ID: 1084968466

View in Genome Browser
Species Human (GRCh38)
Location 11:72756560-72756582
Sequence CACCCACAGCACCCCTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 292}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084968461_1084968466 3 Left 1084968461 11:72756534-72756556 CCTGAGTGTCAGGGATCAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 206
Right 1084968466 11:72756560-72756582 CACCCACAGCACCCCTGGAGGGG 0: 1
1: 0
2: 0
3: 21
4: 292
1084968459_1084968466 5 Left 1084968459 11:72756532-72756554 CCCCTGAGTGTCAGGGATCAGGA 0: 1
1: 0
2: 0
3: 15
4: 209
Right 1084968466 11:72756560-72756582 CACCCACAGCACCCCTGGAGGGG 0: 1
1: 0
2: 0
3: 21
4: 292
1084968460_1084968466 4 Left 1084968460 11:72756533-72756555 CCCTGAGTGTCAGGGATCAGGAG 0: 1
1: 0
2: 0
3: 17
4: 183
Right 1084968466 11:72756560-72756582 CACCCACAGCACCCCTGGAGGGG 0: 1
1: 0
2: 0
3: 21
4: 292
1084968455_1084968466 14 Left 1084968455 11:72756523-72756545 CCAGTGACTCCCCTGAGTGTCAG 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1084968466 11:72756560-72756582 CACCCACAGCACCCCTGGAGGGG 0: 1
1: 0
2: 0
3: 21
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084968466 Original CRISPR CACCCACAGCACCCCTGGAG GGG Intronic
900488525 1:2934969-2934991 CACTCCCAGCACCCCCGGTGTGG - Intergenic
900639729 1:3682879-3682901 CACTCACAGCAGCCCTGGAATGG + Intronic
900644338 1:3702267-3702289 CCTCCACAGCCCTCCTGGAGGGG + Intronic
900991965 1:6102144-6102166 GAGCCCAAGCACCCCTGGAGAGG - Exonic
901051615 1:6428431-6428453 CACCCAGAGGACCCCTTAAGAGG - Intronic
902482707 1:16719930-16719952 CACCCAGAGGACCCCTTAAGAGG + Intergenic
903603206 1:24556663-24556685 CATCCACAGCACGTTTGGAGGGG + Intronic
903968814 1:27106074-27106096 CAGGCCCAGCACCCCTGCAGGGG + Exonic
907407924 1:54265152-54265174 CACCCACAGCCCCCAAGGAAAGG + Intronic
915960580 1:160263090-160263112 CACCTACAGTAACCCTGCAGAGG + Intergenic
918494712 1:185121874-185121896 CAACCCCAGCACCCATGCAGTGG + Intronic
919536069 1:198789282-198789304 CACCCCCAGCAGGCCTGGAGGGG - Intergenic
920319700 1:205109936-205109958 CACCCACAGCACCTCTGCTTGGG + Intronic
920504197 1:206505282-206505304 CACCCACTGCACTCCAGGAAGGG + Intergenic
920556071 1:206905520-206905542 CACCCTCAGCACCTCTGTAAGGG + Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1062919304 10:1267159-1267181 CACCCACACCTACCCGGGAGGGG - Intronic
1063377160 10:5561304-5561326 GAGCCACAGGACCTCTGGAGGGG + Intergenic
1066198557 10:33125166-33125188 CCCCCACAGCCACCCTGCAGAGG - Intergenic
1067524874 10:47032196-47032218 CAGCCACAGCACCTCTTCAGAGG - Intergenic
1069868513 10:71518968-71518990 CACCCACAGCACCACGAAAGAGG + Intronic
1070671108 10:78377726-78377748 AACCCACTGCACCCCTCCAGAGG - Intergenic
1072225980 10:93369245-93369267 CACACACACCAACCCAGGAGAGG - Intronic
1072550091 10:96470550-96470572 CACCCCCAGCACCTCTCTAGGGG + Intronic
1074541768 10:114371086-114371108 CACCTACGGGACCCATGGAGAGG + Intronic
1074939772 10:118223306-118223328 CACCCCCATCCCCACTGGAGTGG + Intergenic
1075417477 10:122275649-122275671 CACCCAGGGCACCAATGGAGAGG - Intronic
1076863027 10:133150916-133150938 CACCCACTGCCCTCCGGGAGAGG - Intergenic
1077517869 11:3012824-3012846 CACCCACAGTAACACTGGGGAGG + Intronic
1077606794 11:3617672-3617694 CACTCAGGGCTCCCCTGGAGTGG - Intergenic
1079345943 11:19652362-19652384 CATCCTCAGCACCTCTGCAGAGG - Intronic
1080770458 11:35336158-35336180 CACCCACCCCACCCCCTGAGAGG - Intronic
1080807066 11:35663105-35663127 CACCCACATGGCCTCTGGAGTGG + Exonic
1081685115 11:45036902-45036924 CACCCACAGCCCAGCTGGAGGGG + Intergenic
1084673536 11:70621496-70621518 CCCCTACAGCACCCTTGGCGAGG + Intronic
1084673929 11:70623480-70623502 CCCCCACAGCACCCTTGATGAGG + Intronic
1084968466 11:72756560-72756582 CACCCACAGCACCCCTGGAGGGG + Intronic
1085519034 11:77127416-77127438 CACCCAGAGCTGCCCTGGCGAGG + Intergenic
1087592117 11:100203203-100203225 CACCCACAGAACATCTGAAGAGG - Intronic
1090522540 11:127494885-127494907 GAACCACTGCACCCCTGAAGTGG + Intergenic
1090838571 11:130471188-130471210 CACCTGCAGCACCCCAGAAGGGG - Exonic
1093971130 12:25377096-25377118 CAACCACACCAAGCCTGGAGGGG - Intergenic
1095990265 12:48029645-48029667 CCCCCACAGCCCCTCTGGGGTGG + Intergenic
1096240976 12:49960260-49960282 CACCCCCAGGATCCCGGGAGAGG - Intergenic
1096470120 12:51870292-51870314 CACCCACAGCTTCCCTGCAAAGG + Intergenic
1097038277 12:56138393-56138415 CACCTGCAGCACCTGTGGAGGGG - Exonic
1097246223 12:57609235-57609257 CCCCCACACCACACCTGTAGGGG + Exonic
1101589918 12:106116379-106116401 CACCCCCAACCCCTCTGGAGTGG - Intronic
1106663115 13:31823518-31823540 AAACCACAGCAATCCTGGAGAGG + Intergenic
1107786379 13:43962034-43962056 CACACAAAGCACCTGTGGAGTGG + Intergenic
1108747326 13:53408984-53409006 CACGCACCCCACCCCGGGAGGGG - Intergenic
1109522923 13:63535314-63535336 CACCCACACCACTACTGCAGAGG + Intergenic
1110339415 13:74371462-74371484 AACCAACACCACCACTGGAGTGG + Intergenic
1113355803 13:109578848-109578870 CACCCACTGGACCCCCGCAGTGG + Intergenic
1113567904 13:111329798-111329820 AAGCCACAGCCCACCTGGAGCGG + Intronic
1113587503 13:111475402-111475424 CCCCGACAGCATCCCTGGTGTGG - Intergenic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1113942267 13:114024539-114024561 TACTCACGGCGCCCCTGGAGGGG + Intronic
1115912929 14:38276567-38276589 CACCACCAGCACCCCTGAAAAGG - Intergenic
1117512682 14:56469896-56469918 CAACCTCAGCACCCCTGGCAGGG - Intergenic
1117736421 14:58773286-58773308 AACCCACAGGCCACCTGGAGGGG + Intergenic
1118734463 14:68691600-68691622 AGCCCACAGCACCCCAGGAGGGG - Intronic
1118811917 14:69281450-69281472 TCCCCAAAGCACCCCTGGATTGG + Intronic
1118909560 14:70049924-70049946 CCCACTCAGCAGCCCTGGAGGGG + Intronic
1119410039 14:74424880-74424902 CATCCTCCTCACCCCTGGAGTGG - Intronic
1121051189 14:90819943-90819965 CTGCCACAGCAACCCTAGAGAGG + Intergenic
1121324639 14:93012877-93012899 CAATCACAGCACCCCTTCAGGGG + Intronic
1121408053 14:93730988-93731010 GACCCACAGTCCACCTGGAGAGG + Intronic
1121562832 14:94887353-94887375 CACCCACAGCAGTCCAGGATTGG + Intergenic
1121959881 14:98249504-98249526 GACCCACATCATGCCTGGAGAGG + Intergenic
1122827422 14:104377012-104377034 TCCCCACAGCAGCCCAGGAGAGG - Intergenic
1122997074 14:105270943-105270965 CACCCAGGACACCCCTCGAGGGG + Intronic
1123629399 15:22250836-22250858 GACCCACAGCCGCTCTGGAGGGG + Intergenic
1123717088 15:23040751-23040773 CACCCCCAGCACCTCTGGCCAGG - Intergenic
1123717168 15:23041013-23041035 CACCCCCAGCACCTCTGGCCAGG - Intergenic
1123717246 15:23041275-23041297 CACCCCCAGCACCTCTGGCCGGG - Intergenic
1123717369 15:23041721-23041743 CCCCCACAGCACCTCTGGCCAGG - Intergenic
1123717428 15:23041910-23041932 CACCCCCAGCACCTCTGGCCAGG - Intergenic
1123717526 15:23042236-23042258 CACCCCCAGCACCTCTGGCCAGG - Intergenic
1123717622 15:23042534-23042556 CACCCCCAGCACCTCTGGCCAGG - Intergenic
1123717809 15:23043164-23043186 CACCCCCAGCACCTCTGGCCAGG - Intergenic
1123717930 15:23043610-23043632 CCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718042 15:23043980-23044002 CACCCCCAGCACCTCTGGCCAGG - Intergenic
1123718112 15:23044206-23044228 CACCCCCAGCACCTCTGGCCAGG - Intergenic
1123718190 15:23044468-23044490 CACCCCCAGCACCTCTGGCCGGG - Intergenic
1123718249 15:23044686-23044708 CACCCCCAGCACCTCTGGCCAGG - Intergenic
1123718493 15:23045532-23045554 CACCCCCAGCACCTCTGGCCAGG - Intergenic
1123718568 15:23045796-23045818 CACCCCCAGCACCTCTGGCCTGG - Intergenic
1123718611 15:23045979-23046001 CCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718676 15:23046195-23046217 CACCCCCAGCACCTCTGGCCAGG - Intergenic
1123718861 15:23046827-23046849 CACCCCCAGCACCTCTGGCCAGG - Intergenic
1123718999 15:23047307-23047329 CACCCCCAGCACCTCTGGCCGGG - Intergenic
1123719290 15:23048312-23048334 CACCCCCAGCACCTCTGGCCGGG - Intergenic
1123719455 15:23048875-23048897 CACCCCCAGCACCTCTGGCCAGG - Intergenic
1123719560 15:23049247-23049269 CACCCCCAGCACCTCTGGCCAGG - Intergenic
1123719667 15:23049612-23049634 CACCCCCAGCACCTCTGGCCAGG - Intergenic
1124223401 15:27869255-27869277 CACCCTCAGCACCCCCACAGCGG + Intronic
1125504278 15:40257967-40257989 CATCCACAGCCCCTCTGTAGGGG - Intronic
1127611244 15:60639684-60639706 CAGCTACAGCACCTCAGGAGGGG + Intronic
1128249130 15:66152533-66152555 TACCCACAGGACCCCTGGCAAGG - Intronic
1128792547 15:70443706-70443728 CTCCCCCAGCACCTCCGGAGGGG + Intergenic
1132316957 15:100897416-100897438 TGCCCACTGTACCCCTGGAGGGG - Intronic
1132345665 15:101107261-101107283 CTCCCGCAGCGCCTCTGGAGGGG - Intergenic
1132502892 16:292490-292512 TAGCCACAGCCTCCCTGGAGTGG + Intronic
1132750335 16:1454690-1454712 CACCCTCAGCACCCGGGGCGGGG + Intronic
1132881369 16:2163104-2163126 CACTCCCAGCACCCACGGAGGGG + Intronic
1134435565 16:14253319-14253341 CACCTTTAGCACCCATGGAGCGG - Intronic
1135149336 16:19991906-19991928 CACTCACAGCTGCCCAGGAGAGG - Intergenic
1136034105 16:27525677-27525699 GACCCACAGCACCCCCAGGGCGG - Intronic
1136398093 16:30003983-30004005 CCCCCACACCACCCCAGCAGCGG + Intronic
1137488969 16:48914793-48914815 CACCCAAAGGATCCCTGGAGAGG - Intergenic
1137759065 16:50925940-50925962 CACTCTCAGCACCCATGAAGCGG + Intergenic
1138563391 16:57815574-57815596 CACCCCCAGCCTCCCTGGTGAGG - Intronic
1139591311 16:67934796-67934818 CACCCACAGAGCCCGTGAAGAGG - Exonic
1139601499 16:67990194-67990216 CACCCTCTGGATCCCTGGAGAGG + Intronic
1139606443 16:68022399-68022421 CTTCCACAGAGCCCCTGGAGTGG + Exonic
1140032298 16:71348474-71348496 CACCCACAGCAGCCGGGGAATGG + Intergenic
1140438589 16:74969026-74969048 CACCCTCAGCACACCAGGTGGGG + Intronic
1141396470 16:83709453-83709475 CACACACGGCACCCCTAGAGTGG - Intronic
1141788267 16:86216148-86216170 CACTCACAGCATCCCTGGTGGGG + Intergenic
1141974158 16:87503600-87503622 GACCCACAGCTGCTCTGGAGGGG - Intergenic
1141983730 16:87566020-87566042 AATCCACAGCTCACCTGGAGTGG - Intergenic
1142222997 16:88864550-88864572 CACGGCCAGCACCCCTGCAGAGG + Intronic
1142223009 16:88864580-88864602 CACGGCCAGCACCCCTGCAGAGG + Intronic
1142223021 16:88864610-88864632 CACGGCCAGCACCCCTGCAGAGG + Intronic
1143239965 17:5435477-5435499 CACCGAGAGCAGCCCTGGAACGG + Intronic
1144092973 17:11874312-11874334 CACACACAGGAGCCCTGAAGGGG + Intronic
1145237805 17:21221420-21221442 CTCCCCCAGCACCCCTGTGGTGG + Intergenic
1145259266 17:21345084-21345106 TACCCACAGGACCAATGGAGAGG - Intergenic
1146034020 17:29390599-29390621 CACCAACACCACCCCTGGTAAGG - Exonic
1146459848 17:33037434-33037456 CAGCCACAGCAGGGCTGGAGGGG - Intronic
1146465720 17:33084603-33084625 CTCCCACAACAACCCTGCAGGGG - Intronic
1147178570 17:38671568-38671590 CTCCCACAACACAGCTGGAGGGG + Intergenic
1147686428 17:42289058-42289080 GGCCCACAGGCCCCCTGGAGAGG - Intronic
1148320620 17:46748684-46748706 AACACACAGGACTCCTGGAGGGG + Intronic
1149367898 17:55964188-55964210 CATCCATAGCACCCCTAGTGAGG + Intergenic
1151834585 17:76574444-76574466 CCCCCACAGCAGCACTGGAATGG + Exonic
1151966432 17:77433979-77434001 CACACACAGCGTCCCTGCAGAGG - Intronic
1152633305 17:81420335-81420357 CCCACACAGCACCCCTGGGCCGG + Intronic
1153576068 18:6523163-6523185 CACCCACAGACCACCTGGTGGGG + Intronic
1157426059 18:47585148-47585170 CACCCACAGCACCCTGGGTCTGG + Intergenic
1157683184 18:49622817-49622839 CAGCCACAGCACCCCTGCTCTGG + Intergenic
1160302705 18:77700193-77700215 CACCCACAGCTCCCCTGCGCTGG - Intergenic
1160411995 18:78681503-78681525 CATCCATAGCACCCCAGGCGAGG + Intergenic
1160710728 19:549838-549860 ACCCCACTGCACCCCTGGAGGGG - Exonic
1161313477 19:3607324-3607346 CTCCCACCCCACCCCTGGAAGGG - Intergenic
1161399147 19:4059846-4059868 CAGCCAGAGCACCCCCGGCGGGG + Intronic
1163115566 19:15187063-15187085 CAGAAACAGCACACCTGGAGGGG - Intronic
1163602693 19:18258325-18258347 CACCCACAGGCCCTCTGCAGAGG - Intronic
1163692533 19:18745396-18745418 CACCTACGTCATCCCTGGAGGGG - Intronic
1166111868 19:40627573-40627595 CACCCGCCACAGCCCTGGAGCGG + Intronic
1166769381 19:45271768-45271790 CCCCCACACCTCCCCTGCAGAGG + Intronic
1167113847 19:47477271-47477293 CACCTTCACCACCCCTAGAGGGG + Intronic
1167621309 19:50562544-50562566 CAGCCACAGCTCCACTGCAGAGG - Intronic
1167935533 19:52903916-52903938 CACCCACAGCATGCCTGCATTGG - Intergenic
1167935548 19:52904029-52904051 CACCCACAGCATGCCTGTATTGG - Intergenic
925003615 2:425542-425564 CACCCACAGCTACGATGGAGTGG + Intergenic
925030640 2:648014-648036 CACCCTCAGGGCCCCTGGCGTGG - Intergenic
926089582 2:10041791-10041813 CACCCGCAGTCCACCTGGAGAGG - Intergenic
926203033 2:10814819-10814841 CAAACACAGCAGGCCTGGAGAGG - Intronic
927694578 2:25231193-25231215 CTCCCCCAGCCCTCCTGGAGTGG + Exonic
928034473 2:27808929-27808951 CACCCACTTCACCCCAGGAATGG + Intronic
928318203 2:30262385-30262407 GCCCCACAGCACCTATGGAGGGG - Intronic
929431448 2:41890793-41890815 CACCCACAGCCTCCAGGGAGGGG + Intergenic
931235673 2:60410703-60410725 CAGCCACAGGACCCCAGGAGGGG + Intergenic
931776818 2:65548041-65548063 CTCCCACAACAGGCCTGGAGAGG + Intergenic
932429243 2:71664113-71664135 CACCCACAGCACTGCTGTACTGG - Intronic
932903269 2:75724195-75724217 CCCCCACCCCACCCCTGGACAGG - Intergenic
934523235 2:95032968-95032990 CAGCCACAGCACCTCCGCAGCGG + Intronic
934561539 2:95316043-95316065 CCCCCACAGCAGCCCAGCAGTGG + Intronic
936118527 2:109721883-109721905 CACCCAGAGCCCACCTAGAGAGG - Intergenic
936444018 2:112581913-112581935 GACCCCCAGCAACCCTGGAGTGG - Intergenic
936886658 2:117318755-117318777 CACCACCACCACCCCTGCAGGGG + Intergenic
938082265 2:128376514-128376536 CACCCTCAACAGTCCTGGAGGGG + Intergenic
938170235 2:129069543-129069565 CACTCACGGCACACCTGGAGGGG + Intergenic
939097634 2:137852635-137852657 CAGCCACAGCTCCTGTGGAGTGG - Intergenic
942536688 2:176972446-176972468 CACCCACACCACCCATTGAGGGG + Intergenic
945047790 2:205797371-205797393 CAGCATCAGGACCCCTGGAGTGG - Exonic
946268463 2:218568879-218568901 CCCCTTCAGCACCCCTGCAGCGG - Exonic
947751183 2:232533430-232533452 CTCCCACATCACCCATGGTGCGG - Intronic
948074867 2:235158224-235158246 AACCCACTGCATCCCTGTAGGGG + Intergenic
1170439497 20:16364492-16364514 AGCCTACAGCACCCCTAGAGTGG - Intronic
1170440806 20:16377188-16377210 CACCCACAGCACCTCCTAAGGGG - Intronic
1171088811 20:22264852-22264874 CAACCTCAGCACCTGTGGAGGGG - Intergenic
1171453349 20:25251742-25251764 GACCTGCAGCACCCCTGCAGTGG + Intronic
1173181883 20:40812266-40812288 AGGCCACAGCATCCCTGGAGGGG + Intergenic
1173691911 20:44967036-44967058 CCCCCACCGCACCCCTCAAGTGG - Intronic
1173776139 20:45708107-45708129 CACACACAGCATCCCTGGACTGG - Exonic
1174140255 20:48408156-48408178 CACCCAAAGCACCTCTTTAGGGG + Intergenic
1174307103 20:49621049-49621071 CACGCACAGCACCTGTGAAGGGG + Intergenic
1174615526 20:51832551-51832573 AACCCACAGCTCCCATGGGGTGG + Intergenic
1175701372 20:61140032-61140054 CAACCACAGCAGCTCTGGAGGGG - Intergenic
1175985668 20:62763148-62763170 CAACCACAGGACCCCTGGGCTGG - Intergenic
1178697503 21:34807317-34807339 TTCCAACAGCACCCCTTGAGCGG + Intronic
1178917125 21:36711546-36711568 CACCCCCTCCACCCCTAGAGAGG - Intronic
1179047639 21:37860701-37860723 CTCCCACTACCCCCCTGGAGTGG + Intronic
1179397298 21:41053008-41053030 TCCCCACTGCACCCCTGGATGGG + Intergenic
1179488408 21:41725703-41725725 CAGCCTCAGCACCCCTGCAGCGG + Intergenic
1179807878 21:43851540-43851562 CTCCAACAGCCCCCCTGGATGGG - Intergenic
1179840949 21:44072928-44072950 AAACCACAGCAGGCCTGGAGCGG - Intronic
1180594259 22:16963209-16963231 CACCAAGGGCACCCCTGGAAAGG - Intronic
1180980959 22:19877752-19877774 GACACACAGCAGCCCTGGGGTGG + Intronic
1181286847 22:21758669-21758691 CAACCACAGGACCAGTGGAGGGG - Exonic
1182127095 22:27824024-27824046 CTCCCACACCACCTCTTGAGAGG - Intergenic
1183236743 22:36624441-36624463 CACCCACAGCACCCAGGCTGAGG + Intronic
1183293185 22:37015221-37015243 CACCTACAGCAGCCCTGCAAGGG - Intronic
1183401401 22:37607171-37607193 CAGGCACAGGACCGCTGGAGAGG + Intergenic
1183540133 22:38425008-38425030 CACCCACAGGACCCTAAGAGAGG + Intergenic
1184093567 22:42304803-42304825 CACCAAGAGCGCCCCTGAAGTGG - Intronic
1184340361 22:43882419-43882441 GCACCACAGCACCCTTGGAGGGG + Intronic
1184534643 22:45078083-45078105 CAGCCACCGCACTCCTGGACTGG + Intergenic
1185148500 22:49151726-49151748 CACCCACAGGGCCCCTGCTGAGG + Intergenic
1185319989 22:50196224-50196246 GACCCACTCCACCTCTGGAGGGG - Intronic
950687767 3:14630896-14630918 CACCCACAGGATCCCTGCTGGGG - Intergenic
952944827 3:38472338-38472360 CACAGACAGCACCCCTCGAAAGG - Intronic
953569245 3:44058187-44058209 GACCCACAATGCCCCTGGAGAGG - Intergenic
954289562 3:49642518-49642540 CACCCTCCCCACCTCTGGAGGGG - Exonic
954616483 3:51971353-51971375 CACCGCCCCCACCCCTGGAGTGG + Intronic
954716940 3:52531652-52531674 CACCCACACCACCTATGGAAGGG - Intronic
954810567 3:53244743-53244765 CACACACAGCACCACGGGATGGG - Intronic
960575378 3:119223774-119223796 CACCCGCAGCGCCCCTGTCGGGG - Intronic
962922712 3:139965420-139965442 CTCCCACATTACCCCTGGAGAGG - Intronic
964892236 3:161551229-161551251 CTCCCACTGCACCCCTGTTGTGG + Intergenic
968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG + Intergenic
968575667 4:1364901-1364923 CACCCACCGCAAACCTGGTGTGG - Intronic
968585729 4:1415058-1415080 CACCCGCAGGACCCCGTGAGTGG + Intergenic
968727691 4:2255892-2255914 CACCCCCAGCTCCCCGGCAGCGG - Intronic
968814588 4:2815301-2815323 CACCCACAGCCCCTCTCCAGAGG - Intronic
969471066 4:7389637-7389659 CACCCTGTGCACCCCAGGAGGGG - Intronic
970372852 4:15425523-15425545 AACCCAGGGCACCCATGGAGAGG + Intronic
972630156 4:40835596-40835618 CCCGCACAGCACCCCTGCAGCGG - Intronic
978557241 4:109993882-109993904 CACCATCAGCACCCCAGAAGGGG + Intronic
979503508 4:121467333-121467355 CCCCCACCACACCCCTGGACAGG + Intergenic
981311102 4:143298966-143298988 ACCTCACAGCACACCTGGAGAGG - Intergenic
985655690 5:1130451-1130473 CCCCCACCCCACCCCAGGAGAGG + Intergenic
986310077 5:6545070-6545092 CACCCACACCACACCTGCACTGG + Intergenic
986448555 5:7844771-7844793 CCCACACAGCCCCCTTGGAGTGG + Intronic
987310083 5:16673681-16673703 CTCCCACACCACCGCTGGGGAGG - Exonic
992120304 5:73585773-73585795 CACCATCAGCAGCACTGGAGAGG + Intergenic
994585924 5:101709545-101709567 CACTCACAGCATCCCCGGATGGG + Intergenic
995863629 5:116666901-116666923 CACCCACGGATCTCCTGGAGGGG - Intergenic
996731852 5:126724656-126724678 TATCCACAGCACCCTTGAAGGGG - Intergenic
998063924 5:139141085-139141107 CACCTAAAACAGCCCTGGAGAGG - Intronic
998519136 5:142783936-142783958 CAGCCACACCACCCCTGCTGTGG + Intronic
999619344 5:153456673-153456695 CATCCACAGCTCCCTTGAAGGGG + Intergenic
1001307883 5:170588952-170588974 ATCCCACAGCAACCCTGAAGAGG - Intronic
1006680741 6:35795401-35795423 GGCCCACGGCACCCCTGGGGAGG - Intronic
1007252005 6:40502141-40502163 TGCCCACAGCAGCCCTAGAGGGG + Intronic
1014547336 6:122748461-122748483 CACCCACAGCATGCCTGTACTGG - Intergenic
1015786153 6:136922811-136922833 CGCCGCCAGCACCCCTGGCGAGG - Exonic
1016489917 6:144588019-144588041 CACCTACAGCATCCATAGAGAGG - Intronic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1018834098 6:167470532-167470554 CACCCACAGCAGCCCTGGCTGGG - Intergenic
1019259492 7:72899-72921 CACCCACACCTCCCCTGGGCCGG - Intergenic
1019318825 7:405693-405715 CCCCCACACCCCCCATGGAGGGG + Intergenic
1019701747 7:2477598-2477620 CAGCGGCAGCACCCATGGAGAGG - Intergenic
1019895446 7:3979037-3979059 CACCCACAGCAGTCCTGATGGGG + Intronic
1022424993 7:30260427-30260449 CACCCTCAAATCCCCTGGAGTGG + Intergenic
1023055235 7:36285355-36285377 AACCCAAACCACCCCTTGAGAGG - Intronic
1023267705 7:38425290-38425312 AGCCCACAGCAGCCCAGGAGAGG + Intronic
1023842882 7:44106813-44106835 CTCCCTCAGAAACCCTGGAGTGG + Exonic
1026440409 7:70438849-70438871 CTCCAACAGCATCCCTGGTGGGG - Intronic
1027235332 7:76294576-76294598 CACCCCCATCACCACTGAAGCGG - Intergenic
1027492808 7:78851345-78851367 CCCTCACAGCACTCCAGGAGGGG - Intronic
1027540621 7:79459556-79459578 CACCCACAGTGTCCCTGGACTGG - Intergenic
1029075380 7:97929977-97929999 ACCCCACAGCAGCCCTGGGGTGG + Intergenic
1029533041 7:101137981-101138003 CACCTGCAGCACCCCTGTACTGG - Exonic
1029605929 7:101599402-101599424 AAGCCACAGCACCCATGCAGGGG + Intergenic
1031151704 7:118061404-118061426 CACACAATCCACCCCTGGAGGGG - Intergenic
1032079077 7:128849730-128849752 TCCCCACAGCACCCCCGAAGTGG + Intronic
1032782199 7:135172253-135172275 CACCCACAGCATGCCTGCATGGG + Intergenic
1033234795 7:139629754-139629776 CAAGGACAGCACACCTGGAGCGG + Intronic
1033989507 7:147265889-147265911 AAACCACAGCACCCCTACAGAGG + Intronic
1034850257 7:154486806-154486828 GACCTACAGCACCTCTGGAAGGG - Intronic
1035911023 8:3566478-3566500 CACTGACAGCACACCAGGAGGGG - Intronic
1035929937 8:3768995-3769017 GGCCCACAGCACACCTGGGGAGG + Intronic
1037070919 8:14647967-14647989 CACCAGAAGCACACCTGGAGTGG + Intronic
1037504551 8:19516973-19516995 GACCCACTGCCCACCTGGAGAGG + Intronic
1038428236 8:27479281-27479303 CACACACAGCCTCTCTGGAGGGG + Exonic
1040470275 8:47730786-47730808 CACCCACTGCACCTCAGGAGGGG + Intronic
1041698864 8:60765718-60765740 AACCCTCAGCACCACTGGTGCGG - Intronic
1044941485 8:97348528-97348550 CACCCACAGCAGCCCTATAAAGG + Intergenic
1047996433 8:130341185-130341207 CACCCACAGCTTGCCTGGATGGG + Intronic
1049021059 8:139957950-139957972 CACCCACAGCCCCTGAGGAGAGG + Intronic
1049429203 8:142551340-142551362 CCCCCACAGCAGCCCCGGGGTGG - Intergenic
1049609914 8:143550114-143550136 GGCCCAGAGCACCCCTGGGGGGG - Intergenic
1049830687 8:144699389-144699411 CACCCACAGCACCCCCACACCGG - Intergenic
1056315337 9:85383393-85383415 CAAACACAAAACCCCTGGAGAGG - Intergenic
1059365859 9:113786002-113786024 CACCCACAGTTCCCATGCAGGGG + Intergenic
1059428381 9:114235519-114235541 CCCCCACAGACCCCCTGGCGAGG - Intronic
1059428877 9:114238081-114238103 CACCCACAGCCACTCTGGAACGG + Intronic
1060036631 9:120261520-120261542 CTCCCAGGGCTCCCCTGGAGAGG + Intergenic
1060104732 9:120866528-120866550 CTCCCACAGCAACCCTGGGCAGG + Intronic
1060154235 9:121308141-121308163 AACCCACAGCTCCCTTGAAGGGG + Intronic
1060994873 9:127870171-127870193 CACCTACAACAGCCCTGGAAGGG + Intronic
1061563123 9:131419462-131419484 CACCCAGAGCAGCCCTGCTGGGG + Intronic
1061824861 9:133251916-133251938 CGCCCCCAGCACCCCTAGTGCGG + Intronic
1062410598 9:136422211-136422233 CACCCTCTGCACCCCTGGGAGGG + Intronic
1062446150 9:136596023-136596045 CTTCAACAGCACCCCTGGAATGG + Intergenic
1062600055 9:137315517-137315539 CACCCCCAGCCCTCCTGGACCGG - Intronic
1062610744 9:137372351-137372373 CTCCCACAGCACCCCCAGAGTGG - Intronic
1062745210 9:138207564-138207586 CACCCACACCTCCCCTGGGCCGG + Intergenic
1062745494 9:138209137-138209159 CACCCACAGAAAACCTGGAGAGG - Intergenic
1203494615 Un_GL000224v1:139385-139407 CACTCAGACCACCCCTGGGGTGG - Intergenic
1203507234 Un_KI270741v1:81260-81282 CACTCAGACCACCCCTGGGGTGG - Intergenic
1189988323 X:46573385-46573407 CGCCCCCATCAGCCCTGGAGTGG - Intergenic
1191036586 X:56031375-56031397 CACCCACAGCATGCCTGTATCGG - Intergenic
1192208063 X:69109197-69109219 CCCCCACACCGCCCCTGGCGGGG - Intergenic
1192564120 X:72148793-72148815 CAACAGCAGCATCCCTGGAGAGG + Intergenic
1195361338 X:104085890-104085912 CACCCACAGAACACCAGCAGGGG + Intergenic
1195507280 X:105672499-105672521 CTCCGACAGAACCCCTGTAGGGG + Intronic
1196537875 X:116868511-116868533 CACTCACAGCAGCCCTTGACTGG + Intergenic
1200040505 X:153362632-153362654 CACCCACAGATCCCCAGAAGTGG + Intergenic
1200258946 X:154601400-154601422 TCCCCTGAGCACCCCTGGAGAGG - Intergenic