ID: 1084971036

View in Genome Browser
Species Human (GRCh38)
Location 11:72772169-72772191
Sequence ATGCCCCCTATGGCAGCACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 2, 2: 2, 3: 6, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084971036_1084971042 15 Left 1084971036 11:72772169-72772191 CCCGGTGCTGCCATAGGGGGCAT 0: 1
1: 2
2: 2
3: 6
4: 122
Right 1084971042 11:72772207-72772229 CAGCGCTGCCATAGCCATAGTGG 0: 1
1: 0
2: 2
3: 5
4: 91
1084971036_1084971044 21 Left 1084971036 11:72772169-72772191 CCCGGTGCTGCCATAGGGGGCAT 0: 1
1: 2
2: 2
3: 6
4: 122
Right 1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG 0: 1
1: 1
2: 0
3: 11
4: 104
1084971036_1084971043 16 Left 1084971036 11:72772169-72772191 CCCGGTGCTGCCATAGGGGGCAT 0: 1
1: 2
2: 2
3: 6
4: 122
Right 1084971043 11:72772208-72772230 AGCGCTGCCATAGCCATAGTGGG 0: 1
1: 0
2: 1
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084971036 Original CRISPR ATGCCCCCTATGGCAGCACC GGG (reversed) Intronic
900080081 1:850054-850076 CAGCCCCCCATGGCAGCAGCTGG + Intergenic
900126377 1:1070668-1070690 AGGCCCCCTTTGTCAGCCCCCGG + Intergenic
900733943 1:4282973-4282995 ATCACCCATATGGCAGCACATGG - Intergenic
900932583 1:5746422-5746444 AGGCCACTGATGGCAGCACCTGG + Intergenic
902375937 1:16029961-16029983 AGGCGCCCGATGGCAGCTCCTGG - Exonic
902882737 1:19383554-19383576 ATGCTCCCAAGGACAGCACCTGG + Intronic
920736469 1:208537453-208537475 ATGCACCCTCAGCCAGCACCAGG + Intergenic
922316395 1:224446757-224446779 ATTCCCCCTTTGGAAGCACTGGG + Intronic
1065143591 10:22743969-22743991 ATGTCCCCTTTTCCAGCACCTGG - Intergenic
1069184441 10:65405456-65405478 ATGCCACCTAGCACAGCACCTGG - Intergenic
1070803467 10:79256673-79256695 ATGCCCCCTGTGGAAACAGCTGG - Intronic
1071131414 10:82397914-82397936 ATGCCCCCAAAGCCAGCAGCAGG - Intronic
1073267777 10:102238529-102238551 ATCCCTCCTATGGCTGCATCAGG + Intronic
1074154182 10:110783900-110783922 ATTCCCCCTAAGCCAGCCCCTGG + Intronic
1075782659 10:125027019-125027041 CTGCCCCCGAAGGCAGCACAGGG - Exonic
1076146283 10:128125233-128125255 ATGCCCACTGTGGAGGCACCCGG + Intronic
1076701399 10:132275123-132275145 ATGGGCCAGATGGCAGCACCAGG - Intronic
1084118639 11:67056405-67056427 CTGCCCCCTCCCGCAGCACCAGG - Intergenic
1084736367 11:71108204-71108226 ATGGCCCCTGTGCCAGCTCCTGG - Intronic
1084971026 11:72772133-72772155 ATGCCCACTATGGCAGTGCCAGG - Intronic
1084971036 11:72772169-72772191 ATGCCCCCTATGGCAGCACCGGG - Intronic
1084971053 11:72772246-72772268 GTGCCCACTATGGCAGCACCGGG - Intronic
1084971062 11:72772282-72772304 ATGCCCACTATGGCAGCACCGGG - Intronic
1084971082 11:72772360-72772382 ATGCCCCCTATGGCAGCGCCAGG - Intronic
1084977809 11:72812926-72812948 GTGCCCCTTAGGGCAGGACCTGG - Intergenic
1088795367 11:113262983-113263005 GTGCCCCCTTTGGAAGAACCTGG + Intronic
1089601274 11:119616796-119616818 ATGCCCCCTACCCCAGCACAGGG - Intergenic
1093237578 12:16630065-16630087 ATGTGCCCAATGGCAGCTCCTGG - Intergenic
1094642762 12:32292154-32292176 ATGCTCCCTCTGGCAGCTCTAGG + Intronic
1096864651 12:54555222-54555244 AACCCACCTATGGCAGCCCCTGG - Intronic
1103342543 12:120228813-120228835 CTGCACCCCATGGCTGCACCTGG + Intronic
1103909097 12:124342146-124342168 ATGCCCCCTACTTCTGCACCCGG + Intronic
1105669171 13:22593184-22593206 GTGCCCCCTATGGGGACACCAGG - Intergenic
1112938043 13:104825275-104825297 GTGCCCCTTATGCCAGCACTGGG + Intergenic
1113885082 13:113654638-113654660 GTGCCCCCGAGGGCAGCCCCTGG - Intronic
1115424778 14:33245480-33245502 ATACCCCCTATTTCAGAACCAGG - Intronic
1117615610 14:57531021-57531043 ATGCCCTCCATTGCAGCCCCTGG + Intergenic
1118846510 14:69551402-69551424 CTGCCTCCTATGGCAGCTGCAGG - Intergenic
1120979323 14:90276819-90276841 ATGCTCCCCATGACAGCAGCTGG - Exonic
1122643379 14:103175656-103175678 ATGCGCCCTGCGGCAGCATCTGG - Intergenic
1123119881 14:105911611-105911633 GTCCTCCCTAGGGCAGCACCGGG + Intergenic
1202854300 14_GL000225v1_random:41056-41078 ATGCCCCCTTAGGCAGAGCCTGG + Intergenic
1202892070 14_KI270722v1_random:168205-168227 GTGCCTCCTGTGGCAGTACCCGG + Intergenic
1126414686 15:48405508-48405530 AGGCCTCGTATGGCAGCAGCGGG + Intergenic
1128300642 15:66564513-66564535 CTGCCCCCTCTGGCTGCACTGGG + Intronic
1130042308 15:80415229-80415251 ATGTCCCCTGTGGCAGCAAGTGG + Intronic
1131793287 15:95988075-95988097 AGGCCCCCTGTGGCATCCCCAGG + Intergenic
1133658187 16:7887547-7887569 GTGCACCCTCTGGCAGCCCCAGG + Intergenic
1133923167 16:10172649-10172671 ATTCCCCCTATGGCAACAGTTGG - Intronic
1137946270 16:52735742-52735764 ATGCCCACTATTGCAGCTGCAGG - Intergenic
1139654593 16:68379701-68379723 ATGGCCCCTTTGCCTGCACCTGG - Intronic
1140131043 16:72162022-72162044 ATGCACCCTATGCCACCATCAGG + Intronic
1140850732 16:78932662-78932684 ATTCCCCCCATGGGAGGACCTGG + Intronic
1142741841 17:1936161-1936183 TTGCCCCCGACGGCGGCACCGGG - Exonic
1144728803 17:17515054-17515076 CCACCCCCTATTGCAGCACCTGG - Intronic
1146309857 17:31759405-31759427 ATGACCCCTTTGGCCTCACCAGG + Intergenic
1149441337 17:56677014-56677036 AGCCACCCTGTGGCAGCACCAGG - Intergenic
1150826396 17:68479924-68479946 ATGCCCCTTATAAAAGCACCAGG + Intergenic
1152248202 17:79197173-79197195 ATGCCTCTTATGTCTGCACCTGG - Intronic
1152535935 17:80950368-80950390 ATGCAACCTAGGGCAGAACCAGG - Intronic
1153650359 18:7234078-7234100 ATTCCCCCTCTAGCAGCAACTGG + Intergenic
1156500203 18:37552678-37552700 CTGCCCCTTATGCCATCACCAGG - Intronic
1156504028 18:37577696-37577718 CTGCCCCCTGCGGCAGCATCCGG + Intergenic
1161054126 19:2181421-2181443 ATGGCCCTTATGGCAGCTGCAGG - Intronic
1164616578 19:29670286-29670308 ATTCCCCTTCTGGCAGCCCCTGG + Intronic
925234696 2:2267542-2267564 ATGCCCCAGATGGAAGCAACAGG + Intronic
925385503 2:3459222-3459244 ATGCCACCCTGGGCAGCACCAGG - Intronic
926334074 2:11850161-11850183 AGGCTCCCTTCGGCAGCACCTGG + Intergenic
928193321 2:29193916-29193938 ATTTCCCCTACGGCAGGACCCGG - Exonic
932457459 2:71858518-71858540 ATGCCTCCTGTGACAGCATCTGG + Intergenic
935126458 2:100227720-100227742 ATGTCCCCTCAGGTAGCACCAGG + Intergenic
941432433 2:165427829-165427851 CTGGCACCTGTGGCAGCACCTGG + Intergenic
943169706 2:184382479-184382501 ATGTCCCTTCTGGCAGCAGCAGG - Intergenic
946022169 2:216648236-216648258 CAGCACCCTCTGGCAGCACCAGG + Intronic
946495692 2:220193140-220193162 CTGGCGCCTATGCCAGCACCTGG + Intergenic
1169761844 20:9104089-9104111 CTGCCCCTTATGGCATCAGCTGG + Intronic
1178286281 21:31328064-31328086 ATGCTCCCTCTGTCAGCACAGGG + Intronic
1180190084 21:46158783-46158805 ATGTCTCCTGGGGCAGCACCCGG - Intergenic
1180601007 22:17015607-17015629 CTGCCTCCTGTGGCAGCCCCAGG + Intergenic
1181444257 22:22956702-22956724 AAACCCCCTATGGCAGCAACAGG + Intergenic
1183358654 22:37372257-37372279 TTGACCCCTATGCCGGCACCCGG - Exonic
1183476770 22:38039851-38039873 AGGCCCCCTCTTGCAGCACAGGG - Intronic
1184112680 22:42404412-42404434 ATGCCCCTGATGGCAGCGGCAGG - Intronic
1184113543 22:42409240-42409262 AGGCACCCCATGGCAGCACAGGG + Intronic
952226851 3:31386509-31386531 ATGCCCCTGAGGGCTGCACCTGG + Intergenic
953441019 3:42917466-42917488 AGGCTCCATATGGTAGCACCTGG - Intronic
953855900 3:46498891-46498913 ATGCTCCCTATGGCAGCTCCTGG - Intronic
955508963 3:59660090-59660112 ATGCCCCCTAAAACAGGACCAGG + Intergenic
956216357 3:66853433-66853455 CTGCCCCCTATGGCATTAACTGG + Intergenic
956994914 3:74814965-74814987 ATGGCTCCTATGGCAGGACCTGG - Intergenic
961082812 3:124041120-124041142 ATACCCCCTCTGGGAGCACTTGG + Intergenic
961112654 3:124298194-124298216 ATGCCCACTGTGCTAGCACCAGG + Intronic
968540683 4:1166819-1166841 ATGGCCCTGACGGCAGCACCAGG + Intergenic
969352632 4:6606511-6606533 ATGCCCCTTAGGGCAGCCCACGG + Intronic
971252504 4:24985257-24985279 GTGCCCCATATGACAGCATCAGG - Intergenic
984082834 4:175270324-175270346 ATGCCCCATATGACAGAACTGGG + Intergenic
985357293 4:189135298-189135320 CTGCCCACTTTGGCAGGACCTGG + Intergenic
992414538 5:76539717-76539739 CTGCCCCCTATGGCTTCCCCAGG - Intronic
995172464 5:109132766-109132788 ATAGCCCAGATGGCAGCACCTGG + Intronic
995638486 5:114223873-114223895 GGGCCCCATTTGGCAGCACCTGG + Intergenic
999312159 5:150558427-150558449 ATGCCCCCTGTGGCTGCCCTAGG - Intergenic
1002356609 5:178634717-178634739 ATGTTCCCTATGGCCGCAACAGG + Intergenic
1002810167 6:620876-620898 AGACCACCTATGGCAGTACCAGG - Intronic
1004739262 6:18441500-18441522 CTGCCCCATATGTCAGCAACAGG + Intronic
1006377312 6:33678623-33678645 ATGCCCCCCACTGCAGCTCCTGG + Exonic
1007476456 6:42122838-42122860 ATGCCTCCTCTGGCAGAGCCAGG + Intronic
1018659865 6:166076223-166076245 CTGGCACCTATGCCAGCACCTGG - Intergenic
1022326335 7:29335400-29335422 ATGCCCTCTATGGCAGGAAGTGG - Intronic
1023649567 7:42354686-42354708 ATGGCCCCTAGGGTAGCACTAGG - Intergenic
1023912984 7:44568526-44568548 AAGCCCCCTATGGTGGCCCCAGG + Intronic
1024772810 7:52744468-52744490 ATGCGCCCTGTGGAAGCAACGGG - Intergenic
1026263510 7:68776310-68776332 ATCCTCCCTATGCCAGCCCCTGG - Intergenic
1027268070 7:76504871-76504893 GTGCCCCCCAGGCCAGCACCAGG + Intronic
1034488294 7:151380003-151380025 ATGCCCCTTGTGGCAGCCACAGG + Intronic
1035397534 7:158545006-158545028 AGGCCCCCTCTGGAAGCTCCAGG + Intronic
1035935085 8:3828108-3828130 ATAGCCCATATGGCAGAACCTGG + Intronic
1037203104 8:16282184-16282206 ATGGCTCCTATGGCCTCACCCGG - Intronic
1039491892 8:37954009-37954031 ATCCCCAATATGGCAGCACTGGG + Intergenic
1046004694 8:108464597-108464619 CTGCCCCCTGTGGCTGCACCTGG - Intronic
1046782838 8:118233697-118233719 AAGCCCCAGATGGCAGCACAAGG + Intronic
1049287973 8:141786885-141786907 AAGCCCCCGAGAGCAGCACCAGG + Intergenic
1055021553 9:71675539-71675561 ATGCCCCCCATGGCTCCACTGGG - Intergenic
1061461434 9:130742514-130742536 AAGCCCTCAATGGCAGCAACAGG - Intronic
1203739359 Un_GL000216v2:165290-165312 ATGCCCACTTAGGCAGAACCTGG - Intergenic
1186809690 X:13176214-13176236 ATGCTCCACATGGCATCACCTGG + Intergenic
1187969812 X:24647866-24647888 GTTCCCCCTAGGGCAGCCCCAGG - Intronic
1194791906 X:98160536-98160558 ATGACCACTATGGCTGCACTGGG - Intergenic
1196771746 X:119301367-119301389 AAGCCTCCTCTGACAGCACCAGG + Intergenic
1200116575 X:153772202-153772224 CTGCCCCCAATGGCACCACTGGG + Exonic
1200256603 X:154585871-154585893 CTGCCCCCTGTGGCATCACCCGG - Intronic
1200261166 X:154618532-154618554 CTGCCCCCTGTGGCATCACCCGG + Intronic
1200972237 Y:9164919-9164941 CTGGCCCCTGTGCCAGCACCTGG + Intergenic
1202138786 Y:21699365-21699387 CTGGCCCCTGTGCCAGCACCTGG - Intergenic