ID: 1084971041

View in Genome Browser
Species Human (GRCh38)
Location 11:72772199-72772221
Sequence GCTATGGCAGCGCTGTGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 106}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084971041_1084971052 21 Left 1084971041 11:72772199-72772221 CCTGTGCACAGCGCTGCCATAGC 0: 1
1: 0
2: 2
3: 3
4: 106
Right 1084971052 11:72772243-72772265 GTGCCCGGTGCTGCCATAGTGGG 0: 2
1: 1
2: 0
3: 5
4: 70
1084971041_1084971055 26 Left 1084971041 11:72772199-72772221 CCTGTGCACAGCGCTGCCATAGC 0: 1
1: 0
2: 2
3: 3
4: 106
Right 1084971055 11:72772248-72772270 CGGTGCTGCCATAGTGGGCACGG 0: 2
1: 1
2: 0
3: 13
4: 100
1084971041_1084971044 -9 Left 1084971041 11:72772199-72772221 CCTGTGCACAGCGCTGCCATAGC 0: 1
1: 0
2: 2
3: 3
4: 106
Right 1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG 0: 1
1: 1
2: 0
3: 11
4: 104
1084971041_1084971051 20 Left 1084971041 11:72772199-72772221 CCTGTGCACAGCGCTGCCATAGC 0: 1
1: 0
2: 2
3: 3
4: 106
Right 1084971051 11:72772242-72772264 TGTGCCCGGTGCTGCCATAGTGG 0: 3
1: 0
2: 2
3: 10
4: 122
1084971041_1084971047 6 Left 1084971041 11:72772199-72772221 CCTGTGCACAGCGCTGCCATAGC 0: 1
1: 0
2: 2
3: 3
4: 106
Right 1084971047 11:72772228-72772250 GGGCATGGCTCCCCTGTGCCCGG 0: 1
1: 1
2: 2
3: 28
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084971041 Original CRISPR GCTATGGCAGCGCTGTGCAC AGG (reversed) Intronic
901219187 1:7573378-7573400 GCTGTGGCCCCGCTGAGCACAGG - Intronic
902777490 1:18684134-18684156 GCAATGGCAGGGCTTTGCAAAGG - Intronic
904769149 1:32871154-32871176 GCCAAGTCAGGGCTGTGCACGGG - Intronic
904774485 1:32898332-32898354 GCTATGTCAGGGCTGTGCGTGGG + Intronic
907157054 1:52344188-52344210 ACTGTGTCAGCACTGTGCACAGG - Intronic
908975943 1:69898594-69898616 ACTCTGCCAGCGCTGGGCACTGG + Intronic
916214557 1:162384220-162384242 GCTATGGCTGGGCTGTGGTCAGG - Intronic
920437787 1:205959353-205959375 GCTATGACAGCGCTGTGCAAGGG - Intergenic
1066402596 10:35090308-35090330 GTAATGGCAGCGCTGTGAGCAGG - Exonic
1067712709 10:48662679-48662701 TCCATGGCATGGCTGTGCACAGG - Intergenic
1071027834 10:81137291-81137313 GCTATGGCAGCTCCTTGTACTGG - Intergenic
1073518073 10:104096955-104096977 GCTAAGGCAGAGCTGTCAACTGG - Intergenic
1073778244 10:106809540-106809562 GCTTTGGCAGCACTGGGCAGAGG + Intronic
1075936970 10:126351093-126351115 GCTGTGGCAGAGGTGTCCACGGG + Intronic
1077538086 11:3134013-3134035 GCTTGGGCAGAGCTGGGCACTGG - Intronic
1077830178 11:5859577-5859599 GCTATGGTAGAAATGTGCACAGG + Intronic
1080231217 11:30018656-30018678 GCAGTGGCAGCGCTATGCCCCGG + Intergenic
1080472457 11:32559419-32559441 GCAATTGCAGGGCTGTGCAGTGG + Intergenic
1083421167 11:62554120-62554142 GGTAGGGCAGGGCTGGGCACAGG + Intronic
1084971017 11:72772091-72772113 GCTATGGCAGCGCTAAGCATGGG - Intronic
1084971031 11:72772163-72772185 CCTATGGCAGCACCGGGCACAGG - Intronic
1084971041 11:72772199-72772221 GCTATGGCAGCGCTGTGCACAGG - Intronic
1084971050 11:72772240-72772262 ACTATGGCAGCACCGGGCACAGG - Intronic
1084971059 11:72772276-72772298 ACTATGGCAGCACCGGGCACAGG - Intronic
1084971067 11:72772312-72772334 GCTATGGCAGCACTGGGCACAGG - Intronic
1084971077 11:72772354-72772376 CCTATGGCAGCGCCAGGCACAGG - Intronic
1084971086 11:72772390-72772412 ACTATGACAACGCTGGGCACAGG - Intronic
1085029966 11:73265050-73265072 GCCATGGCAGGGTGGTGCACTGG + Intronic
1085694335 11:78691117-78691139 TCTAGGACAGAGCTGTGCACAGG - Intronic
1087232437 11:95681459-95681481 GCTATGACAGGGGTGAGCACAGG - Intergenic
1090427048 11:126615173-126615195 GCTAAGGCAGAGGTATGCACGGG - Intronic
1090460900 11:126890792-126890814 GCTGGGGCAGCGCTGGGCACAGG - Intronic
1090805960 11:130202408-130202430 GCTGTGGCAGGGCTGTGTCCAGG + Intronic
1093639839 12:21513460-21513482 GCTATGATAGAGTTGTGCACAGG - Intronic
1096532216 12:52249229-52249251 GCTCTGGCAGCTCTGGGCATGGG - Intronic
1096658035 12:53103841-53103863 GCTATGTCAGAGCTGTGGCCTGG + Intronic
1100702882 12:97166670-97166692 GCTACTGCAGAGCTGTGCAGAGG + Intergenic
1104171110 12:126281697-126281719 GCTTGGGCAGCACTGTGCAATGG - Intergenic
1104415402 12:128593579-128593601 GCTCCAGCAGCTCTGTGCACTGG + Intronic
1106804834 13:33295676-33295698 GCTATGACAGAGGTGTGCAGAGG + Intronic
1110471358 13:75863644-75863666 CCAATGGCTGGGCTGTGCACTGG + Intergenic
1112389453 13:98969772-98969794 GCAAAGGCAGAGCTGTGCCCAGG + Intronic
1113448779 13:110390732-110390754 TATATGGCAGGGCTGTGTACAGG + Intronic
1113461199 13:110483525-110483547 AATATGGCAGAGCTGTGCAAGGG + Intronic
1121711220 14:96040105-96040127 GTTCTGGCCGCGCTGGGCACTGG - Intronic
1122630948 14:103107561-103107583 GCCCTGGCAGGGCTGTGCCCAGG + Intronic
1122994066 14:105253218-105253240 CCCACGGCAGGGCTGTGCACAGG - Intronic
1125594192 15:40873876-40873898 GCTGCGGCGGGGCTGTGCACCGG - Intronic
1126323165 15:47447045-47447067 GATATGGCAGGGGTGTGCCCAGG - Intronic
1126954604 15:53918575-53918597 GCCAAGGCAGTGCTGAGCACAGG + Intergenic
1127867590 15:63044261-63044283 GCCATGGCAGGGCTGTGTGCAGG - Intronic
1133113431 16:3563123-3563145 GCCAGGGCAGCGCGGTGCGCGGG + Exonic
1134790853 16:16987908-16987930 GCCATGTCAGAGCTCTGCACTGG + Intergenic
1138653952 16:58479705-58479727 TCTATGACAGTGCTGGGCACAGG - Intronic
1138672889 16:58629736-58629758 GCTCCGGCAGCGCTGGACACAGG + Exonic
1145913484 17:28556306-28556328 CCTAGGGCAGAGCTGTGCAAGGG - Intronic
1151724503 17:75876479-75876501 GCTACGGCTGCACTCTGCACAGG + Exonic
1151891223 17:76951549-76951571 GGTATGGCTGTCCTGTGCACTGG - Intergenic
1152004055 17:77666418-77666440 ATTATAGCAGCACTGTGCACCGG + Intergenic
1152644138 17:81461081-81461103 GGTGTGGCCACGCTGTGCACGGG - Exonic
1153768965 18:8400442-8400464 GCTGGGGCAGGCCTGTGCACTGG - Intronic
1156291997 18:35755521-35755543 GCTATGGCAGAGCTGTACTACGG - Intergenic
1162907772 19:13833710-13833732 ACTTTGGCGGCGCTGTGCATGGG + Intergenic
1164694158 19:30231257-30231279 GCTGAGGCAGGGCTGAGCACTGG - Intronic
1164866646 19:31609973-31609995 GCTATGGGAGGGGTGTCCACAGG + Intergenic
1168232874 19:55044538-55044560 GCTATGGCATGGCTGTGCCGGGG - Exonic
932908066 2:75775718-75775740 GCAAAGGCAGCTCTGTGTACTGG - Intergenic
937571809 2:123372122-123372144 GCTAAGGAAGCACTGTGCTCAGG - Intergenic
940646833 2:156400478-156400500 GCTGTGGCCGCGCAGGGCACCGG + Intergenic
944882227 2:204025237-204025259 GATATAGCAACGCTGTGGACTGG + Intergenic
947072658 2:226308414-226308436 GCAATGTCAGCAATGTGCACTGG + Intergenic
949057708 2:241937472-241937494 GCTTTGGAAGCGCTCTCCACTGG + Intergenic
1169239125 20:3960028-3960050 ACTATGGTAGGGCTGTGAACAGG - Intronic
1172364265 20:34336861-34336883 GCTTTGCCAGCCGTGTGCACGGG + Intergenic
1175270869 20:57733421-57733443 GCTATGGCAGCAATGTCCGCAGG - Intergenic
1178760223 21:35395057-35395079 GCTATGGCAGGGCTGTCTGCTGG - Intronic
1182825811 22:33263648-33263670 GTTATGGCAGACCTGTGCTCAGG - Intronic
1183264349 22:36816393-36816415 GCTTAGGCAGAGCTGTGCGCCGG + Intronic
1183610545 22:38901052-38901074 GATAAGTCAGCACTGTGCACGGG - Intergenic
1184826625 22:46956996-46957018 GCCCTGGCAGCGCTGGGCAGAGG + Intronic
961470277 3:127107095-127107117 GCCATATCAGCGCTGTCCACGGG - Intergenic
961828150 3:129609360-129609382 GGTAGGGCAGTGCTGGGCACAGG - Intergenic
968311290 3:197685388-197685410 TGTATGGCATCTCTGTGCACTGG + Intronic
968577667 4:1375537-1375559 GCTGTGGCAGCGCCGGGCAGGGG - Intronic
970479870 4:16462100-16462122 GCAGGGGCAGCACTGTGCACAGG - Intergenic
971153605 4:24059584-24059606 GCTGTGGGAGCGATGGGCACGGG - Intergenic
975709073 4:77141031-77141053 GCTATGACAGAGCTAAGCACAGG - Intergenic
984470013 4:180156700-180156722 TTTATGGCAGCACTGTTCACAGG - Intergenic
984829466 4:183958217-183958239 GCTATGGGAGCTCTTTGTACTGG + Intronic
986596566 5:9429028-9429050 GCCATTGCAGGGATGTGCACAGG + Intronic
990263207 5:54047536-54047558 GCTAGGGCATCGCTGTGGCCCGG + Intronic
999306608 5:150523664-150523686 ACTGTGGGAGCTCTGTGCACTGG - Intronic
1000219485 5:159199143-159199165 GCTATGGTAGAGATGTGAACTGG + Intronic
1018667119 6:166148945-166148967 GCTTTCCCAGCGCTTTGCACTGG + Intergenic
1021268916 7:18560547-18560569 GCTATGTCAGAGATGAGCACGGG - Intronic
1022753689 7:33260743-33260765 GCTATAGCAGAGCTTTGCATAGG + Intronic
1025017098 7:55448732-55448754 GCTGGGGCCGCGCTGGGCACTGG - Intronic
1027121983 7:75528328-75528350 GCTTTGGCAGCCCTGAACACCGG + Intergenic
1035053735 7:156019884-156019906 GCTGTGGCTGGGGTGTGCACAGG + Intergenic
1035281482 7:157781137-157781159 GCTGTGGCAGGGCAGTGCTCTGG - Intronic
1038168620 8:25108251-25108273 GCTATAGCAGCGCTGGGCCCAGG + Intergenic
1039876366 8:41589854-41589876 CCCATGGCAGTGCTGTCCACAGG + Intronic
1041375152 8:57204828-57204850 GGAAGGGCAGTGCTGTGCACTGG + Intergenic
1049254105 8:141604844-141604866 GAGTTGGCAGTGCTGTGCACAGG + Intergenic
1057332888 9:94132238-94132260 ACTATGGCAGGAGTGTGCACAGG + Intergenic
1057437728 9:95057868-95057890 GCTCTGGCAGCACTGTGGTCGGG + Intronic
1058368691 9:104239043-104239065 GCAATGGCAGCACCATGCACTGG - Intergenic
1059381846 9:113933114-113933136 GGTTTGGCAGCACTGGGCACTGG + Intronic
1062513789 9:136922104-136922126 GCCATGGCAGTCCTGTGCTCTGG + Intronic
1190759727 X:53429437-53429459 GCAATGGCAGGGATGTACACAGG - Intronic
1192451814 X:71249641-71249663 GCAATGGCAGCGTGGTACACCGG - Exonic
1198475605 X:136994631-136994653 GCTAGGCCAGTGCTGTGCAATGG - Intergenic