ID: 1084971037

View in Genome Browser
Species Human (GRCh38)
Location 11:72772170-72772192
Sequence CATGCCCCCTATGGCAGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084971037_1084971044 20 Left 1084971037 11:72772170-72772192 CCGGTGCTGCCATAGGGGGCATG 0: 1
1: 1
2: 1
3: 10
4: 97
Right 1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG 0: 1
1: 1
2: 0
3: 11
4: 104
1084971037_1084971042 14 Left 1084971037 11:72772170-72772192 CCGGTGCTGCCATAGGGGGCATG 0: 1
1: 1
2: 1
3: 10
4: 97
Right 1084971042 11:72772207-72772229 CAGCGCTGCCATAGCCATAGTGG 0: 1
1: 0
2: 2
3: 5
4: 91
1084971037_1084971043 15 Left 1084971037 11:72772170-72772192 CCGGTGCTGCCATAGGGGGCATG 0: 1
1: 1
2: 1
3: 10
4: 97
Right 1084971043 11:72772208-72772230 AGCGCTGCCATAGCCATAGTGGG 0: 1
1: 0
2: 1
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084971037 Original CRISPR CATGCCCCCTATGGCAGCAC CGG (reversed) Intronic
900265130 1:1753452-1753474 CTTGTCCCCTAGGGCACCACAGG - Intronic
900405355 1:2490540-2490562 CATGGCCCCTCTGGAAGCAACGG - Intronic
900615375 1:3563315-3563337 CCTGGCACCTATGGCAGCCCAGG + Intronic
900634764 1:3657636-3657658 CATGGCCCCTCTGGCAGCCTGGG - Intronic
901028851 1:6294407-6294429 CACGCCACCCAGGGCAGCACTGG - Intronic
909300066 1:74001974-74001996 CATGCTCTCTCTGACAGCACTGG + Intergenic
910238187 1:85057670-85057692 AATGCCCCTTAGGGCAGCATTGG + Intronic
919752722 1:201048306-201048328 CCTGACCCCTGTGCCAGCACTGG + Intronic
922316394 1:224446756-224446778 AATTCCCCCTTTGGAAGCACTGG + Intronic
922333027 1:224594459-224594481 CCTGCCCCATGTGGCTGCACTGG - Intronic
924324742 1:242884499-242884521 CATGTCCATTATGGCACCACTGG + Intergenic
1063654081 10:7969783-7969805 CATGCTCCCTCAGCCAGCACTGG - Intronic
1063960028 10:11299374-11299396 CATGACCCCAATGGTAGCAGGGG - Intronic
1065932651 10:30493236-30493258 CATGCTCCCTATAGCAGAAGGGG + Intergenic
1066153809 10:32653266-32653288 AATGCTCCCTATGTGAGCACTGG + Intronic
1067145600 10:43691613-43691635 CATGCCCCTGCTGGCAGCCCTGG + Intergenic
1069676365 10:70251535-70251557 CATGCCGCACATGGCAGGACAGG + Exonic
1069797181 10:71060985-71061007 GTGGCCCCCTATGGCACCACTGG + Intergenic
1070766294 10:79058330-79058352 TATGGCCCCGAGGGCAGCACAGG + Intergenic
1073454159 10:103626512-103626534 CCTGCCCTCTAAGCCAGCACTGG - Intronic
1075782660 10:125027020-125027042 GCTGCCCCCGAAGGCAGCACAGG - Exonic
1075928142 10:126270216-126270238 GATGACCCCTCTGGTAGCACCGG + Intronic
1076335924 10:129706422-129706444 CACGCCCCCCAAGGCAGCCCAGG + Intronic
1076368194 10:129935681-129935703 CATTCCTCCTACGTCAGCACTGG + Intronic
1084971037 11:72772170-72772192 CATGCCCCCTATGGCAGCACCGG - Intronic
1084971054 11:72772247-72772269 CGTGCCCACTATGGCAGCACCGG - Intronic
1084971063 11:72772283-72772305 CATGCCCACTATGGCAGCACCGG - Intronic
1084971090 11:72772397-72772419 CATGCCCACTATGACAACGCTGG - Intronic
1089601275 11:119616797-119616819 CATGCCCCCTACCCCAGCACAGG - Intergenic
1091158265 11:133394137-133394159 CATGCCTCAGATGGCATCACTGG + Intronic
1094823082 12:34242563-34242585 CATGACCACTATGACTGCACTGG + Intergenic
1095091596 12:38112513-38112535 CATGACCACTATGACTGCACTGG - Intergenic
1099290176 12:80767132-80767154 CATCCTCCCTATGGGAGCAGTGG - Intergenic
1100030057 12:90175859-90175881 CATCCCCCCCAAAGCAGCACTGG + Intergenic
1107191189 13:37588676-37588698 CATTCACCCTATCTCAGCACTGG - Intronic
1108277898 13:48829638-48829660 CCTGCCTCCTATTGCAGCAAAGG - Intergenic
1112938042 13:104825274-104825296 TGTGCCCCTTATGCCAGCACTGG + Intergenic
1114369313 14:22068314-22068336 TCTGCCTCCTATGGCAGCAGTGG + Intergenic
1117897182 14:60499643-60499665 TATGGCCCCTAAGGCAGAACTGG + Intronic
1122939415 14:104974575-104974597 TGTGCCCCCTAAGGCTGCACTGG + Intronic
1202868321 14_GL000225v1_random:136836-136858 CATGCCAACTGAGGCAGCACCGG - Intergenic
1127454593 15:59145284-59145306 CATGCCCACTGTGCCAGAACAGG + Intronic
1128300641 15:66564512-66564534 CCTGCCCCCTCTGGCTGCACTGG + Intronic
1128965107 15:72051211-72051233 CATGCCACCGATGGCAGCAGCGG + Intronic
1129618584 15:77121361-77121383 AATAAGCCCTATGGCAGCACTGG - Intronic
1132205671 15:99984571-99984593 CATTTCCCCTGTGCCAGCACTGG + Intronic
1133770386 16:8864332-8864354 AAGGTCCCCTGTGGCAGCACAGG - Intronic
1140339085 16:74139640-74139662 CAGGGCCACTATGACAGCACAGG + Intergenic
1142289061 16:89184394-89184416 CCTGACCCCTCTGGCAGCTCAGG - Intronic
1143458951 17:7087766-7087788 CATGGCAGCAATGGCAGCACTGG + Intergenic
1144542544 17:16158730-16158752 CATACCATCTCTGGCAGCACAGG - Intronic
1147947138 17:44086615-44086637 CATGCCCCCAGGGGCAGCAGGGG + Exonic
1148000748 17:44385693-44385715 CCTGCGCCCCCTGGCAGCACTGG - Exonic
1157477194 18:48030964-48030986 CCTGGCCCCTATGGCCCCACTGG - Intronic
1160732734 19:648620-648642 CAGGTCCCCTCTGGCAGCCCGGG - Intronic
1162797643 19:13095094-13095116 CAGGCTCCCTAGGGCAGCTCCGG - Exonic
929348657 2:40919782-40919804 CATGGTCTCTATGGCAGCATAGG + Intergenic
929403525 2:41613056-41613078 CATGACCCCGATGACAGGACAGG - Intergenic
942915099 2:181295208-181295230 CATGACCACTGTGGCTGCACTGG - Intergenic
944783843 2:203047608-203047630 AATGCCTTCTGTGGCAGCACAGG + Intronic
947751381 2:232534510-232534532 CTGGCACCCTATAGCAGCACTGG + Intronic
1169120158 20:3090910-3090932 CATGCCCTCTCTGGCAGTAGTGG - Intergenic
1173048837 20:39539558-39539580 GATGCCCAATATGGCAGCATTGG + Intergenic
1174467536 20:50729851-50729873 CTGGCCACCTGTGGCAGCACAGG - Intergenic
1176101020 20:63364684-63364706 CAAGCCCCCTAGGGCGGCTCAGG - Intronic
1176873641 21:14104470-14104492 CATGACCACTATGACTGCACTGG + Intergenic
1177279453 21:18961894-18961916 CATGCCTCCTAGGACAGAACAGG - Intergenic
1178286280 21:31328063-31328085 GATGCTCCCTCTGTCAGCACAGG + Intronic
1180647364 22:17350524-17350546 CATGCCCCTTAAGGCATCTCTGG + Intergenic
1183476771 22:38039852-38039874 CAGGCCCCCTCTTGCAGCACAGG - Intronic
1184113542 22:42409239-42409261 AAGGCACCCCATGGCAGCACAGG + Intronic
1184474858 22:44714855-44714877 CATGGCCCACATGGCAGCTCGGG - Intronic
964619447 3:158706512-158706534 CATACCCACTCTGGCAGCGCTGG - Intronic
969719463 4:8885297-8885319 CCTGTCCCCTCTGGCAGCACAGG - Intergenic
971144437 4:23961698-23961720 CAAGCCCCCTGTGCCAGAACTGG + Intergenic
973335218 4:48949039-48949061 AATGCCCCCTAAAGGAGCACTGG + Intergenic
982001194 4:151022779-151022801 CATTTCCCCTTTGGCAACACTGG - Intergenic
984082833 4:175270323-175270345 GATGCCCCATATGACAGAACTGG + Intergenic
994399014 5:99256204-99256226 CATGCCACCTATACCAGAACAGG - Intergenic
994471439 5:100212802-100212824 CTTTCCCCATATGGCACCACAGG + Intergenic
995778097 5:115746727-115746749 CATGCTCCCTCTGGCAGCAGCGG - Intergenic
997818211 5:137038142-137038164 CTTGCCCTCTATGTCAGCAGAGG - Intronic
998758661 5:145407905-145407927 TCTGCCACCTATGCCAGCACAGG + Intergenic
1001684170 5:173580780-173580802 CATGCCCTCGATGGCACCAAGGG + Intergenic
1001895474 5:175376148-175376170 CTGGCCCCCAATGGCAACACTGG + Intergenic
1003359288 6:5409114-5409136 CATGCCCACCATGTCAGGACAGG - Intronic
1003998968 6:11575471-11575493 CATGGCCCCTTTGGAAGCGCTGG + Exonic
1006927099 6:37662840-37662862 CATTCTCCCTAAGGCTGCACTGG - Intronic
1019768219 7:2866759-2866781 CATGGCCCCCATGGGAGCACGGG - Intergenic
1019994190 7:4713001-4713023 CATGCCCCCTTTGCTGGCACTGG - Intronic
1022220896 7:28312449-28312471 CAAGCCACCTCTGGCTGCACCGG - Intronic
1022334875 7:29412716-29412738 CATGGCCCCTTTTGCAGCATTGG + Intronic
1022502902 7:30893722-30893744 CAAGGTCCCTTTGGCAGCACTGG + Intergenic
1029103183 7:98151584-98151606 CATTCCCCCTGTGGCAGCGTGGG + Intronic
1034384796 7:150732049-150732071 CATGAGGCTTATGGCAGCACAGG + Intronic
1038261981 8:26003538-26003560 CATGGTTCCTATGGGAGCACTGG + Intronic
1039491891 8:37954008-37954030 GATCCCCAATATGGCAGCACTGG + Intergenic
1040994594 8:53389162-53389184 CATGCCATCTATGGAGGCACAGG + Intergenic
1045112346 8:98947650-98947672 CGTGCTCCCAATGGCAACACAGG - Intronic
1048946207 8:139450009-139450031 CATGCCACAGATGGAAGCACTGG - Intergenic
1049271024 8:141696380-141696402 CCTGCCCCCTCTGGCAGGCCCGG + Intergenic
1049797286 8:144502616-144502638 CGTGTCCCCTATGCCAGCCCAGG - Intergenic
1055021554 9:71675540-71675562 CATGCCCCCCATGGCTCCACTGG - Intergenic
1056843727 9:90019382-90019404 CATTCCCCCAAAGGCAGCAGTGG - Intergenic
1059712366 9:116880742-116880764 CATGGCACCTATGGCAGCCATGG - Intronic
1190902830 X:54695349-54695371 CATGTCCTGTATGGCACCACTGG + Intergenic
1194791907 X:98160537-98160559 CATGACCACTATGGCTGCACTGG - Intergenic
1199860633 X:151797951-151797973 CAAGCCCTCAATGGCAGCTCAGG + Intergenic
1200116574 X:153772201-153772223 CCTGCCCCCAATGGCACCACTGG + Exonic
1201175639 Y:11307132-11307154 CAAGCCACCTGAGGCAGCACGGG + Intergenic