ID: 1084971040

View in Genome Browser
Species Human (GRCh38)
Location 11:72772198-72772220
Sequence CTATGGCAGCGCTGTGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084971040_1084971044 -8 Left 1084971040 11:72772198-72772220 CCCTGTGCACAGCGCTGCCATAG 0: 1
1: 0
2: 2
3: 21
4: 102
Right 1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG 0: 1
1: 1
2: 0
3: 11
4: 104
1084971040_1084971051 21 Left 1084971040 11:72772198-72772220 CCCTGTGCACAGCGCTGCCATAG 0: 1
1: 0
2: 2
3: 21
4: 102
Right 1084971051 11:72772242-72772264 TGTGCCCGGTGCTGCCATAGTGG 0: 3
1: 0
2: 2
3: 10
4: 122
1084971040_1084971052 22 Left 1084971040 11:72772198-72772220 CCCTGTGCACAGCGCTGCCATAG 0: 1
1: 0
2: 2
3: 21
4: 102
Right 1084971052 11:72772243-72772265 GTGCCCGGTGCTGCCATAGTGGG 0: 2
1: 1
2: 0
3: 5
4: 70
1084971040_1084971055 27 Left 1084971040 11:72772198-72772220 CCCTGTGCACAGCGCTGCCATAG 0: 1
1: 0
2: 2
3: 21
4: 102
Right 1084971055 11:72772248-72772270 CGGTGCTGCCATAGTGGGCACGG 0: 2
1: 1
2: 0
3: 13
4: 100
1084971040_1084971047 7 Left 1084971040 11:72772198-72772220 CCCTGTGCACAGCGCTGCCATAG 0: 1
1: 0
2: 2
3: 21
4: 102
Right 1084971047 11:72772228-72772250 GGGCATGGCTCCCCTGTGCCCGG 0: 1
1: 1
2: 2
3: 28
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084971040 Original CRISPR CTATGGCAGCGCTGTGCACA GGG (reversed) Intronic
900169441 1:1259430-1259452 TTGGGGCAGGGCTGTGCACAGGG - Intronic
900364915 1:2307398-2307420 CGATGCCAGCGCTGTCCCCACGG + Exonic
906001686 1:42431799-42431821 CTGTGGGAGCACAGTGCACAGGG - Intronic
906448462 1:45923097-45923119 CTAGGGCAGAGCTGGGCCCAGGG - Intronic
908074798 1:60504182-60504204 CTGTGCCAGCACTTTGCACATGG + Intergenic
913130570 1:115834932-115834954 CTGTGTCTGCGCTGTGCTCAGGG + Intergenic
914781687 1:150791379-150791401 CTATGCCAGAGATGGGCACATGG - Intergenic
915888326 1:159747539-159747561 CTATAGCAGTGCTGTCTACACGG - Intergenic
916214556 1:162384219-162384241 CTATGGCTGGGCTGTGGTCAGGG - Intronic
919291911 1:195643588-195643610 CTCTGCCAGGGCTGTGCAGAAGG - Intergenic
920437786 1:205959352-205959374 CTATGACAGCGCTGTGCAAGGGG - Intergenic
1066402595 10:35090307-35090329 TAATGGCAGCGCTGTGAGCAGGG - Exonic
1067712707 10:48662678-48662700 CCATGGCATGGCTGTGCACAGGG - Intergenic
1071495125 10:86162826-86162848 CCATCTCAGCCCTGTGCACAGGG - Intronic
1079094945 11:17504145-17504167 CTAGGGCACTCCTGTGCACAGGG - Intronic
1081972274 11:47207710-47207732 CAATGGGAGCTCTGTGCCCAAGG - Intergenic
1082863954 11:57881494-57881516 CTAGGGCAGCTCCTTGCACATGG - Intergenic
1084927356 11:72524234-72524256 GTATGGCTGAGATGTGCACAGGG - Intergenic
1084971016 11:72772090-72772112 CTATGGCAGCGCTAAGCATGGGG - Intronic
1084971022 11:72772126-72772148 CTATGGCAGTGCCAGGCACAGGG - Intronic
1084971030 11:72772162-72772184 CTATGGCAGCACCGGGCACAGGG - Intronic
1084971040 11:72772198-72772220 CTATGGCAGCGCTGTGCACAGGG - Intronic
1084971049 11:72772239-72772261 CTATGGCAGCACCGGGCACAGGG - Intronic
1084971058 11:72772275-72772297 CTATGGCAGCACCGGGCACAGGG - Intronic
1084971066 11:72772311-72772333 CTATGGCAGCACTGGGCACAGGG - Intronic
1084971076 11:72772353-72772375 CTATGGCAGCGCCAGGCACAGGG - Intronic
1084971085 11:72772389-72772411 CTATGACAACGCTGGGCACAGGG - Intronic
1087232436 11:95681458-95681480 CTATGACAGGGGTGAGCACAGGG - Intergenic
1089681096 11:120119403-120119425 CTGTGGGAGGGCTTTGCACAGGG - Intronic
1095580903 12:43796602-43796624 CTCTGGCAGCGCTGTCCAATAGG + Intronic
1100136053 12:91554705-91554727 CTACGGCAGCAATATGCACAAGG - Intergenic
1101614264 12:106320645-106320667 CCATGGCAGCTCAGGGCACAAGG - Intronic
1106804835 13:33295677-33295699 CTATGACAGAGGTGTGCAGAGGG + Intronic
1107403735 13:40093952-40093974 CTATGCTAGCGCTGTGGCCACGG + Intergenic
1108763181 13:53594592-53594614 CCATAGCAGAGCTCTGCACATGG + Intergenic
1113611952 13:111653020-111653042 CTTTGTGAGTGCTGTGCACATGG - Intronic
1122092648 14:99350367-99350389 CTCTGGCTGAGTTGTGCACACGG - Intergenic
1122994064 14:105253217-105253239 CCACGGCAGGGCTGTGCACAGGG - Intronic
1125464133 15:39934177-39934199 CCATGGCAGCGCTGCGCCCAAGG - Exonic
1125532074 15:40420226-40420248 CCGTGGCAGGGCGGTGCACAAGG - Intronic
1125762776 15:42108640-42108662 CACTGGAAGCTCTGTGCACATGG - Intergenic
1126323164 15:47447044-47447066 ATATGGCAGGGGTGTGCCCAGGG - Intronic
1126954606 15:53918576-53918598 CCAAGGCAGTGCTGAGCACAGGG + Intergenic
1129852071 15:78799040-78799062 CTGTGCCACAGCTGTGCACATGG - Intronic
1130250932 15:82300047-82300069 CTGTGCCACAGCTGTGCACATGG + Intergenic
1130534161 15:84771216-84771238 CTATGGCAGCACTTCTCACAGGG - Intronic
1133012842 16:2924543-2924565 ATGTGGCAGTGCTCTGCACATGG + Intronic
1136394909 16:29987457-29987479 CTATGGCAGCGGGGGGCAGATGG + Exonic
1138653951 16:58479704-58479726 CTATGACAGTGCTGGGCACAGGG - Intronic
1141983102 16:87561968-87561990 CACTGGCAGCGCTGGGCACATGG + Intergenic
1142311995 16:89319582-89319604 CGATGGCAGCGATGTGCTCGAGG + Intronic
1144887971 17:18476907-18476929 CTGAGGCAGCCCTGTGCCCACGG - Intronic
1145144237 17:20467396-20467418 CTGAGGCAGCCCTGTGCCCACGG + Intronic
1145175688 17:20698796-20698818 CTGAGGCAGCCCTGTGCCCACGG + Intergenic
1146289210 17:31596162-31596184 CTATGGCAGGGCAGGGCAGAGGG - Intergenic
1152548847 17:81019282-81019304 CCATGGCAGGTCTGAGCACAAGG + Intergenic
1155064132 18:22254323-22254345 CTACGGCAGCCCTCTGCCCAGGG + Intergenic
1156518235 18:37699014-37699036 CAATGGCAGTGCTATGGACAGGG - Intergenic
1158888446 18:61850907-61850929 CTAGTGCAGCTCTGGGCACACGG + Intronic
1158916746 18:62139814-62139836 CCATGGCAGAGCTGTTCTCAGGG - Intronic
1159816546 18:73080656-73080678 TTATGGCAGCACTGGCCACAGGG + Intergenic
1159949682 18:74473842-74473864 CTTTGGCAGCACTGGGCACATGG + Intergenic
1162907773 19:13833711-13833733 CTTTGGCGGCGCTGTGCATGGGG + Intergenic
1163183924 19:15623208-15623230 CTGTGGAAGCGCCGTCCACAGGG - Exonic
1164413475 19:28025223-28025245 CTATAGCATAGGTGTGCACAAGG + Intergenic
1167033621 19:46979690-46979712 CGATGCCAGCGATGCGCACACGG - Intronic
1167257802 19:48441880-48441902 CTATGGCATCGCCCTGCACAAGG + Exonic
925969205 2:9095421-9095443 CTCGGGGAGAGCTGTGCACACGG - Intergenic
926168026 2:10533779-10533801 CAATGGGTGCGCTGTGCACAAGG + Intergenic
930760823 2:55033569-55033591 CCATGTCAGCGCTGTGCTTAAGG - Intronic
938186220 2:129234340-129234362 CTATGGCAGTACAGTGCATAGGG + Intergenic
947844331 2:233232062-233232084 CTCAGGCAGAGCTGTACACACGG + Intronic
948727217 2:239942227-239942249 CTAGGGCAGCGGTGTTCACGCGG + Intronic
1169068611 20:2708177-2708199 CTCAGCCAGCGCTGTGCCCAGGG - Intronic
1169239124 20:3960027-3960049 CTATGGTAGGGCTGTGAACAGGG - Intronic
1171208521 20:23299554-23299576 CAACAGCAGCACTGTGCACATGG - Intergenic
1171464342 20:25317227-25317249 CTCTGGCAGTGCTGTGCCAAGGG + Intronic
1172600749 20:36181163-36181185 CCATGGCAGGGCTGTGGTCATGG - Intronic
1174368010 20:50068058-50068080 CTAGGGCAGTGCTGGGCACACGG + Intergenic
1181361933 22:22344207-22344229 CCATGAGAGCTCTGTGCACATGG - Intergenic
1181695216 22:24589559-24589581 GTGTGGCAGCACTGTGCACCAGG - Intronic
1185058234 22:48592179-48592201 CTGTGCCAGTGCTGTGCCCAGGG + Intronic
949898039 3:8784890-8784912 CTGTGGCAGCTCTGTGCATATGG - Intronic
950662168 3:14473313-14473335 CTCAGGCAGCGCCATGCACATGG + Intronic
956235159 3:67061242-67061264 CTATGGCAGCACTGGGGAGATGG + Intergenic
964445129 3:156750556-156750578 CACTGGCAGGCCTGTGCACATGG - Intergenic
964619444 3:158706504-158706526 CTCTGGCAGCGCTGGAAACAAGG - Intronic
966470035 3:180278949-180278971 CCTTGGCAGCGCTGTTCCCAGGG - Intergenic
968311291 3:197685389-197685411 GTATGGCATCTCTGTGCACTGGG + Intronic
968757714 4:2425617-2425639 GTAGGGCAGCGCTGGGCAGAGGG - Intronic
968783192 4:2598894-2598916 CTTGGGCAGCTCTGTGCTCACGG + Intronic
969312366 4:6361289-6361311 CTATGGCAGAGCTGTGAAGATGG - Intronic
969487314 4:7479529-7479551 CCCTGGCAGCGGTGTGCAGAAGG - Intronic
969618820 4:8268767-8268789 CAGTGGCAGCCCTCTGCACAGGG + Intergenic
972474623 4:39438697-39438719 CTAGGGCAGTGCTGGGCACATGG + Intronic
973246887 4:48018690-48018712 CTATGCCAGTGCTTGGCACATGG - Intronic
975709072 4:77141030-77141052 CTATGACAGAGCTAAGCACAGGG - Intergenic
977568422 4:98605990-98606012 CTATGGCATCTGTATGCACACGG + Intronic
983825158 4:172249883-172249905 CTATGCTAGGGCTGTGCAGAAGG + Intronic
986814016 5:11388351-11388373 ATATGGCACCGCTGAACACATGG + Intronic
988972178 5:36480059-36480081 CAATGGGAGCCCTGTACACATGG - Intergenic
999306607 5:150523663-150523685 CTGTGGGAGCTCTGTGCACTGGG - Intronic
999648631 5:153743928-153743950 CAATGGCAGAGCTGGACACAGGG + Intronic
1005168961 6:22959019-22959041 CTATGGCAGAGCTGAGCACATGG - Intergenic
1006522531 6:34579661-34579683 CTAGGGCACTGCTGGGCACAAGG + Intergenic
1012676945 6:102127064-102127086 CTATGTCAGTGTTGTGGACACGG + Intergenic
1013627344 6:111951104-111951126 CTATGGCAGCAGAGTGCAAAGGG - Intergenic
1018053933 6:160035589-160035611 CAATGGCAGACCTGTGAACAAGG - Intronic
1019991887 7:4697542-4697564 CTAAGGCAGGGGTGTGCAGACGG - Intronic
1031971994 7:128071863-128071885 CGGTGGCAGCACTGTGCCCAAGG + Intronic
1034210174 7:149356474-149356496 CTAAGGCAGTGCTGAGCACCTGG + Intergenic
1034954811 7:155327769-155327791 CCATGGCCAGGCTGTGCACAGGG - Intergenic
1039876368 8:41589855-41589877 CCATGGCAGTGCTGTCCACAGGG + Intronic
1046848679 8:118948496-118948518 CTATGGCAGTGCTGATCAAAAGG - Intronic
1048150137 8:131885914-131885936 ATCTGGCAGCGGTGAGCACAGGG - Intergenic
1050137411 9:2481095-2481117 CTATGACAGGGCTGTGAAGAAGG - Intergenic
1053637372 9:40025253-40025275 CCATGGCAGGGTTTTGCACAAGG + Intergenic
1061649354 9:132034460-132034482 CTATTGCAGCGCTCTGTCCAAGG + Intronic
1061696493 9:132379470-132379492 TTAGGGCAGGGCTGAGCACAAGG - Intronic
1203653556 Un_KI270752v1:1843-1865 CTATTTCAGGGCTATGCACAGGG + Intergenic
1186519440 X:10192643-10192665 CCATGGCAGGGCTTTCCACAGGG + Intronic
1188748209 X:33873228-33873250 CTCTGCTAGCGCAGTGCACAAGG - Intergenic
1190759726 X:53429436-53429458 CAATGGCAGGGATGTACACAGGG - Intronic
1192155999 X:68747062-68747084 CCATGGCAGCCCAGTGCAAAGGG + Intergenic
1197193387 X:123673744-123673766 CAATGGCAGGGCTGTTCTCAGGG - Intronic
1197860869 X:130968899-130968921 CTATGGCAGAGGTGTGTACATGG - Intergenic