ID: 1084971027

View in Genome Browser
Species Human (GRCh38)
Location 11:72772135-72772157
Sequence TGGCACTGCCATAGTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 187}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084971016_1084971027 22 Left 1084971016 11:72772090-72772112 CCCCATGCTTAGCGCTGCCATAG 0: 1
1: 0
2: 0
3: 7
4: 181
Right 1084971027 11:72772135-72772157 TGGCACTGCCATAGTGGGCATGG 0: 1
1: 0
2: 2
3: 17
4: 187
1084971020_1084971027 5 Left 1084971020 11:72772107-72772129 CCATAGCAGTCACGGTTCTCCCT 0: 1
1: 0
2: 1
3: 10
4: 84
Right 1084971027 11:72772135-72772157 TGGCACTGCCATAGTGGGCATGG 0: 1
1: 0
2: 2
3: 17
4: 187
1084971014_1084971027 28 Left 1084971014 11:72772084-72772106 CCCGCTCCCCATGCTTAGCGCTG 0: 1
1: 0
2: 1
3: 8
4: 144
Right 1084971027 11:72772135-72772157 TGGCACTGCCATAGTGGGCATGG 0: 1
1: 0
2: 2
3: 17
4: 187
1084971018_1084971027 20 Left 1084971018 11:72772092-72772114 CCATGCTTAGCGCTGCCATAGCA 0: 1
1: 0
2: 0
3: 3
4: 101
Right 1084971027 11:72772135-72772157 TGGCACTGCCATAGTGGGCATGG 0: 1
1: 0
2: 2
3: 17
4: 187
1084971017_1084971027 21 Left 1084971017 11:72772091-72772113 CCCATGCTTAGCGCTGCCATAGC 0: 1
1: 0
2: 1
3: 4
4: 52
Right 1084971027 11:72772135-72772157 TGGCACTGCCATAGTGGGCATGG 0: 1
1: 0
2: 2
3: 17
4: 187
1084971015_1084971027 27 Left 1084971015 11:72772085-72772107 CCGCTCCCCATGCTTAGCGCTGC 0: 1
1: 0
2: 0
3: 18
4: 164
Right 1084971027 11:72772135-72772157 TGGCACTGCCATAGTGGGCATGG 0: 1
1: 0
2: 2
3: 17
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084971027 Original CRISPR TGGCACTGCCATAGTGGGCA TGG Intronic
900088992 1:911125-911147 TGGCACAGCCACAGTGGGGCGGG - Intergenic
900602900 1:3510682-3510704 TGGTACCCCCATGGTGGGCATGG - Intronic
900895053 1:5477621-5477643 TGGCTTTGCCATAGTGTGCCAGG - Intergenic
901122408 1:6906387-6906409 TGGCCCTGCCACAGTGAGGAAGG - Intronic
901153123 1:7117602-7117624 TGGCTCCCCCCTAGTGGGCACGG + Intronic
903117837 1:21192708-21192730 GGGCAGTGCCAGAGTGGGGAGGG - Intergenic
908501385 1:64745857-64745879 CGGGAGTGCCATAGGGGGCAGGG + Intronic
909998114 1:82306469-82306491 TGGCACAGCCATTGCAGGCAAGG - Intergenic
911120725 1:94293748-94293770 TGGCACACCCATGGAGGGCATGG - Intergenic
912736351 1:112152710-112152732 TGACCCTACCACAGTGGGCAGGG + Intergenic
912969810 1:114270129-114270151 TGGCACTGCAACAGTGCCCAGGG - Intergenic
915048390 1:153040195-153040217 TGGCACTGCTGAGGTGGGCAGGG + Exonic
915049784 1:153056584-153056606 TGGCACTGCTGAGGTGGGCAGGG + Exonic
915050836 1:153070688-153070710 TGGCACTGCTGAGGTGGGCAGGG + Exonic
915052753 1:153093600-153093622 TGGCACTGCTGAGGTGGGCAGGG + Exonic
915056802 1:153140558-153140580 TGGCACTGCTGAGGTGGGCAGGG + Intergenic
915777480 1:158506610-158506632 AGTCACTGCCTTAGTGGGCTTGG + Intergenic
919411258 1:197246003-197246025 TGACACTACCATAGTGGGGAGGG + Intergenic
919981904 1:202647064-202647086 TGGCAGAGCCATGGTGGCCAGGG + Intronic
920533768 1:206723888-206723910 TGCCCCTGCCACAGTTGGCAGGG + Intronic
924600025 1:245480396-245480418 AGGGACTGCCATACTGGGCTAGG + Intronic
1064964037 10:20997365-20997387 TGGCACTGCCAAGGGGGGCAAGG + Intronic
1067278508 10:44854347-44854369 TGGCACTGTGATAGCAGGCAGGG + Intergenic
1069806975 10:71132261-71132283 TGGGACTCCCAAAGCGGGCAAGG - Intergenic
1070620027 10:78002257-78002279 AGGCACTGCCAGCGTGGTCACGG + Exonic
1070646877 10:78207993-78208015 TGGGTCTCCCAGAGTGGGCATGG + Intergenic
1070764891 10:79050702-79050724 TGGCACTCCAAGAGAGGGCATGG - Intergenic
1072373100 10:94785933-94785955 TGGCATTTACATAGTGGGCAGGG - Intronic
1073348657 10:102803201-102803223 TGCCACTGCCACAGTGGAAAAGG - Intronic
1073924544 10:108499901-108499923 TTGCACTGCCATGATGAGCAAGG - Intergenic
1075184540 10:120243872-120243894 TGGCACCCCCAGAGAGGGCATGG - Intergenic
1075320514 10:121487959-121487981 TGGCAGTAACACAGTGGGCAGGG - Intronic
1076880806 10:133238247-133238269 CGGCCCTGACCTAGTGGGCAGGG - Intronic
1079273691 11:19013476-19013498 TTCCACTGCCAGAGTGGGTAGGG + Intergenic
1081611419 11:44565489-44565511 GGGTACGGCCATAGTGGGCGGGG + Intronic
1081663567 11:44903274-44903296 TGGGACTGGCATAGTTGGAAAGG + Intronic
1081984451 11:47291386-47291408 AGGCACTGCCTTTGTGGGAACGG - Intronic
1082926315 11:58551103-58551125 TGGCATTGCCACAGTGCCCAAGG - Exonic
1084381940 11:68818143-68818165 TGTCACTGACAGAGTGGGCCAGG - Intronic
1084971027 11:72772135-72772157 TGGCACTGCCATAGTGGGCATGG + Intronic
1084971038 11:72772171-72772193 CGGTGCTGCCATAGGGGGCATGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971055 11:72772248-72772270 CGGTGCTGCCATAGTGGGCACGG + Intronic
1084971064 11:72772284-72772306 CGGTGCTGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1084971083 11:72772362-72772384 TGGCGCTGCCATAGGGGGCATGG + Intronic
1085008092 11:73113845-73113867 TGGTACTGCCTTAGTGGTCTTGG + Intronic
1085317285 11:75553289-75553311 TGGCTCTGCCATGGTGCCCATGG - Intergenic
1085355451 11:75832527-75832549 TGGCACACCCAGAGAGGGCATGG - Intronic
1088435000 11:109802472-109802494 TGGCACTGCTAGAGAGAGCATGG - Intergenic
1090226815 11:125076661-125076683 TGGGACTGCCAGAGGGGACACGG + Intronic
1090266350 11:125355629-125355651 TATCTCTGCCATAGTGGGCCTGG + Intronic
1091180034 11:133596126-133596148 TGGCACTGCCATAGTATACTGGG + Intergenic
1099016261 12:77347597-77347619 TGGCACATCCATGGAGGGCATGG - Intergenic
1099633952 12:85188648-85188670 TGGCATTGCTGTAGTGGGAAGGG - Intronic
1100857192 12:98767909-98767931 TGGGACTGCCAGAGAGGGAATGG - Intronic
1106052867 13:26207831-26207853 TGGGACTGCCTTAGCTGGCATGG - Intronic
1106911074 13:34464265-34464287 TGGCACAACCATAGGAGGCAGGG - Intergenic
1108428164 13:50326156-50326178 TGGTACTGCCTCAGTGGGCAAGG - Intronic
1109660922 13:65459024-65459046 TGGAGCTGCCATATTGGACATGG + Intergenic
1110488408 13:76073130-76073152 TGGCACGTCCAGAGGGGGCATGG + Intergenic
1113364318 13:109661952-109661974 TGGCACAGCATTACTGGGCAGGG + Intergenic
1117258233 14:54002171-54002193 TGGCACTGCCAAAGAAGGAAAGG - Intergenic
1118318780 14:64741467-64741489 TGGCACTGCCATGCCGGGCCAGG - Exonic
1119750842 14:77076306-77076328 TGGCTCTGCCATGGCGGGGAGGG - Intergenic
1120174441 14:81278113-81278135 TTGCACTGCCAAAGTGATCAGGG + Exonic
1121164187 14:91775991-91776013 TGGCACTCCCCGAGTGGGCAGGG + Intronic
1122497502 14:102169288-102169310 TGGCAGTGCCTTTCTGGGCAGGG - Intronic
1122733299 14:103818780-103818802 TGGCACTGACAAAATGGACAGGG + Intronic
1125596557 15:40890993-40891015 TGGCAGTGACATAATGGTCAAGG - Intergenic
1126053184 15:44706514-44706536 AGGCACTGCCATGGTGGTCTTGG + Intronic
1126749542 15:51862874-51862896 TGGCAGTGCCATGATGTGCAGGG - Exonic
1128092833 15:64930725-64930747 TGGCACTGACCCAGTGTGCATGG + Intronic
1133533306 16:6675523-6675545 AGGCCCTGCCACAGTAGGCATGG + Intronic
1134768755 16:16785499-16785521 TGGTACTGCGATAGTGGGTGGGG + Intergenic
1135313216 16:21421718-21421740 TGGCACTCCCATTGTGTGGAAGG - Intronic
1135366140 16:21853996-21854018 TGGCACTCCCATTGTGTGGAAGG - Intronic
1135396147 16:22133001-22133023 TGTGACTGGCATAGCGGGCAGGG - Exonic
1135445675 16:22517168-22517190 TGGCACTCCCATTGTGTGGAAGG + Intronic
1136255428 16:29035804-29035826 TGGCACTCCCATTGTACGCAAGG + Intergenic
1136323327 16:29502223-29502245 TGGCACTCCCATTGTGTGGAAGG - Intronic
1136438012 16:30242192-30242214 TGGCACTCCCATTGTGTGGAAGG - Intronic
1138348072 16:56332066-56332088 TGGCACTGGCACAGTGGGGGTGG - Intronic
1139007432 16:62590292-62590314 TGGCACTGGTATGGTGGGCTAGG + Intergenic
1140365105 16:74375108-74375130 TGGCACTCCCATTGTACGCAAGG + Intergenic
1142102994 16:88285478-88285500 TGCCACAGCCAGCGTGGGCAGGG + Intergenic
1144782931 17:17816926-17816948 TGGCCCCGGCAGAGTGGGCAGGG - Intronic
1144967793 17:19089018-19089040 TGGCCCTGCCATAGGGAGCCCGG + Intergenic
1144980123 17:19163045-19163067 TGGCCCTGCCATAGGGAGCCCGG - Intergenic
1144988099 17:19215187-19215209 TGGCCCTGCCATAGGGAGCCCGG + Intergenic
1147456022 17:40538643-40538665 TGGCTGTGCCAGTGTGGGCATGG - Intergenic
1148621980 17:49041684-49041706 TCCCACTGCCATATGGGGCAGGG + Intronic
1149232803 17:54554804-54554826 TAGCTCTGGCATAGTGGGGAAGG + Intergenic
1149516916 17:57287810-57287832 TGGCAATGCCATTGTGCGTAAGG + Intronic
1150725729 17:67649925-67649947 TGGCACACCCAGAGGGGGCACGG - Intronic
1151904107 17:77036400-77036422 TGGCACGTCCAGAGAGGGCAGGG - Intergenic
1153754239 18:8263789-8263811 TGGCACATCCACAGAGGGCATGG + Intronic
1153784111 18:8518956-8518978 TGCCACTTCCAGAGTGGCCATGG - Intergenic
1154365847 18:13708300-13708322 TGGCACACCCAGAGAGGGCATGG - Intronic
1155476018 18:26236548-26236570 TTGCCCTGGCATAGTGGACATGG + Intronic
1156474179 18:37395162-37395184 TGGCAGAGCCTTAGTGGACAGGG + Intronic
1158214861 18:55089640-55089662 TGGCCATGCCATTGTGGGCTAGG - Intergenic
1158628384 18:59091109-59091131 TGACACCGCCATCTTGGGCATGG + Intergenic
1159721583 18:71898486-71898508 TGGCATTGCTACGGTGGGCAAGG + Intergenic
1160066780 18:75583094-75583116 CGGCACTGCCCTGGTGGGCCTGG - Intergenic
1161443413 19:4304992-4305014 TGGGACTGGGATACTGGGCAGGG - Intronic
1162452660 19:10764259-10764281 TGGCGCTGCCATCGTGGCCATGG + Intronic
1163292065 19:16385373-16385395 TTGCCATGCCAGAGTGGGCAGGG - Intronic
1167427073 19:49434800-49434822 TGACACAGCCATAGTGGACGCGG + Exonic
1167766726 19:51488216-51488238 TGGCCATGACATAGTGGGGAGGG + Intronic
927849326 2:26489124-26489146 AGGAACTGCCACAGTGGGAAGGG + Intronic
928108893 2:28490588-28490610 TGCCACTGCCACGGTGGGGAAGG + Intronic
928436569 2:31258326-31258348 AGGCACTGCCACAGGGGGTAGGG - Intronic
929536967 2:42789930-42789952 TGGCCCTGCCACAGAGGGCAGGG + Intronic
929811340 2:45191431-45191453 TTGCCCGGCCAGAGTGGGCAGGG + Intergenic
929949947 2:46401167-46401189 TGGCACTGCTGAAGAGGGCATGG - Intergenic
935141761 2:100359438-100359460 TGGCACATCCAGAGAGGGCATGG - Intergenic
936458448 2:112693240-112693262 AGTCACTGGCAGAGTGGGCAGGG + Intergenic
945861063 2:215122938-215122960 TGGGAATGCCATAGTAGGGAAGG - Intronic
946632931 2:221690853-221690875 TGGCAGAGCCAAAGTAGGCAGGG + Intergenic
948296388 2:236863812-236863834 TGGCACTGCCGTGGGGGACAGGG + Intergenic
1168819164 20:761723-761745 TGGCCCTGCAAGAGGGGGCAGGG + Exonic
1175975239 20:62707663-62707685 TGGCACTGGCATAGGTGGCCAGG - Intergenic
1178786038 21:35654416-35654438 TGGTGCTACCATAGTGGTCATGG - Intronic
1180147747 21:45930634-45930656 TGGCACTGCCTCTGTGGGGAGGG - Intronic
1181278023 22:21699021-21699043 TGCCGCTGCCCTGGTGGGCATGG - Exonic
1182458728 22:30469611-30469633 AGGCAATGCCTTAGGGGGCAGGG + Intronic
1182647143 22:31819346-31819368 TGGGATGGCCAAAGTGGGCATGG - Intronic
1184366318 22:44053881-44053903 TGGCACGCCCAGAGAGGGCATGG - Intronic
1184389050 22:44192576-44192598 TGGCCATGCCCCAGTGGGCAGGG - Intronic
1184630451 22:45774170-45774192 TGGCCCTGCCTTAGTAGGCATGG + Intronic
1185129250 22:49028318-49028340 TGGCAGAGCCAGAGTGGACAAGG + Intergenic
949873501 3:8608660-8608682 TGGGACTGCCAGGGTGGCCAGGG + Intergenic
950416732 3:12873142-12873164 TGGCACTCCCAGAGGGGACACGG - Intergenic
953197824 3:40750619-40750641 TGACAGTCCCAAAGTGGGCAGGG + Intergenic
953215016 3:40909852-40909874 TGCCACTGCCATAGTGGGCCAGG + Intergenic
954165452 3:48753742-48753764 TGGCACTGGGATATTGGGGATGG - Intronic
954387482 3:50251906-50251928 TGGCAGGGCCACAGTGGTCAAGG - Intronic
954616575 3:51971738-51971760 TGGGACTGCCACCCTGGGCAGGG - Intronic
956014621 3:64868544-64868566 TGGGAGTGCTATAGTGGGCCAGG + Intergenic
957618738 3:82567441-82567463 TGGCTCTCCCTTGGTGGGCATGG + Intergenic
958944730 3:100350387-100350409 TGGGACTGCCACCATGGGCATGG + Intronic
964074106 3:152672205-152672227 TTGCACTGCCAAACTGGGAAGGG + Intergenic
968224412 3:196964643-196964665 TGGCAGTGCTAGACTGGGCACGG - Intronic
968894110 4:3388719-3388741 TGTCACTGCCGTGGAGGGCAGGG - Intronic
969946686 4:10790553-10790575 AGGCACTGCCATTGTGCCCATGG + Intergenic
970114929 4:12684270-12684292 TGGCCCTGCCAAAATGGGAAGGG - Intergenic
973045940 4:45534533-45534555 TTGCATTGGCATAGTGGACATGG - Intergenic
978920560 4:114178023-114178045 GGGCACTGCTATAGTGCCCATGG - Intergenic
980822187 4:138032443-138032465 TGGCATTGGAATAGTGGGGAAGG + Intergenic
981311159 4:143299278-143299300 TGGCAGAGCCAAGGTGGGCAGGG - Intergenic
981434082 4:144699383-144699405 TGGCACACCCAGAGAGGGCAGGG - Intronic
981633937 4:146853870-146853892 TTGCACTGACAGAGTGGCCAAGG + Intronic
982432577 4:155339455-155339477 TGGCACTTCCATGGTTGGAATGG + Intergenic
982665039 4:158251315-158251337 TGGCTCTGCCAATGAGGGCATGG - Intronic
990473689 5:56141624-56141646 TGGCACACCCAGAGAGGGCACGG + Intronic
990809076 5:59701943-59701965 TGGCACTAACATAGAGGTCATGG + Intronic
991075741 5:62535083-62535105 TGTCAGTGCCATCCTGGGCATGG + Intronic
992689599 5:79229822-79229844 TGCCACTGCCATTGTTGTCATGG + Intronic
994017913 5:94989894-94989916 TGTCACAGCCAGAGAGGGCATGG + Intronic
996353256 5:122569155-122569177 TGGCACTGGAAAAGTAGGCAGGG + Intergenic
997044516 5:130298259-130298281 TCTTCCTGCCATAGTGGGCAAGG + Intergenic
1003370077 6:5516117-5516139 TGGCACTGCCACAGTCTGGAAGG - Intronic
1003522581 6:6870977-6870999 TGGAACTGCAATAGTGGTCCTGG - Intergenic
1005358584 6:25008843-25008865 TGGCACTTCCCTAGAGGGAATGG - Intronic
1005975443 6:30794664-30794686 TGGCACTGCCCAGCTGGGCATGG - Intergenic
1009404890 6:63300118-63300140 GGGCAGGGCCATAGTGGGCTTGG - Intronic
1010238130 6:73591960-73591982 TGGCACGCCCAGAGAGGGCATGG - Intergenic
1010442860 6:75918548-75918570 TGGCACTGCCATACTGGAGAAGG + Intronic
1010741615 6:79512392-79512414 TGGCACTGGTATAATGGGCATGG + Intronic
1011744567 6:90397039-90397061 TGGCCCAGGCATGGTGGGCAGGG + Intergenic
1015041836 6:128730036-128730058 TCACACTGACAAAGTGGGCAAGG - Intergenic
1018498146 6:164371184-164371206 TGGACCTGAAATAGTGGGCATGG - Intergenic
1022227363 7:28377011-28377033 AGGCATTGCCACAGAGGGCATGG - Intronic
1022537342 7:31106398-31106420 TGGCACTGCCAGCCTGGGAAGGG + Intronic
1022552265 7:31252024-31252046 TGGCAGTGCCACAGGAGGCAAGG + Intergenic
1029043431 7:97601387-97601409 TGGCACACCCACAGTGGGAAGGG + Intergenic
1034347008 7:150392457-150392479 TGGCTCTTCCATGGTGGGCCTGG - Intronic
1036730457 8:11258641-11258663 TGGCCCAGACACAGTGGGCATGG + Intergenic
1039536932 8:38324908-38324930 TGGCATGGCCAGAGAGGGCATGG + Intronic
1039597868 8:38807098-38807120 TGGCATTCCCAGAGAGGGCATGG - Intronic
1041674161 8:60521275-60521297 AGGCACCGCCAGAGTGGGCATGG + Intronic
1043088017 8:75861076-75861098 TGGCACTTTCAGAATGGGCAAGG - Intergenic
1043484999 8:80690587-80690609 TAGCACTGCCAAAGTGAGAAAGG + Intronic
1044030776 8:87233758-87233780 TGCCACAGCCAAACTGGGCATGG - Intronic
1045149010 8:99381866-99381888 TGACAATGCCATAATGGGAATGG - Intronic
1048239600 8:132728114-132728136 TTGCACTACCATAGTGGGATGGG + Intronic
1049256052 8:141614457-141614479 TGGTACAGCCAGAGTGGACAAGG + Intergenic
1049864072 8:144922299-144922321 TGGCAGCACCAGAGTGGGCAGGG + Intergenic
1051915099 9:22198575-22198597 TGGAACTGCCCAAGAGGGCATGG + Intergenic
1052904144 9:33818308-33818330 TGGAACTGCCCCAGAGGGCAGGG + Intronic
1055193521 9:73557747-73557769 TGGCACAGTCATAGTAGGCAGGG - Intergenic
1056984288 9:91346962-91346984 TGGCACTCCTAAAGAGGGCATGG - Intronic
1060670634 9:125466335-125466357 AAGCACTGCCATAGGGGACAGGG + Intronic
1061318959 9:129815752-129815774 TGGCACTGCCATTGAAGGGAAGG - Intronic
1062005133 9:134235144-134235166 TGGCACTGCCATGGATGGCCAGG + Intergenic
1062712594 9:137984758-137984780 TGTCACTGCCATCGTCAGCAAGG - Intronic
1189219157 X:39356278-39356300 TGTCTCTGCCAGTGTGGGCAGGG + Intergenic
1193724792 X:85025950-85025972 TGGCACTGCCATAGTGTGTGGGG + Intronic
1197170589 X:123429505-123429527 TGGGACTGCCATAGTAGTGAGGG - Intronic
1199538488 X:148930791-148930813 TAGCACTGCCTTAGTGGCCATGG - Intronic
1202119564 Y:21509294-21509316 TGGCACTGAAGAAGTGGGCAGGG + Intergenic
1202122016 Y:21532834-21532856 TGGCACTGAAGAAGTGGGCAGGG + Intronic
1202156990 Y:21896548-21896570 TGGCACTGAAGAAGTGGGCAGGG - Intronic
1202159436 Y:21920089-21920111 TGGCACTGAAGAAGTGGGCAGGG - Intergenic
1202185884 Y:22185004-22185026 TGGCACTGAAGAAGTGGGCAGGG - Intergenic
1202205476 Y:22401392-22401414 TGGCACTGAAGAAGTGGGCAGGG + Intronic