ID: 1084971031

View in Genome Browser
Species Human (GRCh38)
Location 11:72772163-72772185
Sequence CCTATGGCAGCACCGGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 2, 2: 6, 3: 11, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084971031_1084971044 27 Left 1084971031 11:72772163-72772185 CCTGTGCCCGGTGCTGCCATAGG 0: 1
1: 2
2: 6
3: 11
4: 144
Right 1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG 0: 1
1: 1
2: 0
3: 11
4: 104
1084971031_1084971043 22 Left 1084971031 11:72772163-72772185 CCTGTGCCCGGTGCTGCCATAGG 0: 1
1: 2
2: 6
3: 11
4: 144
Right 1084971043 11:72772208-72772230 AGCGCTGCCATAGCCATAGTGGG 0: 1
1: 0
2: 1
3: 3
4: 44
1084971031_1084971042 21 Left 1084971031 11:72772163-72772185 CCTGTGCCCGGTGCTGCCATAGG 0: 1
1: 2
2: 6
3: 11
4: 144
Right 1084971042 11:72772207-72772229 CAGCGCTGCCATAGCCATAGTGG 0: 1
1: 0
2: 2
3: 5
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084971031 Original CRISPR CCTATGGCAGCACCGGGCAC AGG (reversed) Intronic
900475962 1:2876522-2876544 CCACTGGCAGCAGCTGGCACAGG - Intergenic
902997432 1:20237666-20237688 CCTAAGGCCACACCGGGCAAGGG + Intergenic
905276924 1:36824443-36824465 CCTCTGGCAGCACAGGGCCTGGG + Intronic
905632782 1:39527928-39527950 CCTATGGCAGCAGGGGGCTCAGG - Intergenic
905769542 1:40628707-40628729 CCTACCACAGCACCTGGCACAGG + Intronic
907579154 1:55556233-55556255 CTGATGTCAGCACCAGGCACTGG - Intergenic
908501379 1:64745849-64745871 CCTATGGCACTCCCGAGCACCGG - Intronic
912250003 1:108001127-108001149 CCTTTGGCAGCCCTGGGAACAGG - Intergenic
912385694 1:109270237-109270259 CCTAGTGCAGCACCTGGCCCAGG + Intronic
915236533 1:154487497-154487519 GAAATGGCAGCACCTGGCACAGG + Intronic
919927421 1:202199476-202199498 GCTCTGGCAGCAGCGGGCATGGG + Intronic
922234371 1:223712372-223712394 CAGATGGCAGCACCGGCCCCGGG + Exonic
924217549 1:241839689-241839711 CCTGTGGCAGCCCTTGGCACAGG + Intergenic
1063134088 10:3201442-3201464 CCTAAGGCAGTACCAGGCAAGGG - Intergenic
1065483626 10:26216807-26216829 CCGATGGCATCTCCGGGCTCTGG + Exonic
1066661416 10:37741045-37741067 CCTAAGGCTGCACCAGGCAAGGG - Intergenic
1068769563 10:60805585-60805607 CCCATGGCAGCACTAGGCTCTGG - Intergenic
1070771673 10:79085898-79085920 CCTGGGGCAGCACCGGGCACTGG + Intronic
1072604814 10:96971574-96971596 CCTAATGCAGCACCAGGGACAGG + Intronic
1073778244 10:106809540-106809562 GCTTTGGCAGCACTGGGCAGAGG + Intronic
1073793866 10:106966786-106966808 CACATGGCAGCTCCTGGCACAGG - Intronic
1078073131 11:8132077-8132099 CCTCTGGCAGCAAAGGGCCCTGG - Intronic
1080759679 11:35236492-35236514 CCTTTGGCTCCACCAGGCACAGG - Intergenic
1083143262 11:60739013-60739035 CCTTTGGCAGCACGGGGCCCTGG - Intronic
1084971023 11:72772127-72772149 ACTATGGCAGTGCCAGGCACAGG - Intronic
1084971031 11:72772163-72772185 CCTATGGCAGCACCGGGCACAGG - Intronic
1084971041 11:72772199-72772221 GCTATGGCAGCGCTGTGCACAGG - Intronic
1084971050 11:72772240-72772262 ACTATGGCAGCACCGGGCACAGG - Intronic
1084971059 11:72772276-72772298 ACTATGGCAGCACCGGGCACAGG - Intronic
1084971067 11:72772312-72772334 GCTATGGCAGCACTGGGCACAGG - Intronic
1084971077 11:72772354-72772376 CCTATGGCAGCGCCAGGCACAGG - Intronic
1085887426 11:80536771-80536793 CTGATGGAAGCACCTGGCACAGG + Intergenic
1090775444 11:129960999-129961021 CCTAGAGCAGCACAGGGTACAGG + Exonic
1094649537 12:32361925-32361947 CAGATGGCAGCAGTGGGCACTGG - Intronic
1097486699 12:60212555-60212577 CCCAAGGCTGCACAGGGCACAGG - Intergenic
1102570089 12:113822276-113822298 CCTGTGCCAGCACCAGGCAGAGG - Intronic
1104450929 12:128867648-128867670 TCCATGGCAGCCCCAGGCACTGG - Intronic
1112323765 13:98429820-98429842 CCTATGGTAGTATCTGGCACAGG - Intronic
1112461216 13:99605559-99605581 AGTATGGCTGGACCGGGCACTGG + Intergenic
1113594136 13:111519452-111519474 CCTGTGGCAGCCCGGGACACAGG + Intergenic
1119329970 14:73786723-73786745 CCCAGGGAAGCACCGGGCAGGGG + Intronic
1119379332 14:74218579-74218601 CCCATGCCAGCCCCAGGCACAGG + Intergenic
1121561481 14:94879432-94879454 CCTATGTCAGCACAGGGCAGTGG + Intergenic
1122997206 14:105271730-105271752 CAGATGGCAGCAGTGGGCACAGG + Intronic
1123411582 15:20065633-20065655 CCTACGGCTGCACCTGGGACAGG - Intergenic
1123520931 15:21072752-21072774 CCTACGGCTGCACCTGGGACAGG - Intergenic
1127693009 15:61415855-61415877 CCTGGGGTAGCACAGGGCACTGG + Intergenic
1128518354 15:68358388-68358410 CCTAAGGCAGCACCTGCCATGGG + Intronic
1130284639 15:82544736-82544758 CCTGTGTCAGCACCAGACACAGG + Intronic
1131423531 15:92326835-92326857 CCTCAGGCAGGACTGGGCACCGG - Intergenic
1132063584 15:98712571-98712593 CCTGTGGCTCCACCGAGCACTGG + Intronic
1133110341 16:3544349-3544371 CCTTTGGGTGCACGGGGCACAGG + Intronic
1134803986 16:17109084-17109106 CCCAGTGCAGCACCAGGCACAGG - Intronic
1136146822 16:28320971-28320993 CCTACCGCCGCACCGGGCACCGG - Exonic
1140974441 16:80045435-80045457 GTGATGGCAGCACAGGGCACAGG - Intergenic
1141178319 16:81735067-81735089 GCTCTGGCAGAACCAGGCACTGG + Intergenic
1141707410 16:85674725-85674747 TCTATGACAGCACAGGGGACAGG + Exonic
1142174564 16:88639232-88639254 CCGGCCGCAGCACCGGGCACTGG - Exonic
1145062047 17:19739624-19739646 CCTCTTGCATCACCGGGGACTGG + Exonic
1145312998 17:21710624-21710646 CCTGTGGCAGCACCTGGCACAGG + Intergenic
1146289211 17:31596163-31596185 CCTATGGCAGGGCAGGGCAGAGG - Intergenic
1147132811 17:38419159-38419181 CCCGTGGCAGCACCGCGCACCGG - Intergenic
1147156412 17:38546520-38546542 CCTGCGGCAGCATCGGGCAACGG - Intronic
1147441356 17:40449213-40449235 CCTAGGGCTGCATGGGGCACAGG - Intronic
1150653065 17:67022472-67022494 CTTCTGGCAGCAGCGGGCTCTGG - Intronic
1151723767 17:75873234-75873256 TCTAGGGCAGCAGAGGGCACTGG + Intergenic
1152586123 17:81190248-81190270 CCTGTGGCAGCAGATGGCACAGG + Intronic
1152595491 17:81235834-81235856 TCTATGGCGGCCCAGGGCACTGG + Intronic
1154448655 18:14457921-14457943 CCTGTGGCTGCACAGGGCCCAGG + Intergenic
1156918332 18:42488007-42488029 CCTACTGCAGAACCTGGCACAGG + Intergenic
1157159058 18:45296266-45296288 CCCATGCCAGGACCCGGCACAGG - Intronic
1159816545 18:73080655-73080677 ATTATGGCAGCACTGGCCACAGG + Intergenic
1160697100 19:489937-489959 CCTCTCTCAGCACCGGGCAGGGG - Intronic
1160975839 19:1792012-1792034 CCTGCTGCAGAACCGGGCACAGG - Exonic
1162456777 19:10789888-10789910 CCTATGGCAGGACTGGGCCAGGG + Intronic
1163512981 19:17747268-17747290 CCTAGGGCAGCCCCGGGATCCGG - Intergenic
1165062199 19:33210422-33210444 GCTCTGGCAGCACCCGGCACAGG + Intronic
1165353501 19:35290425-35290447 GATACGGCAGCACCGGCCACTGG + Intergenic
1166364460 19:42271601-42271623 CCTCAGTCAGCACCAGGCACAGG - Intronic
925539663 2:4952891-4952913 CCTGAGGCTGCACAGGGCACTGG + Intergenic
927172149 2:20379255-20379277 CCTACGGGAGCACCAGGCCCAGG - Intergenic
929533812 2:42768111-42768133 CCTGTTGCAGCGGCGGGCACAGG - Intronic
932489348 2:72110178-72110200 CCTGTGGCAGCACCCGGGAGAGG - Intergenic
932722204 2:74146574-74146596 ATGATGGAAGCACCGGGCACTGG + Intronic
937150620 2:119683296-119683318 CCTAGGACGGCACTGGGCACGGG + Intronic
938186219 2:129234339-129234361 CCTATGGCAGTACAGTGCATAGG + Intergenic
938565745 2:132516782-132516804 CCTAGTGCAGCACCTAGCACAGG + Intronic
944259110 2:197656960-197656982 CACATGGCAGCACTGGGCCCAGG - Intronic
947751386 2:232534517-232534539 CCTATAGCAGCACTGGGGCCAGG + Intronic
947837253 2:233184702-233184724 CCTAGGGCTGCACAGGCCACAGG - Intronic
948893752 2:240918939-240918961 CCTTGGCCAGCACCGGGCCCAGG - Intronic
1169165090 20:3415925-3415947 CCTAAGGCTGCACAGGGCAGTGG + Intergenic
1169195945 20:3682075-3682097 CCTGAGGCTGCACCGGGCACGGG - Exonic
1169292893 20:4367887-4367909 CCTCCAGCAGCACAGGGCACAGG - Intergenic
1172509649 20:35491440-35491462 CATATGTCAGCACCTAGCACAGG - Intronic
1172600285 20:36178410-36178432 GCAGTGGCAGCTCCGGGCACTGG + Intronic
1174394388 20:50237658-50237680 CCTTTGGCCACACCGGGGACAGG - Intergenic
1175136388 20:56827449-56827471 CCTGTGTCAGCACCAGGCAGTGG - Intergenic
1178671469 21:34595113-34595135 CTTACAGCAGCACCTGGCACTGG + Intronic
1180824091 22:18851247-18851269 CCCATGGCAGCAGCAGGCTCAGG - Intronic
1181785272 22:25222150-25222172 GCTTTGGTAGCCCCGGGCACAGG + Intronic
1183245603 22:36691055-36691077 CCTAGGACAGCACCTGGCAATGG + Intronic
1184784095 22:46663493-46663515 CCTATGGCAGCACCTGGCAGGGG - Intronic
951144880 3:19214974-19214996 CCTATGGCAACAGTGGGCACAGG - Intronic
951340802 3:21484498-21484520 CCTTTGTCAGCAGGGGGCACTGG - Intronic
951449401 3:22819375-22819397 CCTAAGGCTGCACAGGGCAGTGG + Intergenic
953855896 3:46498885-46498907 CCTATGGCAGCTCCTGGCCTGGG - Intronic
956432544 3:69201787-69201809 CCTCAGACAGCACCTGGCACAGG + Intronic
962475649 3:135752940-135752962 CCTAGGACAGCCCCAGGCACAGG - Intergenic
968136911 3:196226451-196226473 GCTAGTGCAGCACCTGGCACTGG + Intronic
968462666 4:733095-733117 CCTGAGGCAGCACGGGGCAGGGG - Intronic
968577667 4:1375537-1375559 GCTGTGGCAGCGCCGGGCAGGGG - Intronic
985444203 4:190012046-190012068 CCTAGGGCTGAACCGGGCCCAGG + Intergenic
985709904 5:1422365-1422387 CCTTGGGCAGCACTGGGCAGTGG - Intronic
985710000 5:1422737-1422759 CCTTGGGCAGCACTGGGCAGCGG - Intronic
989225435 5:39022421-39022443 CCGCTGGCAGCACCTGGCAGGGG - Intronic
989821483 5:45799281-45799303 CCTATGGCAGTAAAGGTCACTGG + Intergenic
993580960 5:89660743-89660765 CCTAAGACAGCACAGGGCAATGG - Intergenic
994905686 5:105839038-105839060 CCTCTTGCAGCAACGTGCACTGG - Intergenic
995063410 5:107835656-107835678 ACTATGGCAGAATAGGGCACAGG + Intergenic
996279355 5:121709373-121709395 ATTATGGGAGCACAGGGCACAGG + Intergenic
997229642 5:132233190-132233212 CCTATGGCAGGATCTGGCTCAGG - Intronic
1000097969 5:157987548-157987570 CCACTGGCAGCACCAGGCCCAGG - Intergenic
1000652213 5:163831454-163831476 CCTCAGGCAGCACTGGGCTCTGG + Intergenic
1002810164 6:620870-620892 CCTATGGCAGTACCAGGCACAGG - Intronic
1003688246 6:8326278-8326300 GCCATGCCAGCCCCGGGCACTGG + Intergenic
1004459449 6:15822007-15822029 CCCATGGCAACACCAGTCACAGG + Intergenic
1006614595 6:35317881-35317903 GGTCTGGCAGCACCTGGCACAGG - Exonic
1007810176 6:44480073-44480095 CCTCTGGCAGCAGCCTGCACTGG + Intergenic
1007902251 6:45422897-45422919 GCGAGGGCAGCACCGAGCACAGG - Exonic
1012542619 6:100379655-100379677 CCTATAACAGCACCTGACACAGG - Intergenic
1013627345 6:111951105-111951127 CCTATGGCAGCAGAGTGCAAAGG - Intergenic
1022481892 7:30749688-30749710 CCTCTGGCAGCAGGAGGCACTGG + Intronic
1023220466 7:37916486-37916508 CCTGTGGCTGCACCTGGCGCTGG - Exonic
1024765521 7:52653283-52653305 CCTACAGCAGCACTGGGCAGTGG - Intergenic
1032125433 7:129189385-129189407 CGTAGGGCAGCACCGAGCCCAGG - Exonic
1032279707 7:130491023-130491045 CCTCTGGATGCAGCGGGCACCGG + Intronic
1035465182 7:159070295-159070317 GCAGTGGCAGCACCGGGCCCTGG - Intronic
1036462237 8:8963538-8963560 CCTTTGGCAGCTCCCGGCCCCGG + Intergenic
1036496812 8:9277376-9277398 GCTGTGGCTGCACAGGGCACAGG - Intergenic
1039056972 8:33544678-33544700 CCTATCTCAGCACCTGGCCCAGG + Intergenic
1043033596 8:75169262-75169284 CCTAAGGCTGCACAGGGCAGTGG + Intergenic
1043515745 8:80993223-80993245 CCCATGGCAGGAGCAGGCACTGG + Exonic
1045009322 8:97943961-97943983 CCTGTGGCAGGACCAGGCAGGGG - Intronic
1049206058 8:141364095-141364117 CCACTGGCAGGACCCGGCACAGG + Intronic
1052341104 9:27365041-27365063 CCTTTGAAAGCACCTGGCACAGG + Intronic
1053588556 9:39486620-39486642 CATATAGCAACACCAGGCACAGG - Intergenic
1055108532 9:72537155-72537177 CCTGAGGCAGCACAGGGCAGTGG + Intronic
1056998961 9:91489872-91489894 CCTATGGAAGCTCCGTGCTCTGG + Intergenic
1057171031 9:92963240-92963262 CCTGCGGCAGCACCTGGCACAGG + Intronic
1058368691 9:104239043-104239065 GCAATGGCAGCACCATGCACTGG - Intergenic
1059381846 9:113933114-113933136 GGTTTGGCAGCACTGGGCACTGG + Intronic
1060422778 9:123481444-123481466 TCTTCGGCAGCACCTGGCACAGG - Intronic
1062028478 9:134351329-134351351 CCTATGCCAGCAGCGGGCAGAGG + Intronic
1062278714 9:135742578-135742600 CCTTTGGCGCCCCCGGGCACGGG - Intronic
1062328419 9:136023780-136023802 CCTATCACAGCACATGGCACGGG + Intronic
1186415643 X:9381032-9381054 CCTCTGGCAGCACTGCACACTGG + Intergenic
1191673852 X:63774417-63774439 CCTTTGGCAACACAGGACACTGG - Intronic
1194274859 X:91866277-91866299 CCTAAGGCAGAACTGGGCATAGG - Intronic
1198262172 X:134974576-134974598 CCTATGGCAGGAGAGGGCACTGG + Intergenic
1199274590 X:145926295-145926317 GCTACAGCAGCACAGGGCACTGG + Intergenic
1199721094 X:150543239-150543261 GCTAGGGCTGCACCAGGCACTGG - Intergenic
1200095411 X:153657341-153657363 CCGATGACACCACTGGGCACAGG + Intergenic
1200592101 Y:5087678-5087700 CCTAAGGCAGAACTGGGCATAGG - Intronic