + Intronic
1074562337 10:114545408-114545430 CTACGTGCCCAGGGGGCCTGTGG - Intronic
1075657473 10:124171751-124171773 CCATGTGCCCTGGGGGCTGCTGG + Intergenic
1076911981 10:133394888-133394910 CCGCGTGTACTGGGGGCCGAGGG + Intronic
1076948794 10:133667729-133667751 CCACGTGCCCTGCGCGCCTGGGG + Exonic
1076949778 10:133671028-133671050 CCACGTGCCCTGCGCGCCTGGGG + Intronic
1076950762 10:133674327-133674349 CCACGTGCCCTGCGCGCCTGGGG + Intergenic
1076951752 10:133677637-133677659 CCACGTGCCCTGCGCGCCTGGGG + Intergenic
1076952741 10:133680947-133680969 CCACGTGCCCTGCGCGCCTGGGG + Intergenic
1076953725 10:133684246-133684268 CCACGTGCCCTGCGCGCCTGGGG + Intergenic
1076955698 10:133743908-133743930 CCACGTGCCCTGCGCGCCTGGGG + Intergenic
1076956688 10:133747218-133747240 CCACGTGCCCTGCGCGCCTGGGG + Intergenic
1076957675 10:133750527-133750549 CCACGTGCCCTGCGCGCCTGGGG + Intergenic
1076958660 10:133753826-133753848 CCACGTGCCCTGCGCGCCTGGGG + Intergenic
1076959649 10:133757136-133757158 CCACGTGCCCTGCGCGCCTGGGG + Intergenic
1076960633 10:133760435-133760457 CCACGTGCCCTGCGCGCCTGGGG + Intergenic
1077077767 11:709056-709078 ACAAGGGCCCTGGGGGCAGAAGG - Intronic
1077090830 11:777526-777548 TCACGTGCCCTGGCGGCCGGGGG + Intergenic
1082807605 11:57460662-57460684 CCCCGTCCCGTCGGGGCCGATGG + Exonic
1083324530 11:61866619-61866641 CCACGTCCCCTGGGGCCAAATGG - Exonic
1084091078 11:66879735-66879757 CCAGGTCCCTAGGGGGCCGAGGG - Intronic
1084965386 11:72741771-72741793 CCACGTGCCCTGGGGGCCGAGGG + Intronic
1085019471 11:73196408-73196430 CCACTTGACCTGGGAGCCAAGGG + Intergenic
1085197576 11:74681805-74681827 CCCCGTCCCCTGGGGGAAGAGGG + Intergenic
1090435848 11:126685819-126685841 CCACGCCCCTTGGGGGCAGATGG + Intronic
1091609853 12:1996726-1996748 CCACGTGTCCTATGGGCCGTGGG + Intronic
1091994556 12:4982941-4982963 CCCCCTGCCTTGGGGGCCCATGG + Intergenic
1096122061 12:49094674-49094696 CCACGTGCCCCGGGAGCGGGCGG + Exonic
1102778914 12:115546641-115546663 CCATTTTCCCTGGGGGCCCAGGG - Intergenic
1103294779 12:119877052-119877074 CCACCTTCCTTGGGAGCCGAGGG - Intronic
1103951997 12:124556307-124556329 CCTCGTGCCCTGGTGCCCGTTGG - Intronic
1107708154 13:43127299-43127321 CCAGTTGCCCTGTGGGCAGAGGG - Intergenic
1108676098 13:52739219-52739241 CCGGGTGCGCTGGGGGCCGCAGG - Intronic
1111770218 13:92586754-92586776 CCAAGTGCCCTGGGAGCAGAGGG + Intronic
1112302040 13:98239646-98239668 CCAAGTGGCCTGGGGGCAGTGGG + Intronic
1113881773 13:113630961-113630983 CCACCAGCACTGGGGGCGGAAGG - Intronic
1113964041 13:114142441-114142463 TCAAGTGCCCTGAGGGCGGATGG - Intergenic
1119246157 14:73110263-73110285 CCACTTGCCCAGGAGGCAGAGGG - Intronic
1120982470 14:90302533-90302555 CCACCTGCCCTGGGAGCTGGGGG + Intronic
1121527392 14:94628536-94628558 CCGCCTCCCCTGGGGGCTGAGGG + Intergenic
1122102318 14:99422890-99422912 CCAGGCGCCTTGGGGGCCGCGGG - Intronic
1122645308 14:103189691-103189713 CCACCTGCCCTGGGGTCCGACGG - Intergenic
1122649791 14:103220261-103220283 CCACCTGCCCTGGGGTCCGAAGG + Intergenic
1122972592 14:105158463-105158485 CCAGGTGGCCCGGGGGCAGAGGG - Intronic
1123024787 14:105419616-105419638 CCTGGTGCCCTGGGGGTAGAGGG - Intronic
1123130836 14:105984076-105984098 CTAAGTGCCATGGGGGCCCAAGG + Intergenic
1202903547 14_GL000194v1_random:56213-56235 CCAAGTGCCCTCGGGGGCGAGGG + Intergenic
1202858213 14_GL000225v1_random:64342-64364 CCACGTGCCCTGCTGGCCTGGGG - Intergenic
1202860697 14_GL000225v1_random:79460-79482 CCACGTGCCCTGCGCGCCTGGGG - Intergenic
1123581069 15:21715296-21715318 CTAAGTGCCATGGGGGCCTAAGG + Intergenic
1123617718 15:22157919-22157941 CTAAGTGCCATGGGGGCCTAAGG + Intergenic
1124118056 15:26866509-26866531 CCAGGAGCCCTGGGGGCTGCAGG - Exonic
1126614553 15:50563730-50563752 GCATGTGGCCTGTGGGCCGAGGG - Intronic
1128107788 15:65057228-65057250 CAATGTGCCCTTGGGGCCTAGGG + Intronic
1128768818 15:70266889-70266911 CCACGTGCGATGGGGGAGGAAGG - Intergenic
1131072150 15:89472718-89472740 TCACCTGCCCTGGGAGCCTAGGG + Exonic
1132550607 16:552516-552538 CCACGTACCCTGGGGGGCAGGGG - Exonic
1132672434 16:1107329-1107351 CCAGGTGCCCTGGGGTGCGGCGG + Intergenic
1132708926 16:1258045-1258067 GCAGGTGCACTGGGGGCGGAGGG - Exonic
1132954460 16:2584153-2584175 CCATGTGCCCAAGGGACCGAGGG + Intronic
1132959885 16:2616010-2616032 CCATGTGCCCAAGGGACCGAGGG - Intergenic
1134821497 16:17251080-17251102 CCTCCTGCCCTGGGGGCAGTGGG - Intronic
1136396154 16:29993609-29993631 CGGCGTGCCCTGGGGGCTGCAGG - Intronic
1136511289 16:30739518-30739540 CCAAGTCCCCTGGGGCCTGAGGG + Exonic
1139594376 16:67949564-67949586 CCACCTGCTCTGGGGGCCTCAGG + Intronic
1139711125 16:68777221-68777243 CCACGGGCTCTGGGGCCAGACGG + Intronic
1141995917 16:87636223-87636245 CCACGTGCCCTGGGGTGGGGTGG + Intronic
1142125228 16:88406859-88406881 TCAGGAGACCTGGGGGCCGACGG - Intergenic
1144781763 17:17811859-17811881 CCATGTGCCCTGGGAGCAGGGGG + Intronic
1147168201 17:38604486-38604508 CGAGGGACCCTGGGGGCCGAGGG - Intronic
1147309712 17:39588020-39588042 CCACCTTCCCTGGGGGCAGAAGG + Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150651979 17:67016346-67016368 CCATGGGCCCTGGGGGCCAGCGG - Intronic
1151719477 17:75847267-75847289 CCATGTGCCCTGGGCGGGGAAGG - Intronic
1152436345 17:80278588-80278610 CCATGGGCCCTGGAGGCAGACGG + Intronic
1160537850 18:79604459-79604481 CTGCGTGCCCAGGGGGCAGAGGG - Intergenic
1160613674 18:80108463-80108485 CCACGTGCTCTGGGGCACGAGGG + Intergenic
1160778937 19:869243-869265 CCACGTGCCCGGGGAGCCTGAGG + Intronic
1160916234 19:1497936-1497958 CCACGTGTGCGGGGGGCCCAGGG + Intergenic
1161317152 19:3622638-3622660 CCACTCCCTCTGGGGGCCGAGGG - Intronic
1162111734 19:8403354-8403376 GCACGTGCCCTGCCTGCCGAGGG - Intronic
1162125658 19:8498415-8498437 CCACGGGCCCCGGGGGCAGCGGG + Exonic
1162128277 19:8511016-8511038 CCGCGTGCCCTGCGGGCAGGCGG + Exonic
1162304020 19:9860611-9860633 CCAGGTACCCTGGGGGCAGCTGG - Intronic
1164763264 19:30743946-30743968 CCACTGGCCCTGGGGGCAGCCGG - Intergenic
1165887100 19:39085862-39085884 CCACGTGGTCTGGGTGCCAATGG - Intronic
1166824299 19:45599524-45599546 CCTGGTGCCCTGGCGGCCGGCGG + Intronic
1167508001 19:49881277-49881299 CCAGGAGCCCTGGGGGCAGCTGG - Exonic
1167741847 19:51328696-51328718 CCAGGAGCCCTGGGGGCCTCGGG - Exonic
1167752039 19:51387315-51387337 CCACAGGCCCTGGTGGGCGAAGG + Exonic
1168132044 19:54327587-54327609 CCACGTGCTGTGGGAGCCGGTGG - Intergenic
932859815 2:75278435-75278457 CCACGGGCCCTGGGCCCAGAAGG - Intergenic
934503115 2:94874209-94874231 CCAAGTGCCCTCGGGGGCGAGGG - Intronic
934708041 2:96498307-96498329 CCAAGTGCCCTGTGTGCCGCTGG - Exonic
937302400 2:120851400-120851422 CCCCTGGCCCTGGGGGCCCACGG - Intronic
938406474 2:131035744-131035766 CCACGTGCAAGGGGGGCAGAGGG - Intronic
939428524 2:142072500-142072522 ACATGTGCCCTGTGGGCCGGGGG - Intronic
940373315 2:152925593-152925615 CCACATGCCCAGAGGGCCAAGGG - Intergenic
941918162 2:170825492-170825514 CCACGTGCCCTGTTGGCCATAGG + Intronic
942189487 2:173456277-173456299 CCAGGTGCCCTGGAAGCCCATGG + Intergenic
943185931 2:184607588-184607610 CCACGTGTCATGGGGGTGGAAGG - Intronic
943642269 2:190372562-190372584 CTACGCCCCCTGGGGGCCAAAGG + Intergenic
944888001 2:204084927-204084949 CCAAGTGCCCTGGGGCTCCAAGG + Intergenic
945476168 2:210285073-210285095 CCTTGTCCCCTGGGGGCCCAGGG - Intergenic
946298852 2:218809764-218809786 CCACGTGAGCTGGGGCCTGAAGG + Exonic
948362936 2:237435440-237435462 CCACCTGCTCTGGGGCCCCATGG - Intergenic
948462987 2:238139176-238139198 CCACTTCCCCTGGGGGCCTCGGG - Intronic
948783795 2:240340555-240340577 CCACGAGCCCGGGGTGCCGCAGG + Intergenic
948858296 2:240740828-240740850 CCTGGTGCCCTGGGGGCAGCTGG - Intronic
949034482 2:241810283-241810305 TCACGAGCTCTGGCGGCCGAGGG + Intronic
1168853537 20:993077-993099 CCACTTTCCCTGGAGCCCGATGG - Intronic
1172015280 20:31869643-31869665 CCAGCTGCCCTGGGGGTGGAAGG - Intronic
1172044678 20:32071799-32071821 CCAGTTTCCCTGGGGGCTGACGG + Intronic
1172098717 20:32473335-32473357 CCACGTGCTCTGGGGGGCTCTGG - Intronic
1174487241 20:50869244-50869266 CCCAGTGCCCTGGGGGATGAAGG + Intronic
1175330138 20:58158039-58158061 CCAGGGGCCCTGGTGGCAGAGGG - Intronic
1175815603 20:61881727-61881749 CCAGGTCCCCTGGGGGCCACTGG + Intronic
1175895800 20:62335118-62335140 GCCGGTGCCCTGGGGGCCAAGGG + Exonic
1176002830 20:62840625-62840647 CCAGGTGCCATTGGGGCCCAGGG + Exonic
1176135223 20:63519601-63519623 CCACGTGCTCAGGGGGCACAAGG + Intergenic
1176258475 20:64166370-64166392 CCAGGTGCCCAGGGGGTCGGGGG - Intronic
1176622914 21:9070981-9071003 CCAAGTGCCCTCGGGGGCGAGGG + Intergenic
1179973478 21:44849311-44849333 CCACTCGCGCTGGGTGCCGAGGG - Intergenic
1180120356 21:45741901-45741923 CCCAGTGCCCTGGGGGCGGTGGG + Intronic
1183744592 22:39685447-39685469 CCACGTGCCCTGGGGGAGGGCGG + Intronic
951543662 3:23806184-23806206 CCCCGTGCCCTGCGGCCCGGCGG - Intronic
952114860 3:30166607-30166629 CCACGTATCCTGAAGGCCGAAGG - Intergenic
954452393 3:50578834-50578856 ACACCTGCCCTGGGGCCCCATGG + Exonic
956468681 3:69542752-69542774 CCCCGTGCGGCGGGGGCCGAGGG - Intergenic
957084842 3:75669509-75669531 CCACGTGCCCTGCGCGCCTGGGG + Intergenic
961063921 3:123857957-123857979 CCACTTGCACTTGGGGCCTATGG + Intronic
961594573 3:128006531-128006553 CCAAGTGCCCAGGGGGCGGGGGG - Intergenic
961780539 3:129317810-129317832 CCTGGTGCTCTGGGGGGCGAAGG - Intergenic
962837151 3:139199545-139199567 CCAAGTCCCCTGGGGGAGGAGGG - Intronic
962891832 3:139678786-139678808 CCATGAGCCCTGGGGGCTTATGG - Intergenic
963843637 3:150132902-150132924 CCATGTGGCCTGTGGGCCGCAGG - Intergenic
968480977 4:832903-832925 CAAGGACCCCTGGGGGCCGAAGG + Intergenic
968504730 4:966589-966611 CCACGGGCCCTGGGGGCTCCGGG - Intronic
968771927 4:2512909-2512931 CCACATGCCCTTGGGGCAGTTGG + Intronic
969096171 4:4734543-4734565 TGACGTGCACTGGGGGCCCACGG + Intergenic
971347390 4:25823757-25823779 CCAGGAGCCCAGGGAGCCGAAGG + Intronic
972328742 4:38043466-38043488 CCAGCTACTCTGGGGGCCGAGGG + Intronic
985446125 4:190022065-190022087 CCACGTGCCCTGCGCGCCTGGGG - Intergenic
985452248 4:190068513-190068535 CCACGTGCCCTGCGCGCCTGGGG + Intergenic
985453232 4:190071810-190071832 CCACGTGCCCTGCGCGCCTGGGG + Exonic
985454222 4:190075103-190075125 CCACGTGCCCTGCGCGCCTGGGG + Exonic
985455210 4:190078396-190078418 CCACGTGCCCTGCGCGCCTGGGG + Exonic
985456198 4:190081696-190081718 CCACGTGCCCTGCGCGCCTGGGG + Exonic
985457182 4:190084990-190085012 CCACGTGCCCTGCGCGCCTGGGG + Intergenic
985458169 4:190088283-190088305 CCACGTGCCCTGCGCGCCTGGGG + Exonic
985459158 4:190091583-190091605 CCACGTGCCCTGCGCGCCTGGGG + Exonic
985463411 4:190174352-190174374 CCACGTGCCCTGCGCGCCTGGGG + Exonic
985721279 5:1490494-1490516 CCACGAGCCGGGAGGGCCGAGGG + Intronic
986981594 5:13454115-13454137 CCAGGTGACCTTGGGGCCTAAGG + Intergenic
1002047380 5:176549620-176549642 CCTCCTTCCCTGGGGGCTGATGG + Intronic
1006286934 6:33103970-33103992 CCATGGGCCCCGGGGGCTGAAGG - Intergenic
1006297301 6:33175582-33175604 CCATGAGCCCTGGGGGCCCAGGG + Exonic
1006841106 6:37028285-37028307 ACACGTGGCCTGGGCGCAGATGG - Exonic
1007344219 6:41216278-41216300 ACAGGTGCCCTGGGGGACCATGG - Intergenic
1011802312 6:91031163-91031185 CCAACTCCCCTGGGAGCCGAAGG - Intergenic
1016833621 6:148455944-148455966 CCAGCTGCCCTGGGGGCAGCAGG - Intronic
1018687565 6:166315855-166315877 CCCACTGCCCTGGGGGACGAAGG + Intergenic
1018750514 6:166800279-166800301 CCCCGTGCTCTAGGGGCTGAGGG - Intronic
1018802772 6:167236367-167236389 CCCGCTGCCCTGGGGGCCGCCGG - Intergenic
1019283478 7:211825-211847 CCACGTGCCCTGTGGGAAGACGG - Intronic
1019500436 7:1361910-1361932 CCAGGGGCCCTGGGGGCTGCAGG - Intergenic
1019503163 7:1375676-1375698 CCACCTCCCCTTGGGGCCCAGGG - Intergenic
1025256010 7:57384311-57384333 TCACGGCTCCTGGGGGCCGAGGG + Intergenic
1025777114 7:64569469-64569491 CCAGGGGCCCTGGGGGCCTCGGG + Intergenic
1026014856 7:66664942-66664964 CCACCTGCCGTGGGGGCCACGGG - Intronic
1034965656 7:155389093-155389115 CCACGTCCTCTGGGGTCAGATGG + Intronic
1036690491 8:10941698-10941720 CTACGTGGCCTGGGGGCTCATGG + Intronic
1037829228 8:22178166-22178188 CCAGGTGCCCTGGGTGCACACGG - Intronic
1040746095 8:50644058-50644080 ACAGGTGCCCTGGATGCCGAGGG + Intronic
1043966921 8:86489026-86489048 CCATGTGGCCTAGGGGCCGCAGG + Intronic
1045510247 8:102807590-102807612 CCACCTGTCCCGGGGGCGGAAGG - Intergenic
1047292328 8:123541292-123541314 CCACGTGGCCTCCGGGCCGGGGG - Intergenic
1048493204 8:134913563-134913585 GCAGGTGCTCTGGGGGCTGATGG + Intergenic
1049612706 8:143562811-143562833 CCACGTGTGCTGGGAGCCGCAGG + Exonic
1054810384 9:69429475-69429497 CCAGGTGCCCTGGGGGGAAAGGG - Exonic
1055993269 9:82130786-82130808 GCAGGTGCCCTGGGGGCCCTGGG + Intergenic
1056361567 9:85862739-85862761 CCAGCTGCCCTGAGGGCTGAGGG - Intergenic
1057322933 9:94030907-94030929 CGACGCGCCCTGGAGGCAGAGGG - Intronic
1057576102 9:96244090-96244112 CCCCGTGCCCTGGGTGCTGGAGG - Intronic
1060812001 9:126615281-126615303 GCCCGAGCCCTCGGGGCCGAGGG + Intronic
1061193647 9:129095962-129095984 CCAGGTGCCCCGGGGGCTGGAGG - Intronic
1061224910 9:129275812-129275834 GAATGTGCCCTGGGGGCAGATGG - Intergenic
1061422998 9:130482256-130482278 CCACATGCCCGGGGGACTGATGG - Intronic
1061815541 9:133192395-133192417 TCACGTGACCTGGAGGCCCAGGG + Intergenic
1061880874 9:133568254-133568276 CCACCTGCCCCGGGAGCGGATGG - Exonic
1062034269 9:134375877-134375899 CCACGTGCCCTGCGACTCGATGG + Intronic
1062110587 9:134780090-134780112 CCACCCGCACAGGGGGCCGATGG + Exonic
1062133029 9:134910377-134910399 CCACGTCCCCTGGTGGCCCTTGG + Intronic
1062236792 9:135514117-135514139 CCACCTGCCCTGAAGGCCGCGGG + Intergenic
1062385021 9:136305846-136305868 CCACCTGCCCTGGGGGACAGCGG + Intronic
1062478517 9:136741159-136741181 CCACGTGCTCTCGGGGACAAGGG + Intronic
1062501434 9:136853676-136853698 CCACGAGCCTTGGGGGTCCAGGG - Intronic
1203746101 Un_GL000218v1:41408-41430 CCAAGTGCCCTCGGGGGCGAGGG + Intergenic
1203364911 Un_KI270442v1:248510-248532 CCACGTGCCCTGGCGACCTGTGG - Intergenic
1203564006 Un_KI270744v1:78073-78095 CCAAGTGTCCTCGGGGGCGAGGG - Intergenic
1190218041 X:48493187-48493209 CCACGGGCCCCTGGGGCCCAGGG + Intergenic
1190233453 X:48599368-48599390 CCTCGGGCCCTGGGGGCCCGTGG + Exonic
1190290649 X:48989934-48989956 CCAAGGGTACTGGGGGCCGAGGG - Intronic
1198533663 X:137567207-137567229 CCACGTGCCCTGTGGGCGACGGG - Exonic
1199991462 X:152989842-152989864 CCACGTGGCCTGGGTGCCAGTGG + Exonic
1200000789 X:153058847-153058869 CCATGTGGCCTGGGGGCCAGTGG - Intronic
1200234982 X:154463836-154463858 CCGCGTCCCCTGGGGCCCGAGGG - Intronic
1201073809 Y:10171887-10171909 CCACGTGCCCTGGTGACCTGTGG + Intergenic