ID: 1084969510

View in Genome Browser
Species Human (GRCh38)
Location 11:72763021-72763043
Sequence GGACACCGGAACCAGCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 3, 2: 17, 3: 70, 4: 287}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084969507_1084969510 17 Left 1084969507 11:72762981-72763003 CCAGGAAGTAAGCAAATACTCAA 0: 1
1: 1
2: 16
3: 88
4: 527
Right 1084969510 11:72763021-72763043 GGACACCGGAACCAGCTTGAAGG 0: 1
1: 3
2: 17
3: 70
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084969510 Original CRISPR GGACACCGGAACCAGCTTGA AGG Intronic
900890556 1:5446817-5446839 GGACACAGGAACTGGCTTGTGGG - Intergenic
903988503 1:27247487-27247509 AGACACTGGAACCTACTTGAGGG - Intronic
904715659 1:32465511-32465533 GGCCACCAGAACCAGCTACAGGG - Intronic
905628204 1:39502619-39502641 GGACACAGGAGCCAACCTGAAGG + Intronic
907031590 1:51177623-51177645 GGACATCTAAGCCAGCTTGAAGG + Intergenic
908095706 1:60735248-60735270 GTACATAGGAGCCAGCTTGAAGG + Intergenic
908303713 1:62789342-62789364 GTTCATGGGAACCAGCTTGAAGG - Intronic
909692314 1:78422663-78422685 GGACATAGAAGCCAGCTTGAAGG - Intronic
909829398 1:80167091-80167113 GGACACAAGAACCAACTTAAGGG + Intergenic
910257533 1:85262805-85262827 GGACACAGAAGCCTGCTTGAAGG - Intergenic
911948572 1:104142309-104142331 GGACATAGAAGCCAGCTTGAAGG - Intergenic
912483301 1:110002381-110002403 GGACAGAAGAGCCAGCTTGAAGG + Intronic
912725335 1:112054272-112054294 GGACACAGGAGCTACCTTGAAGG + Intergenic
913415667 1:118603715-118603737 GGACACAGGAGCCATCTTGAAGG + Intergenic
913468363 1:119166109-119166131 GAACACAGGAACAGGCTTGATGG + Intergenic
913693628 1:121303393-121303415 AGACACAGAAGCCAGCTTGAAGG - Intronic
913974473 1:143443890-143443912 GGACACAAGAACCAACTTAAAGG + Intergenic
914068863 1:144269504-144269526 GGACACAAGAACCAACTTAAAGG + Intergenic
914110292 1:144696850-144696872 GGACACAAGAACCAACTTAAAGG - Intergenic
914143931 1:144976687-144976709 AGACACAGAAGCCAGCTTGAAGG + Intronic
916523580 1:165588274-165588296 GGACACTGGACCCAGTTTGGTGG - Intergenic
916900999 1:169223555-169223577 GGACACAGAAGCCAGCTTGAAGG - Intronic
917440535 1:175064935-175064957 GCACACAGTAACCAGCCTGAAGG + Intergenic
918009079 1:180569709-180569731 GGACACAGGGACCAGCCTGAAGG + Intergenic
918717647 1:187810409-187810431 GGAAACCGGAAGCAGCAAGATGG + Intergenic
919127108 1:193408390-193408412 AGACTCCGGACCCAGCCTGAAGG - Intergenic
919704258 1:200661165-200661187 GGACATAGAAACCAACTTGAAGG + Intronic
920329542 1:205196064-205196086 GGACACAGGAACCAGCTTGAAGG + Intronic
920480952 1:206321762-206321784 AGACACAGAAGCCAGCTTGAAGG - Intronic
920588544 1:207193833-207193855 GGACACCAGATCCTACTTGAGGG - Intergenic
921260689 1:213383087-213383109 GGACACACGACCCAGCTTGGAGG - Intergenic
922532345 1:226354009-226354031 GGACACCAGGACCAGCCCGAGGG - Intergenic
923007303 1:230060865-230060887 GGACATAGGAGCCAGCTTGAAGG - Intronic
923369728 1:233297827-233297849 GAACACCTGAACCAGCAGGAAGG + Intergenic
923585784 1:235268934-235268956 AGACACAGGAAGCATCTTGAAGG + Intronic
923625485 1:235610613-235610635 AGACACAGGAACCAGCTTGAAGG - Intronic
1064007159 10:11707904-11707926 GGAAACCAGAACCTGCTGGAGGG + Intergenic
1064265269 10:13820807-13820829 GGACCCCGGGACCTGCTGGATGG + Intronic
1065148150 10:22793770-22793792 GAACACAGGAGCCAGCTTGGAGG - Intergenic
1066131840 10:32402007-32402029 GGACAGAGGAGCCAGCTTGAAGG + Intergenic
1067784442 10:49233854-49233876 GGACACCAGATTCAGCATGAAGG + Intergenic
1067815169 10:49468888-49468910 GGACAAAGGAGCCAGCTTGAAGG + Intronic
1067927238 10:50522244-50522266 GGATAAAGGAGCCAGCTTGAAGG - Intronic
1068799977 10:61129617-61129639 GGACACGGGAACCAATTTGAAGG - Intergenic
1070942840 10:80361767-80361789 GGACAGAGAAGCCAGCTTGAAGG - Intronic
1072957472 10:99900030-99900052 GGTCACCGGGATGAGCTTGAGGG - Exonic
1073288309 10:102401274-102401296 GGACACCCGAAGCAGCTTCCGGG + Exonic
1074130844 10:110572953-110572975 AGACACAGGAGCCAGCTTGAAGG - Intronic
1074179967 10:111051604-111051626 GCACACAGGAACCAGCTTGAAGG + Intergenic
1074187233 10:111107720-111107742 GGACACAGGATCCAAGTTGAAGG - Intergenic
1075842979 10:125519724-125519746 AGACACAGGAGCCAGGTTGAAGG + Intergenic
1077491087 11:2861389-2861411 GGGCCCCGGACCCAGCCTGAGGG - Intergenic
1077730063 11:4721040-4721062 GGACACCGGAAGCTGCTGTAGGG - Intronic
1079404725 11:20134771-20134793 GAACACCGGATCCAGCTTCAAGG + Intergenic
1080531370 11:33179867-33179889 GGACACAGAAGCCAGCTCGAAGG + Intergenic
1081530061 11:43952233-43952255 AGACACAGGAACCTACTTGAAGG - Intergenic
1082167573 11:48965842-48965864 GGAAACTGGAGCCACCTTGAGGG - Intergenic
1083576193 11:63793593-63793615 GAATACAGAAACCAGCTTGAAGG + Intergenic
1084499316 11:69525449-69525471 GGACTCCAGAACCTGCTTCAGGG + Intergenic
1084731759 11:71078209-71078231 GGACACAGGAGCCATCCTGAAGG + Intronic
1084969510 11:72763021-72763043 GGACACCGGAACCAGCTTGAAGG + Intronic
1085116147 11:73933954-73933976 GGACACAGGATCCAGCTTGAAGG - Intergenic
1085520731 11:77137686-77137708 GGACAGCTGAACCACCTCGATGG - Intronic
1086643861 11:89194801-89194823 AGACATAAGAACCAGCTTGAAGG - Intronic
1087124043 11:94605861-94605883 AGACACAGAAGCCAGCTTGAAGG - Intronic
1088384142 11:109234124-109234146 GGAAACAGGAGCCAGTTTGAAGG - Intergenic
1089811293 11:121134065-121134087 GGACACAGGAGCCAGCTTGAAGG - Intronic
1089855765 11:121543349-121543371 GAACACAGGAACCAGCCTGATGG - Intronic
1090663966 11:128902565-128902587 GACCACCGGAACCAGGCTGATGG + Exonic
1090793614 11:130114543-130114565 GGACACAGGAACCAGCATAACGG - Intronic
1090859713 11:130642043-130642065 GGACACAAAAGCCAGCTTGAAGG - Intergenic
1091127774 11:133117156-133117178 TGACACAGGAGCCAACTTGAAGG - Intronic
1091607169 12:1963649-1963671 GGACACAGAAATCAGCTTCAAGG - Intronic
1092302572 12:7266050-7266072 GGACACAGAAACCAGCCTGAAGG + Intergenic
1092579815 12:9826852-9826874 AGACACCGGAGCCTACTTGAAGG + Intergenic
1092897255 12:13024192-13024214 GGTCACAGGAACCAATTTGAAGG - Intergenic
1095186314 12:39204387-39204409 AGACACTAGAACCTGCTTGAGGG + Intergenic
1095571712 12:43690513-43690535 AGACACCGGGACCTACTTGAGGG + Intergenic
1096749591 12:53750397-53750419 GGATTCAGGAACCAGCATGAAGG + Intergenic
1096953566 12:55502175-55502197 AGACACCAGAGCCTGCTTGAGGG + Intergenic
1096972500 12:55679024-55679046 GGAGACAGGAGCCAGCTTGCAGG + Intergenic
1097216189 12:57415028-57415050 GGACAAAGCAGCCAGCTTGAAGG + Intronic
1098195698 12:67999499-67999521 GGACACAGAAGCCAACTTGAAGG + Intergenic
1098909339 12:76193275-76193297 GGACAAAGGAGGCAGCTTGAGGG - Intergenic
1099193229 12:79582451-79582473 TGATACAGGAACCAACTTGAAGG + Intronic
1103060944 12:117858178-117858200 GCATATCAGAACCAGCTTGAGGG + Intronic
1103929390 12:124441286-124441308 GGACACAGAACCCAGCCTGAAGG + Intronic
1104287327 12:127435807-127435829 GAAAACAGGAACAAGCTTGAAGG - Intergenic
1104294526 12:127499928-127499950 GGACACGAAAGCCAGCTTGAAGG - Intergenic
1104994640 12:132646100-132646122 GGACTCAGGTGCCAGCTTGAAGG + Intronic
1105688499 13:22811235-22811257 GGGCACAGGCACCAGCTTGAAGG + Intergenic
1110089686 13:71430435-71430457 GGACACAAGAGCCAGCTTGAGGG + Intergenic
1110421184 13:75310811-75310833 AGACACCGGGACCCCCTTGAGGG - Intronic
1110634913 13:77755551-77755573 GGATACAGGAACCAAGTTGAAGG + Intronic
1111668507 13:91299871-91299893 GGACATAGGATCCAGCTTGAGGG - Intergenic
1111935539 13:94553453-94553475 GGACCTAGGAACCAGTTTGAAGG + Intergenic
1112005275 13:95248160-95248182 GAACAGAGGACCCAGCTTGACGG + Intronic
1113130379 13:107030262-107030284 GGACACTGGAACCAGCCAGGGGG + Intergenic
1113647600 13:112010177-112010199 GGCCACCGGATCCAGGATGAGGG + Intergenic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1115253813 14:31377287-31377309 GGACAAATGAACCAACTTGAAGG + Intronic
1116037520 14:39645319-39645341 GGACACAGGAACCAGGTGAAAGG + Intergenic
1117019757 14:51557788-51557810 AGACACCGGGACCTACTTGAAGG + Intronic
1118400073 14:65371662-65371684 GGACATGGAAATCAGCTTGAAGG - Intergenic
1119184075 14:72625383-72625405 GGACACAGGAAGCAACTTGAAGG - Intronic
1119384204 14:74246992-74247014 GGGCACCAGAACCAGCAGGAAGG + Intronic
1119449253 14:74694251-74694273 GGCTACTGGAACCAGCTTAAAGG + Intronic
1121493146 14:94374238-94374260 GGACACAGCAACCAGACTGAAGG + Intergenic
1121609630 14:95268664-95268686 TGACATCTGAACCAGCTGGAGGG + Intronic
1122565067 14:102648031-102648053 GGACACAGGAGTCAGCTTGAAGG - Intronic
1122902749 14:104788554-104788576 GGACCCCAGGACCAGCTGGATGG + Intronic
1125373898 15:39007552-39007574 TGACACAGGAATCAGCTTAAAGG - Intergenic
1126168971 15:45678514-45678536 GGACACAAGAGCCAGCTGGAAGG - Intronic
1126233916 15:46359724-46359746 AGACACCGGGACCTACTTGAGGG + Intergenic
1126446329 15:48749043-48749065 GGACATAGGAGCCAGTTTGAAGG + Intronic
1126783244 15:52156221-52156243 GGTCATGGGAACCTGCTTGACGG - Intronic
1127072024 15:55296602-55296624 GGACACAGGATCCATCCTGAGGG + Intronic
1127125817 15:55811039-55811061 GGACACAGGCACCAACCTGAAGG - Intergenic
1127322485 15:57860747-57860769 GAACACAGGAACCAACTTGAAGG - Intergenic
1129655545 15:77522549-77522571 AGACACAGGGGCCAGCTTGAAGG + Intergenic
1130182975 15:81650654-81650676 GGACATAGCAACTAGCTTGAAGG - Intergenic
1130696982 15:86140651-86140673 GGACTCCAGACCCAGCTTGGGGG + Intergenic
1130971160 15:88734007-88734029 GAAGACAGGAGCCAGCTTGAAGG - Intergenic
1131365590 15:91836795-91836817 GGACAAAGGAGCCAGCTTCAAGG - Intergenic
1132126038 15:99225492-99225514 GGACTCAGGAGCCAGCTGGAAGG + Intronic
1132427496 15:101730829-101730851 GGGCACAGGAACCAGCTTGAAGG + Intergenic
1132860074 16:2066163-2066185 AGAGACAGGAAGCAGCTTGATGG - Intronic
1133501473 16:6371494-6371516 TGATACAGGAGCCAGCTTGAAGG - Intronic
1134585292 16:15404993-15405015 GGACACAGGAACCAGCTTGGGGG - Intronic
1134766672 16:16764869-16764891 AGACACTGGGACCTGCTTGAGGG - Intergenic
1135952670 16:26929834-26929856 GGGCACCGGAGCCTACTTGAAGG - Intergenic
1136285481 16:29238050-29238072 GGACACAGGAATTGGCTTGAAGG - Intergenic
1136319303 16:29472246-29472268 GGACACAGGAACCAGCGTGGAGG - Intergenic
1136433874 16:30211590-30211612 GGACACAGGAACCAGCGTGGAGG - Intergenic
1137994893 16:53199847-53199869 GAACACAGGAACCAACTTGAAGG + Intronic
1138623173 16:58227886-58227908 GGACACAGGACCCAGCTTGAAGG + Intergenic
1139727333 16:68911886-68911908 GCACACTGGAGCCAACTTGAAGG + Intronic
1140023015 16:71257115-71257137 GGACACAGAAGCCAGATTGATGG + Intergenic
1141486446 16:84343351-84343373 GGACCCCGGGCCCAGCGTGATGG - Intergenic
1142090809 16:88208190-88208212 GGACACAGGAATTGGCTTGAAGG - Intergenic
1143373146 17:6452849-6452871 GGACACAGGACCCAGCAGGAGGG - Exonic
1144079838 17:11753974-11753996 GGACACTGGAGCCCCCTTGAGGG - Intronic
1146120691 17:30191461-30191483 GCACACAGAAACCAGCTTGAAGG + Intergenic
1146588592 17:34106714-34106736 GGACACAGGAACTAGCTTTAAGG - Intronic
1148461757 17:47843165-47843187 GGGCACCTGAAGCAGCTTGCAGG + Intergenic
1149395227 17:56234511-56234533 AGACACCGGGACCTACTTGAGGG - Intronic
1149568792 17:57657673-57657695 GGACACAGAAAACATCTTGAAGG - Intronic
1149575679 17:57710777-57710799 GGACACAGAAGCCACCTTGAGGG - Intergenic
1150204722 17:63394319-63394341 GGACACAGGAATCAGTTTGAAGG - Intronic
1151006631 17:70445179-70445201 GGACATAGGAGCCAACTTGAAGG + Intergenic
1151823436 17:76509843-76509865 GGACACAGGAGCCAGCTGGAAGG + Intergenic
1151924486 17:77184560-77184582 GGACAGAGGAACCAGCCTGAAGG - Intronic
1152981457 18:281539-281561 GGACATCCGACCCAGCTTGGTGG - Intergenic
1153198201 18:2623989-2624011 GGACACAGGAACCAGCCTGATGG - Intergenic
1153554149 18:6293400-6293422 GGACACCAAAACCAGCTTGAAGG + Intronic
1154036933 18:10812359-10812381 GGACACCGGGGCCTACTTGAGGG + Intronic
1154109393 18:11552719-11552741 GGACACCCAAAGCAGCTTGCAGG + Intergenic
1155090775 18:22507988-22508010 AGACACTGGAACCTACTTGAGGG + Intergenic
1156341838 18:36216405-36216427 GGACACAAGAGCCAGCTTGAAGG + Intronic
1157004447 18:43565158-43565180 GGCCACAAGAGCCAGCTTGAAGG + Intergenic
1157084338 18:44563626-44563648 AGACACCGGGGCCTGCTTGAGGG + Intergenic
1157987793 18:52459359-52459381 AGACACCGGTACCTACTTGAGGG - Intronic
1158749163 18:60238920-60238942 AGACACTGGAACCTACTTGATGG - Intergenic
1159955009 18:74512958-74512980 GGACACCGGGAACAGCACGATGG - Intronic
1159968272 18:74618146-74618168 AGACACAGGAGCCAGCTTGAAGG - Intronic
1160682925 19:420212-420234 GGACACCAGAAACAGTCTGAGGG + Intronic
1163059444 19:14748139-14748161 AGACACCGAAGCCTGCTTGAGGG - Intronic
1163083574 19:14962225-14962247 GGAGAACGGAACCAGCTTCCTGG - Exonic
1164924107 19:32113188-32113210 GGAGACAAGAACCAGATTGAAGG + Intergenic
1164973845 19:32556160-32556182 GGACACAGGAGCTAGCTTGGAGG - Intergenic
1165127217 19:33607145-33607167 GGACACGGGAACCATCTGCAAGG - Intergenic
1165192075 19:34073124-34073146 GGACACAGGAACCAGTTTGGTGG + Intergenic
1165503725 19:36210945-36210967 GGACACAGGAATCGACTTGAAGG + Intronic
1165530060 19:36391283-36391305 GGACACAGGAGCCAATTTGAGGG + Intronic
1165602985 19:37073846-37073868 GGACACGGGCACCAGCGTCAGGG + Intronic
1166017753 19:39995877-39995899 GGACATGGAAACCAGATTGAAGG - Intronic
1166857076 19:45787626-45787648 GCACACAGGAGGCAGCTTGAAGG + Intronic
1167025928 19:46918105-46918127 GGACACAGAAGCCAGCCTGAAGG - Intergenic
1167151789 19:47714188-47714210 GGACAGAGGACCCAGCTTGCAGG - Intronic
1167234839 19:48308012-48308034 GGCCACAGAAGCCAGCTTGAAGG + Intronic
925523603 2:4775582-4775604 GGACACCCTACCCAGCTTGGAGG + Intergenic
925848246 2:8053026-8053048 GGACCCAGAAGCCAGCTTGAAGG + Intergenic
927821737 2:26272184-26272206 GCACACAGGAGCCAACTTGAAGG - Intronic
928417156 2:31105279-31105301 GGACACAGGAGCTGGCTTGAAGG - Intronic
928693554 2:33825227-33825249 AGACACCGGAGCCTACTTGAGGG - Intergenic
929735164 2:44540287-44540309 GGACAAAGGGACCAGCTTGAAGG - Intronic
929850357 2:45582671-45582693 GGACACAGAAGCTAGCTTGAAGG - Intronic
931297219 2:60939104-60939126 GGACACAGAAGCCAGCTTGAAGG + Intergenic
931561195 2:63562818-63562840 GCACACAGGAGCAAGCTTGAAGG - Intronic
931639002 2:64364765-64364787 GGACACAGCAGCCAGCTTTAAGG + Intergenic
932604105 2:73152604-73152626 GGACACAGGAACCAACTTGAAGG + Intronic
934179179 2:89604865-89604887 GGACACAAGAACCAACTTAAAGG + Intergenic
934289463 2:91679133-91679155 GGACACAAGAACCAACTTAAAGG + Intergenic
934844459 2:97653712-97653734 GGACACAAGAACCAACTAGAAGG - Intergenic
935015230 2:99175863-99175885 GGACACAGGAACTAACATGAAGG - Intronic
935620217 2:105123477-105123499 GGACACAGAAGCCACCTTGAAGG + Intergenic
938131730 2:128721816-128721838 GGACACAGGAGGCAGCTGGAAGG + Intergenic
939542664 2:143512824-143512846 GGACACAGGAACTAGTTTGCAGG - Intronic
940084563 2:149844192-149844214 GAACATAGGAACCAGCTCGAAGG + Intergenic
940308249 2:152249443-152249465 GGACACATGAACCAACTTTAAGG - Intergenic
940823541 2:158384783-158384805 GGGCACAGAAGCCAGCTTGAAGG - Intronic
941051026 2:160734425-160734447 GGACACAGGAACCATTTTAAAGG - Intergenic
941479404 2:165987669-165987691 AGACACAGGAACCAACTAGAAGG - Intergenic
942277095 2:174331206-174331228 GGACTCCGGAATAAGGTTGAAGG - Intergenic
942781541 2:179648736-179648758 GGACACAGGAGGCAGCTTGAAGG + Intronic
943657346 2:190523719-190523741 GGACACAGGAGCTAGTTTGAAGG + Intronic
944725951 2:202471122-202471144 GGACACAGGAGCCAGCTGGAAGG + Intronic
944828251 2:203506618-203506640 GGACACAGGAACCAGCCTGAAGG + Intronic
945898599 2:215513518-215513540 GAACACAGAAACCAGCTTGAAGG - Intergenic
948471012 2:238179143-238179165 GGACACAGGAACCAGCCAGCAGG + Intronic
948513015 2:238484698-238484720 TGTCACCGGAACCAGCCTGATGG + Intergenic
1169177304 20:3528568-3528590 AGACACCGGGACCTGCTTGAGGG + Intronic
1171253006 20:23663629-23663651 GGACACAGGAAGCAGCTTAAAGG + Intergenic
1171253089 20:23664926-23664948 GGACACAGGAAGCAGCTTAAAGG - Intergenic
1171259493 20:23718947-23718969 GGACACAGGAAGCAGCTTAAAGG + Intergenic
1171259576 20:23720240-23720262 GGACACAGGAAGCAGCTTAAAGG - Intergenic
1171268561 20:23794411-23794433 GGACACAGGAAACAGCTTAAAGG + Intergenic
1171268642 20:23795700-23795722 GGACACAGGAAGCAGCTTAAAGG - Intergenic
1173061795 20:39669478-39669500 GGACACAGGACCCAGCTGAAAGG - Intergenic
1173571760 20:44081675-44081697 GGACAACTCAGCCAGCTTGAAGG - Intergenic
1175710396 20:61216113-61216135 GGACACCAGAGCCAGCTCAACGG - Intergenic
1176728886 21:10469694-10469716 GAACACCAGTGCCAGCTTGAAGG - Intergenic
1177361173 21:20074136-20074158 AGACACAGGAATCAGCTTAAAGG + Intergenic
1178951178 21:36987054-36987076 GGACACAGGGGTCAGCTTGATGG - Intronic
1179262825 21:39773594-39773616 GGACACCAGCACCAGCTTGGAGG - Intronic
1181656884 22:24308935-24308957 GGACACAGGAACCAGCCTGATGG - Intronic
1181789026 22:25248668-25248690 GGACACAGGAACCAGCTTGAAGG - Intergenic
1182086581 22:27565246-27565268 AGACACTGGAACCATGTTGAAGG - Intergenic
1182636421 22:31731009-31731031 GGACACAGCAGCCAACTTGAAGG - Intronic
1183610225 22:38897189-38897211 GGACACAGAAGCCAACTTGAAGG - Intergenic
1185268835 22:49918989-49919011 GGACCCCGGATCCAGGGTGAGGG - Intronic
949420650 3:3862424-3862446 GGACACAGGTGCCAGCTTGAAGG - Intronic
949618168 3:5779240-5779262 GGACACATAAGCCAGCTTGAAGG - Intergenic
949869170 3:8572741-8572763 GGACATAGCAACCAGTTTGAAGG - Intergenic
950677335 3:14562327-14562349 GGACACAGAAGCCAGCTGGAGGG + Intergenic
950775860 3:15349796-15349818 AGACACCGGAGCCTACTTGAGGG + Intergenic
952131590 3:30370384-30370406 AGACACTGGAACGAGGTTGAGGG - Intergenic
952484182 3:33792813-33792835 GAACACAGGAGCCAGCTTGAGGG + Intergenic
952949554 3:38509692-38509714 GGACATGTGAATCAGCTTGAAGG + Intronic
953230576 3:41061557-41061579 AGACAACGGAGCCAACTTGAGGG - Intergenic
953352638 3:42227518-42227540 GCACACCAGAATCACCTTGAGGG - Intergenic
953854111 3:46487731-46487753 GGACACAGGAACCAACCTGAAGG - Intergenic
954568972 3:51624693-51624715 GGACACTGGAGCCAGACTGATGG - Intronic
955206063 3:56897239-56897261 GGACACAGGCACCAGGTTGTAGG - Intronic
958874738 3:99603295-99603317 AGACACCGGGACCTACTTGAGGG - Intergenic
960114304 3:113878261-113878283 GGATACTGGAGCCAGCTTGAAGG - Intronic
960117010 3:113905220-113905242 GGCCAAAGGAACCAACTTGAAGG - Intronic
960714295 3:120560090-120560112 GGACACAGGCATCACCTTGAGGG + Intergenic
960930622 3:122845125-122845147 AGACACTGGGACCAACTTGAGGG - Intronic
961240825 3:125409815-125409837 TGACGCAGGAACCAACTTGAAGG - Intergenic
961578316 3:127856716-127856738 AGACACCGGGACCTACTTGAAGG - Intergenic
962534327 3:136314187-136314209 GGACACAGGAACCAGCATGAAGG + Intronic
962585218 3:136835861-136835883 GGACACAGGAGCTGGCTTGAAGG - Intronic
962716768 3:138133254-138133276 GGACCCCAGAAACAGCTTGTAGG + Intergenic
963183197 3:142382502-142382524 AAACACAGGAACCAGGTTGAGGG - Intronic
964481102 3:157139023-157139045 GGACACAGGAACTATCTTAAAGG + Intergenic
964765753 3:160177395-160177417 GGACACAGAAACCAGCTTGAAGG - Intergenic
964860976 3:161200682-161200704 GAACACAGGAGCCAGCTTGAAGG - Intronic
966752297 3:183334001-183334023 GGACACAAGAGTCAGCTTGAAGG + Intronic
967499292 3:190178131-190178153 AGACTCGGGAGCCAGCTTGAAGG + Intergenic
969600998 4:8176342-8176364 GGACACAGGAAGCTGTTTGATGG - Intergenic
969989103 4:11242114-11242136 GGACACAGAAACCAAGTTGAAGG + Intergenic
970692222 4:18632852-18632874 GGACACTGGGACCTACTTGAGGG + Intergenic
970776011 4:19675075-19675097 AGACACTGGAACCTACTTGAAGG + Intergenic
971989669 4:33875915-33875937 AGACACCGGGACCTGCTTGAGGG - Intergenic
972441401 4:39097073-39097095 AGACACAGGAAACAGCTTGCAGG + Intronic
972571277 4:40312547-40312569 GGACACAGGAGCCAGTGTGAAGG + Intergenic
972862197 4:43183777-43183799 GGACACAGGAGTCAACTTGAAGG - Intergenic
974587620 4:63900014-63900036 CGACACAGAAACCAGCTTTAAGG - Intergenic
974621915 4:64367216-64367238 AGACACTGGAGCCTGCTTGAGGG + Intronic
976367935 4:84251083-84251105 AGACACTGGGACCTGCTTGAGGG + Intergenic
977503522 4:97872840-97872862 GGACACAAGAATTAGCTTGAAGG - Intronic
977692967 4:99936719-99936741 AGACACAGGAGCCAGCCTGAAGG + Intronic
979233826 4:118376623-118376645 GGACACAGAAACCAGTTGGAAGG + Intergenic
979562986 4:122121047-122121069 GGTCACAAGAGCCAGCTTGAAGG + Intergenic
980106858 4:128596125-128596147 GGGCACGGGAAACATCTTGAGGG + Intergenic
981474282 4:145173010-145173032 GGACAACTGAAACTGCTTGAAGG + Intronic
981982338 4:150809467-150809489 GGACAATGAAGCCAGCTTGAAGG + Intronic
982727355 4:158919810-158919832 GGACACAGAAGCCAGATTGAAGG - Intronic
984115806 4:175679816-175679838 AGATACAAGAACCAGCTTGAAGG - Intronic
985810780 5:2082801-2082823 GGATACAGGAACCAGCTGCAAGG + Intergenic
986728993 5:10621112-10621134 GGACACTGGAGCCATCTTCAGGG - Intronic
987577254 5:19745693-19745715 GAACACAGGAACCAGCCTGCAGG - Intronic
987850337 5:23344533-23344555 AGACACCGGGACCTACTTGAGGG + Intergenic
989298906 5:39864860-39864882 AGACACCGGGGCCTGCTTGAGGG - Intergenic
989659456 5:43784155-43784177 GGACACAGGAACCATTTTAATGG - Intergenic
991642075 5:68764977-68764999 GGACACTGGAACCAGCTGTAAGG - Intergenic
996447826 5:123577089-123577111 GGACAGAGAAGCCAGCTTGAAGG - Intronic
996710339 5:126537093-126537115 GGACAGTGAAGCCAGCTTGAAGG + Intergenic
998105523 5:139466643-139466665 GGACACAGAAGCCAGCTTGTAGG - Intergenic
999168000 5:149567693-149567715 GGACACAGGAGTCAGCTTGAAGG - Intronic
999290546 5:150422648-150422670 GGACCCAGGAGCCAACTTGAAGG + Intergenic
1000626127 5:163540977-163540999 GGACACAGGAATTAACTTGAAGG + Intergenic
1001341402 5:170849554-170849576 GGACACAGGAACCAACTCGATGG + Intergenic
1001788243 5:174432307-174432329 GGACAATGGAAGGAGCTTGAGGG - Intergenic
1003048303 6:2756340-2756362 GTACATAGGAGCCAGCTTGAAGG - Intergenic
1003190433 6:3869795-3869817 GCACACAGGAACCTGCCTGATGG + Intergenic
1004401915 6:15296705-15296727 GGACACGGGTAGCAGCTTTAAGG - Intronic
1004451128 6:15747732-15747754 GGACACAGGAATCAACCTGAAGG + Intergenic
1004490745 6:16112481-16112503 GAACACAGGAAATAGCTTGAAGG + Intergenic
1005739778 6:28779910-28779932 GGACACAGAAGCCAGCTTGAAGG + Intergenic
1009445645 6:63739185-63739207 GGACACAGGAACCAGCTTGAAGG - Intronic
1009468666 6:64004618-64004640 GGACACTGGAGCCTACTTGAGGG - Intronic
1010610339 6:77946748-77946770 AGACACTGGAACCTACTTGAAGG - Intergenic
1011402112 6:86974861-86974883 GTACACAGGAACCACTTTGAAGG - Intronic
1012161135 6:95887399-95887421 GAGCACCGGAATCAGCTTGAAGG - Intergenic
1012198712 6:96377974-96377996 AGACACCGGGACCTGCTAGAGGG - Intergenic
1012343842 6:98162191-98162213 GGACACAGGAGCTAACTTGAAGG + Intergenic
1012544356 6:100400622-100400644 TGACACAGGAGCCAGCTTGAAGG + Intronic
1012781794 6:103569612-103569634 AGACACAGGAACTATCTTGAAGG - Intergenic
1012903147 6:105031265-105031287 GGACACAGAAACCAGCCTGAAGG - Intronic
1015251815 6:131135463-131135485 GGACGCCGGAACAAGCCAGAAGG - Intergenic
1015488035 6:133793955-133793977 AGACACTGGGACCAACTTGAGGG - Intergenic
1015654436 6:135500719-135500741 GGTCACAGAAGCCAGCTTGAAGG + Intergenic
1017158894 6:151347156-151347178 GGACACAAGAACTGGCTTGAAGG - Intronic
1018017128 6:159722625-159722647 AGACATGGGAGCCAGCTTGAAGG - Intronic
1018235951 6:161723839-161723861 GGTCTGCTGAACCAGCTTGAGGG - Intronic
1020571114 7:9862991-9863013 AGACACTGGAGCCTGCTTGAGGG + Intergenic
1022222366 7:28325901-28325923 GGACACAGAAGCCAGCTTGAAGG - Intronic
1022536748 7:31103118-31103140 GGACACGGGCCCCAGCTTGGAGG + Intronic
1023125628 7:36951513-36951535 GGCCACTGGAACCACCTGGAGGG + Intronic
1024562369 7:50655321-50655343 AGACACAGGAGCCAGCATGAAGG - Intronic
1026131387 7:67623684-67623706 GGACATAGGAACCAGCCTGAAGG + Intergenic
1026131840 7:67627413-67627435 GGACACAGGAACCGGCTTGAAGG + Intergenic
1030807927 7:113938741-113938763 GGACACTGGTGCCTGCTTGAGGG - Intronic
1032647547 7:133841823-133841845 AGACACCGGGACCTACTTGAGGG - Intronic
1035014370 7:155752079-155752101 GGACACAGAAACCAGTTTAAAGG - Intronic
1036386183 8:8283844-8283866 AGACACATGAACCATCTTGAAGG + Intergenic
1037177082 8:15960550-15960572 GGACACCAGGACCTACTTGAGGG - Intergenic
1038782978 8:30584161-30584183 GGACATAGGAACCAACATGAAGG - Intronic
1042523543 8:69740781-69740803 GGACACAGAAGACAGCTTGAAGG + Intronic
1043371715 8:79602032-79602054 GGTCACAAGAACAAGCTTGAAGG - Intergenic
1043475153 8:80598891-80598913 GGACACAGGAGCCAGTTTGAAGG - Intergenic
1044047867 8:87460218-87460240 GGACACATAAACCAGCTGGAAGG + Intronic
1044390392 8:91643371-91643393 GGAAACAGAAGCCAGCTTGAAGG - Intergenic
1045175096 8:99714176-99714198 GGACACAGGGACCATCTTAAAGG + Intronic
1046979742 8:120324052-120324074 GGACACTGGGACCTACTTGAGGG + Intronic
1047380113 8:124353728-124353750 AGACACAGAAACCAGCTTGAAGG + Intronic
1047586750 8:126281516-126281538 GCACATGGGAACCAGTTTGAAGG + Intergenic
1049066176 8:140317362-140317384 GGACACAGGAACCAACCAGAAGG - Intronic
1050137629 9:2483703-2483725 GGACACAGAAACCAGTTTGAAGG + Intergenic
1050249118 9:3725287-3725309 AGACACTGGAGCCAACTTGAGGG + Intergenic
1051487483 9:17624638-17624660 GGACACAGGAGCCATCTTGAAGG - Intronic
1052150996 9:25115594-25115616 GGACACTGGAGCCTACTTGAGGG + Intergenic
1053545370 9:39017883-39017905 GGACATTAGAAGCAGCTTGATGG - Intergenic
1055130592 9:72769934-72769956 GGACAGAGGAACAAGCATGAAGG + Intronic
1055463412 9:76540518-76540540 GGACACAGGAGCCACCCTGAAGG - Intergenic
1055573522 9:77640916-77640938 TGACACAGGAGCCAGCTTGAAGG + Intronic
1057014557 9:91640093-91640115 GGCCACAGAAGCCAGCTTGAAGG + Intronic
1057326434 9:94068957-94068979 GGACATTGTAAACAGCTTGATGG - Intronic
1058247986 9:102654609-102654631 TGACACAGAAACCACCTTGAGGG + Intergenic
1059185267 9:112263148-112263170 GGACATAGAAACCAGCTTGAAGG + Intronic
1060510194 9:124226246-124226268 GGACACAGGGGCCAGCTGGATGG + Intergenic
1060708457 9:125831779-125831801 GGACACAGGAGCCAACTTGAAGG - Intronic
1061285689 9:129621175-129621197 GAAACCTGGAACCAGCTTGAGGG + Intronic
1061386386 9:130292718-130292740 GGACATAGGAACCAGCTTGAAGG - Intronic
1203585362 Un_KI270746v1:64373-64395 GAACACCAGTGCCAGCTTGAAGG + Intergenic
1187428500 X:19200786-19200808 AGATTCAGGAACCAGCTTGAAGG + Intergenic
1187509829 X:19907777-19907799 GGACACAGCAATCAGCTTAAAGG + Intergenic
1187764394 X:22623704-22623726 GAACACAGGAATAAGCTTGAAGG + Intergenic
1187793502 X:22976935-22976957 AGACACAGGAACCTACTTGAGGG + Intergenic
1187906842 X:24074805-24074827 GGACACAAGAGCCAGCCTGAAGG - Intronic
1188451341 X:30310345-30310367 AGACACTGGAACCTACTTGAAGG - Intergenic
1189811937 X:44788953-44788975 TGACACAGGAACCAACTTGAAGG + Intergenic
1190124279 X:47689700-47689722 GGATGCAGGAACCAGCATGAAGG - Intergenic
1190949509 X:55129516-55129538 GGACACCAGAACCAACTTGCAGG + Intronic
1191654366 X:63579869-63579891 AGACACTGAAACCAACTTGAGGG + Intergenic
1193152114 X:78136397-78136419 GGACACAGGAAACAGCTTGAAGG + Intronic
1195602265 X:106762853-106762875 GGACACCGGGGCCTACTTGAGGG + Intronic
1195779351 X:108444123-108444145 GGACACAGGAGCCAATTTGAAGG - Intronic
1196769511 X:119280007-119280029 GGACATGGAAACCAGCTTAAAGG - Intergenic
1197293636 X:124690199-124690221 TGACACAGGAGCCAACTTGAAGG - Intronic
1197293784 X:124692266-124692288 AGACACCGGGACCAACTTGAGGG + Intronic
1197449679 X:126595993-126596015 AGACACAGGAGCCATCTTGAAGG + Intergenic
1198426896 X:136529632-136529654 AGACACCGGGACCTACTTGAAGG + Intergenic
1198495833 X:137192094-137192116 GGACATAGGAGCCAGCTTGAAGG + Intergenic
1199457792 X:148048617-148048639 GGACACAGGAAGCAACTTGAAGG + Intergenic
1199877006 X:151940788-151940810 AGACACCAGGACCTGCTTGAGGG - Intergenic