ID: 1084971030

View in Genome Browser
Species Human (GRCh38)
Location 11:72772162-72772184
Sequence CTATGGCAGCACCGGGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 3, 1: 1, 2: 6, 3: 19, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084971030_1084971043 23 Left 1084971030 11:72772162-72772184 CCCTGTGCCCGGTGCTGCCATAG 0: 3
1: 1
2: 6
3: 19
4: 153
Right 1084971043 11:72772208-72772230 AGCGCTGCCATAGCCATAGTGGG 0: 1
1: 0
2: 1
3: 3
4: 44
1084971030_1084971044 28 Left 1084971030 11:72772162-72772184 CCCTGTGCCCGGTGCTGCCATAG 0: 3
1: 1
2: 6
3: 19
4: 153
Right 1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG 0: 1
1: 1
2: 0
3: 11
4: 104
1084971030_1084971042 22 Left 1084971030 11:72772162-72772184 CCCTGTGCCCGGTGCTGCCATAG 0: 3
1: 1
2: 6
3: 19
4: 153
Right 1084971042 11:72772207-72772229 CAGCGCTGCCATAGCCATAGTGG 0: 1
1: 0
2: 2
3: 5
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084971030 Original CRISPR CTATGGCAGCACCGGGCACA GGG (reversed) Intronic
900475961 1:2876521-2876543 CACTGGCAGCAGCTGGCACAGGG - Intergenic
900510643 1:3058734-3058756 CTATGGCTGTCCCTGGCACACGG + Intergenic
901137900 1:7009537-7009559 CTACGGCAACACAGGGCACCTGG - Intronic
904708617 1:32411462-32411484 CTCTGGCAGTACAGGGCAGATGG - Intergenic
906001686 1:42431799-42431821 CTGTGGGAGCACAGTGCACAGGG - Intronic
906240039 1:44237170-44237192 CTATGGTAGAACCAGGAACACGG + Intronic
907525302 1:55050424-55050446 CCAGTGTAGCACCGGGCACATGG + Intronic
907880750 1:58547014-58547036 CTACGGCAGTACCGGCCAAAAGG + Intergenic
910933186 1:92462878-92462900 CTATGGCAGCAAAGGGCACCAGG + Intergenic
912385695 1:109270238-109270260 CTAGTGCAGCACCTGGCCCAGGG + Intronic
915083382 1:153367304-153367326 CTAACACAGCACTGGGCACATGG - Intergenic
918346212 1:183609569-183609591 GTCTGGCAGGCCCGGGCACAGGG + Intergenic
919927422 1:202199477-202199499 CTCTGGCAGCAGCGGGCATGGGG + Intronic
922332941 1:224593783-224593805 CTATGGATGCACCCAGCACAAGG - Intronic
922533051 1:226359018-226359040 CTATGCCCGCACCAGGGACAAGG + Intergenic
1064326190 10:14353723-14353745 CCATGGCTGCATCTGGCACATGG - Intronic
1072604815 10:96971575-96971597 CTAATGCAGCACCAGGGACAGGG + Intronic
1074773595 10:116749570-116749592 CTAGCGCAGCACCTGGCACATGG + Intergenic
1077208365 11:1354987-1355009 CAATGGCACCACAGGGCACCAGG - Intergenic
1080759678 11:35236491-35236513 CTTTGGCTCCACCAGGCACAGGG - Intergenic
1081695101 11:45104304-45104326 GCAGGGCAGCACAGGGCACAGGG + Intronic
1082863954 11:57881494-57881516 CTAGGGCAGCTCCTTGCACATGG - Intergenic
1084971022 11:72772126-72772148 CTATGGCAGTGCCAGGCACAGGG - Intronic
1084971030 11:72772162-72772184 CTATGGCAGCACCGGGCACAGGG - Intronic
1084971040 11:72772198-72772220 CTATGGCAGCGCTGTGCACAGGG - Intronic
1084971049 11:72772239-72772261 CTATGGCAGCACCGGGCACAGGG - Intronic
1084971058 11:72772275-72772297 CTATGGCAGCACCGGGCACAGGG - Intronic
1084971066 11:72772311-72772333 CTATGGCAGCACTGGGCACAGGG - Intronic
1084971076 11:72772353-72772375 CTATGGCAGCGCCAGGCACAGGG - Intronic
1084971085 11:72772389-72772411 CTATGACAACGCTGGGCACAGGG - Intronic
1085887427 11:80536772-80536794 TGATGGAAGCACCTGGCACAGGG + Intergenic
1085893038 11:80603642-80603664 CTAGCTCAGCACCTGGCACATGG - Intergenic
1086408225 11:86517798-86517820 CTAGCGTAGCACCAGGCACATGG + Intronic
1087168908 11:95030896-95030918 CCATGGGAACACCAGGCACAAGG - Intergenic
1091651557 12:2313996-2314018 CTATGTGGGCACAGGGCACACGG + Intronic
1094263825 12:28531774-28531796 CTAGAGCAGTACCTGGCACATGG - Intronic
1094446043 12:30531658-30531680 CTATGTCTTCACCCGGCACAGGG + Intergenic
1096531192 12:52243913-52243935 CTCTTCCAGCACCTGGCACATGG + Intronic
1097187508 12:57203650-57203672 CTATGGCAGTGCCTGGTACATGG - Intronic
1097486697 12:60212554-60212576 CCAAGGCTGCACAGGGCACAGGG - Intergenic
1097922528 12:65091865-65091887 CTAGAGCAGAACCTGGCACATGG - Intronic
1100036422 12:90258005-90258027 CTAGGGCAGTGCCTGGCACATGG + Intergenic
1101614264 12:106320645-106320667 CCATGGCAGCTCAGGGCACAAGG - Intronic
1101842807 12:108340239-108340261 CCATGGAAGCACTTGGCACAGGG - Intergenic
1102570088 12:113822275-113822297 CTGTGCCAGCACCAGGCAGAGGG - Intronic
1103648950 12:122418201-122418223 CTAGAACAGCACCTGGCACACGG + Intronic
1113405015 13:110031006-110031028 CTCTAGCATCAACGGGCACAGGG - Intergenic
1114495438 14:23128496-23128518 CTCTGGCTGCCACGGGCACATGG - Intronic
1115191931 14:30755362-30755384 CTATGGGAGCACAGAGCTCACGG - Intergenic
1125744346 15:41988486-41988508 TTAGGGCAGCACCTGGCACATGG + Intronic
1126137077 15:45402761-45402783 CTCTCGCAACACCGGCCACACGG - Exonic
1128451883 15:67810673-67810695 CTATCCCAGCACCTGGCCCAGGG + Intergenic
1130534161 15:84771216-84771238 CTATGGCAGCACTTCTCACAGGG - Intronic
1133110342 16:3544350-3544372 CTTTGGGTGCACGGGGCACAGGG + Intronic
1134803984 16:17109083-17109105 CCAGTGCAGCACCAGGCACAGGG - Intronic
1135214450 16:20552850-20552872 CTATGGCAGTTCCCGTCACAAGG - Intronic
1135651022 16:24206707-24206729 CAATGGCAGCACCTGTCCCATGG + Intronic
1136394909 16:29987457-29987479 CTATGGCAGCGGGGGGCAGATGG + Exonic
1138653951 16:58479704-58479726 CTATGACAGTGCTGGGCACAGGG - Intronic
1141329100 16:83091775-83091797 CTATAGCAGTGCCTGGCACATGG + Intronic
1141532657 16:84657562-84657584 CTTGGGCAGCAGCGAGCACACGG - Exonic
1141983102 16:87561968-87561990 CACTGGCAGCGCTGGGCACATGG + Intergenic
1142304365 16:89277331-89277353 CTCAGGCAGCACCTGGCACCTGG + Intronic
1142612472 17:1116790-1116812 CTAGCACAGCACCTGGCACACGG + Intronic
1145275145 17:21424726-21424748 CTGTGGCTTCACCTGGCACATGG + Intergenic
1145312999 17:21710625-21710647 CTGTGGCAGCACCTGGCACAGGG + Intergenic
1145711424 17:26982430-26982452 CTATTGCAGCACGTGGCACATGG + Intergenic
1146289210 17:31596162-31596184 CTATGGCAGGGCAGGGCAGAGGG - Intergenic
1146628585 17:34454018-34454040 CATGGGCAGCACCAGGCACAAGG - Intergenic
1146907708 17:36628597-36628619 CTTCTGCAGCACCTGGCACAGGG - Intergenic
1147441355 17:40449212-40449234 CTAGGGCTGCATGGGGCACAGGG - Intronic
1151723768 17:75873235-75873257 CTAGGGCAGCAGAGGGCACTGGG + Intergenic
1154175880 18:12087099-12087121 ATATGGCAGCAGCAGGGACAGGG - Intergenic
1158888446 18:61850907-61850929 CTAGTGCAGCTCTGGGCACACGG + Intronic
1159440244 18:68469425-68469447 CTATGGAAGCAAAGGGAACAGGG + Intergenic
1159816546 18:73080656-73080678 TTATGGCAGCACTGGCCACAGGG + Intergenic
1159949682 18:74473842-74473864 CTTTGGCAGCACTGGGCACATGG + Intergenic
1164214160 19:23129290-23129312 CTGTGGCTTCTCCGGGCACATGG - Intronic
1165062200 19:33210423-33210445 CTCTGGCAGCACCCGGCACAGGG + Intronic
1166347862 19:42177377-42177399 CCATGGCAACCCCGGGCCCAAGG + Intronic
1167257802 19:48441880-48441902 CTATGGCATCGCCCTGCACAAGG + Exonic
1167750605 19:51377647-51377669 CAAAGACAGCACCTGGCACATGG - Intergenic
929533811 2:42768110-42768132 CTGTTGCAGCGGCGGGCACAGGG - Intronic
935023908 2:99257979-99258001 CTAGGGTAGCTCAGGGCACAAGG - Intronic
937999010 2:127717202-127717224 CTAGGGCAGCAGGGAGCACAAGG - Exonic
938186220 2:129234340-129234362 CTATGGCAGTACAGTGCATAGGG + Intergenic
944259109 2:197656959-197656981 ACATGGCAGCACTGGGCCCAGGG - Intronic
947330318 2:229022265-229022287 CTATGGCAGGACCAGGCACGTGG - Intronic
947776091 2:232710483-232710505 CTAGTCCAGCACCTGGCACAAGG - Intronic
947837252 2:233184701-233184723 CTAGGGCTGCACAGGCCACAGGG - Intronic
948990438 2:241551311-241551333 CTATGCCAGCATCGGTCACATGG + Intergenic
1169292892 20:4367886-4367908 CTCCAGCAGCACAGGGCACAGGG - Intergenic
1170404040 20:16017868-16017890 CCATGACAGCACCAGCCACATGG + Intronic
1170569513 20:17625010-17625032 CTCTGGCAGAGCCTGGCACAGGG + Intronic
1170904768 20:20503440-20503462 CAATGGCAGCACCGGGCAGACGG - Exonic
1172509648 20:35491439-35491461 ATATGTCAGCACCTAGCACAGGG - Intronic
1172600286 20:36178411-36178433 CAGTGGCAGCTCCGGGCACTGGG + Intronic
1172630543 20:36375473-36375495 CTAGTGCAGCACCTGGCACATGG - Intronic
1173340921 20:42152080-42152102 CTATGGGAGCACCATGCATACGG + Intronic
1173553562 20:43949786-43949808 CAATGACAGAAGCGGGCACAGGG - Intronic
1174368010 20:50068058-50068080 CTAGGGCAGTGCTGGGCACACGG + Intergenic
1174394387 20:50237657-50237679 CTTTGGCCACACCGGGGACAGGG - Intergenic
1174522795 20:51144679-51144701 CTATGGCAGGGCCGGGGGCAGGG + Intergenic
1175256695 20:57652241-57652263 CTACGGCAGCGGCGGGCGCATGG - Exonic
1175387944 20:58609071-58609093 CTGGTGCAGCACCTGGCACATGG + Intergenic
1175667492 20:60872836-60872858 CTAAGGCAGGAGAGGGCACACGG - Intergenic
1176172608 20:63702811-63702833 CTGTGCCAGCACCTCGCACAGGG + Intronic
1177339727 21:19783666-19783688 CTATGGCTTCTCCAGGCACACGG + Intergenic
1177624770 21:23645960-23645982 CTATGGCTGGACCAGGCATACGG + Intergenic
1180233799 21:46444149-46444171 AGATGGCAGCACCGGGCTCTCGG - Intronic
1180824089 22:18851246-18851268 CCATGGCAGCAGCAGGCTCAGGG - Intronic
1180954295 22:19734692-19734714 CCATGGCAGCACACGGCACCTGG - Intergenic
1181772777 22:25138870-25138892 TCATGGAAGCACCTGGCACATGG - Intronic
1183149898 22:36028919-36028941 CTGTGGCAGCACCGGGAAGGCGG + Intergenic
1184093239 22:42303253-42303275 GCATGGCAGAACCTGGCACAAGG - Intronic
949112467 3:278545-278567 ATATGGCAGCACCTGTCACCAGG + Intronic
950525875 3:13522933-13522955 CTCAGGCAGCACCGGGCACATGG + Intergenic
952425290 3:33169114-33169136 CTATGGTAGAAAGGGGCACAAGG + Intronic
952962220 3:38599349-38599371 GTATGGCAGCATCAGGCTCAGGG - Intronic
956235159 3:67061242-67061264 CTATGGCAGCACTGGGGAGATGG + Intergenic
956432545 3:69201788-69201810 CTCAGACAGCACCTGGCACAGGG + Intronic
962475648 3:135752939-135752961 CTAGGACAGCCCCAGGCACAGGG - Intergenic
962655689 3:137542238-137542260 CTGTGGCAGCACAGGGTGCAGGG + Intergenic
968134193 3:196209580-196209602 CCACGGCATCACAGGGCACAAGG + Intronic
968577666 4:1375536-1375558 CTGTGGCAGCGCCGGGCAGGGGG - Intronic
968620557 4:1601775-1601797 CTATGGCAGGGCCTGGCACGTGG + Intergenic
968623427 4:1614915-1614937 GCATTTCAGCACCGGGCACAGGG + Intergenic
969785889 4:9456717-9456739 CTATGACAGCAAAGGTCACAGGG - Intergenic
972474623 4:39438697-39438719 CTAGGGCAGTGCTGGGCACATGG + Intronic
975827884 4:78338836-78338858 CCATGGCACCACCAGCCACAGGG - Intronic
978761346 4:112358350-112358372 CTATGCCAGCACCGGCCCCCTGG + Intronic
985444204 4:190012047-190012069 CTAGGGCTGAACCGGGCCCAGGG + Intergenic
985679494 5:1248574-1248596 CCATGGCTGCATCAGGCACATGG - Intergenic
986897682 5:12390083-12390105 CTATAGCAGTGTCGGGCACATGG - Intergenic
991971533 5:72146493-72146515 TTAGAGCAGCACCTGGCACATGG - Intronic
993689477 5:90981640-90981662 TTCTGGCAGCTCAGGGCACAAGG - Intronic
994913204 5:105940354-105940376 CTATGCCAGCAACCAGCACAGGG + Intergenic
995992169 5:118253910-118253932 ATATGTCAGAAGCGGGCACAGGG - Intergenic
996345781 5:122486927-122486949 CAATGGCAGCCCCAGACACAAGG - Intergenic
1000097968 5:157987547-157987569 CACTGGCAGCACCAGGCCCAGGG - Intergenic
1000731855 5:164844528-164844550 CTATGTCAGCAAAAGGCACAGGG - Intergenic
1001971294 5:175956928-175956950 CTAGCACAGCACCTGGCACAAGG - Intronic
1002246148 5:177886849-177886871 CTAGCACAGCACCTGGCACAAGG + Intergenic
1005168961 6:22959019-22959041 CTATGGCAGAGCTGAGCACATGG - Intergenic
1006554300 6:34852466-34852488 CTATGGTAGAACAGGGCACCAGG - Intronic
1006614594 6:35317880-35317902 GTCTGGCAGCACCTGGCACAGGG - Exonic
1007060416 6:38935114-38935136 CTATGGGAGCACCAGGTACCTGG - Intronic
1007513443 6:42392176-42392198 CCAGGGCAGCACCTGGCACATGG + Intronic
1011246389 6:85325498-85325520 GTATGGCAGCACCCACCACATGG + Intergenic
1013627344 6:111951104-111951126 CTATGGCAGCAGAGTGCAAAGGG - Intergenic
1014710421 6:124800185-124800207 CTAAAGCAGAACCGGGCATAAGG - Intronic
1017209044 6:151834831-151834853 CTGTGGCAGCACCTGGAACTTGG + Intronic
1020002945 7:4765909-4765931 CTAGGGCAGCAGCTGGCTCAGGG + Exonic
1020311250 7:6870447-6870469 CTATGACAGCAAGGGTCACAGGG + Intergenic
1020930436 7:14386546-14386568 CTATTTCAGCAACTGGCACATGG - Intronic
1022301522 7:29106632-29106654 CTATGGCAGAACAGGGAAGAGGG + Intronic
1023915128 7:44582798-44582820 CTATGGCAGCACTGGGCTTTTGG - Intergenic
1024536964 7:50444034-50444056 CTATGGCAGCATTGGGCAGTAGG - Intergenic
1032495111 7:132355576-132355598 CTAGGGCAGTGCCAGGCACATGG - Intronic
1034684268 7:152956206-152956228 CTCTGGGGGCGCCGGGCACACGG + Intergenic
1035231991 7:157470709-157470731 GCAGGCCAGCACCGGGCACACGG - Intergenic
1035465181 7:159070294-159070316 CAGTGGCAGCACCGGGCCCTGGG - Intronic
1036282990 8:7417370-7417392 CTCTGGCAGCACCGGGAGCATGG + Intergenic
1036338479 8:7894149-7894171 CTCTGGCAGCACCGGGAGCATGG - Intergenic
1036903249 8:12687613-12687635 CTATGACAGCAAAGGTCACAGGG + Intergenic
1038782446 8:30579868-30579890 CTATGGCAGAACCAGGCACCAGG + Intronic
1041233837 8:55778866-55778888 CTATTGCAGCACCTGACACTCGG - Intronic
1048901739 8:139044479-139044501 AAATGGCAGCACCCAGCACAGGG + Intergenic
1049454469 8:142680117-142680139 CTATAGGAGCACAGGGCCCAGGG + Intronic
1049685084 8:143936142-143936164 CCAGGGCAGCACCGGGCTCCAGG + Intronic
1051171943 9:14327506-14327528 GTATGGCAGCACCCAGCCCAAGG - Intronic
1053588555 9:39486619-39486641 ATATAGCAACACCAGGCACAGGG - Intergenic
1056787092 9:89601056-89601078 CTATGTCAGCACAGGGCTCTTGG - Intergenic
1057171032 9:92963241-92963263 CTGCGGCAGCACCTGGCACAGGG + Intronic
1062028479 9:134351330-134351352 CTATGCCAGCAGCGGGCAGAGGG + Intronic
1062346391 9:136117243-136117265 CTAGGGCAGCACTGGGGAAAGGG + Intronic
1188850532 X:35126387-35126409 CTATGTAAGCATCTGGCACAAGG + Intergenic
1189294583 X:39909599-39909621 CAATTGCAGCACCTGGGACAGGG - Intergenic
1194765714 X:97844152-97844174 CTATTGGATCAACGGGCACAGGG - Intergenic
1198262173 X:134974577-134974599 CTATGGCAGGAGAGGGCACTGGG + Intergenic
1198812416 X:140549154-140549176 CTAACACAGCACCTGGCACATGG + Intergenic
1199274591 X:145926296-145926318 CTACAGCAGCACAGGGCACTGGG + Intergenic