ID: 1084971044

View in Genome Browser
Species Human (GRCh38)
Location 11:72772213-72772235
Sequence TGCCATAGCCATAGTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 104}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084971036_1084971044 21 Left 1084971036 11:72772169-72772191 CCCGGTGCTGCCATAGGGGGCAT 0: 1
1: 2
2: 2
3: 6
4: 122
Right 1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG 0: 1
1: 1
2: 0
3: 11
4: 104
1084971039_1084971044 11 Left 1084971039 11:72772179-72772201 CCATAGGGGGCATGGTTCTCCCT 0: 2
1: 1
2: 2
3: 11
4: 106
Right 1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG 0: 1
1: 1
2: 0
3: 11
4: 104
1084971030_1084971044 28 Left 1084971030 11:72772162-72772184 CCCTGTGCCCGGTGCTGCCATAG 0: 3
1: 1
2: 6
3: 19
4: 153
Right 1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG 0: 1
1: 1
2: 0
3: 11
4: 104
1084971040_1084971044 -8 Left 1084971040 11:72772198-72772220 CCCTGTGCACAGCGCTGCCATAG 0: 1
1: 0
2: 2
3: 21
4: 102
Right 1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG 0: 1
1: 1
2: 0
3: 11
4: 104
1084971031_1084971044 27 Left 1084971031 11:72772163-72772185 CCTGTGCCCGGTGCTGCCATAGG 0: 1
1: 2
2: 6
3: 11
4: 144
Right 1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG 0: 1
1: 1
2: 0
3: 11
4: 104
1084971037_1084971044 20 Left 1084971037 11:72772170-72772192 CCGGTGCTGCCATAGGGGGCATG 0: 1
1: 1
2: 1
3: 10
4: 97
Right 1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG 0: 1
1: 1
2: 0
3: 11
4: 104
1084971041_1084971044 -9 Left 1084971041 11:72772199-72772221 CCTGTGCACAGCGCTGCCATAGC 0: 1
1: 0
2: 2
3: 3
4: 106
Right 1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG 0: 1
1: 1
2: 0
3: 11
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084971044 Original CRISPR TGCCATAGCCATAGTGGGCA TGG Intronic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
905952211 1:41961384-41961406 TGCCATAGCAATAGTAACCAAGG + Intronic
907522595 1:55033941-55033963 TCCCATAGCCCCAGAGGGCAAGG - Intergenic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
915163112 1:153933436-153933458 TGCCTTAGCATTAGTGGGCTTGG - Intronic
917283001 1:173397012-173397034 TGCCAAAGACAAGGTGGGCATGG + Intergenic
919981904 1:202647064-202647086 TGGCAGAGCCATGGTGGCCAGGG + Intronic
921632923 1:217456222-217456244 TCCCAAAGCCCAAGTGGGCATGG - Intronic
1069669369 10:70188880-70188902 TGCCATGGGGATAGTGTGCAGGG - Intergenic
1072373100 10:94785933-94785955 TGGCATTTACATAGTGGGCAGGG - Intronic
1072896585 10:99372407-99372429 TGCAAGAGCAAGAGTGGGCAAGG + Intronic
1073947921 10:108773544-108773566 TGGCATAGCCAGAGAGAGCATGG - Intergenic
1074212861 10:111353669-111353691 TGAAATAGCCATGGTGGGAAGGG + Intergenic
1075138210 10:119806450-119806472 TGCCATCGCGAGAGTGGTCATGG + Exonic
1075343819 10:121667791-121667813 TGTCATAGACACAGTGGCCAGGG - Intergenic
1075407615 10:122205006-122205028 TGACAGAGCCATAGTGAGGATGG - Intronic
1078638986 11:13077921-13077943 TGCCATAGTCATTTTGGGAAAGG - Intergenic
1081591760 11:44427960-44427982 TGCCATCGCCATATTGGGGAAGG - Intergenic
1082078213 11:47991345-47991367 AGCCATAGCCAGAGTTGGCCAGG - Intronic
1084971027 11:72772135-72772157 TGGCACTGCCATAGTGGGCATGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1090289414 11:125528768-125528790 TGCCATACCCAGAGAGGGCATGG + Intergenic
1091795289 12:3294493-3294515 TGCCAGAGCCAGCCTGGGCAGGG - Intergenic
1102953854 12:117046946-117046968 TGCCAAAGCCAGAGGGGTCAGGG + Intronic
1109205412 13:59477791-59477813 TGACATGCCCAGAGTGGGCATGG + Intergenic
1109792123 13:67262752-67262774 TGCCCTAGCCAGAGTGGGGAGGG - Intergenic
1110361570 13:74631113-74631135 TGCCATGGCATTAGTGGGGAGGG + Intergenic
1116742644 14:48776435-48776457 AGCCATGGCCATAGTTGGCATGG - Intergenic
1121549685 14:94789412-94789434 TGCCATAGTCATGATGGGCAAGG - Intergenic
1125725837 15:41867713-41867735 TGCCATACCCAGAGTGCCCATGG - Intronic
1127389305 15:58492271-58492293 TTCCATGGCCATAGAGAGCATGG - Intronic
1128880979 15:71242673-71242695 TACCATAGCCATACTTGCCAGGG - Exonic
1130251229 15:82301442-82301464 TGCCATAGGCTTGGTGGGGAGGG - Intergenic
1132425065 15:101709266-101709288 TTCCATAGCCAGTGAGGGCAGGG - Intronic
1139212361 16:65092106-65092128 TGCCATAGTCATAGATGGCAGGG + Intronic
1140865540 16:79057868-79057890 TTCCATATCCATAATGTGCAAGG + Intronic
1141153229 16:81579155-81579177 TGCAATAGCCCTAGGAGGCAGGG - Intronic
1141724776 16:85780559-85780581 TGCCCCAGCCAGCGTGGGCACGG - Intronic
1141761911 16:86034133-86034155 TGCCATTGCCAGGCTGGGCAAGG + Intergenic
1142102994 16:88285478-88285500 TGCCACAGCCAGCGTGGGCAGGG + Intergenic
1143783769 17:9242438-9242460 TGCCACAGCCCTTCTGGGCAGGG - Exonic
1144468324 17:15515097-15515119 GCCCATACCCACAGTGGGCATGG + Intronic
1146433215 17:32818682-32818704 TGCTATAGCGATCTTGGGCAAGG + Intronic
1150160465 17:62893850-62893872 TGCCATTGCCAGAGTGGACTGGG - Intergenic
1152014994 17:77744696-77744718 GGCCAGGACCATAGTGGGCAGGG - Intergenic
1156474179 18:37395162-37395184 TGGCAGAGCCTTAGTGGACAGGG + Intronic
1158227136 18:55213184-55213206 TGCCAAAGGCAAGGTGGGCAAGG - Intergenic
1167427073 19:49434800-49434822 TGACACAGCCATAGTGGACGCGG + Exonic
932312562 2:70755382-70755404 TGCTTTAGCCAGAGTGGTCAGGG - Intronic
933443754 2:82350174-82350196 TCCCAAAGCCGAAGTGGGCATGG - Intergenic
939755058 2:146099999-146100021 TGCCAAAGACAAGGTGGGCATGG + Intergenic
941978123 2:171427673-171427695 TGCTTTAGCCAGAGTGGTCAGGG - Intronic
944335742 2:198531742-198531764 TGCCTTAGTCATAGTGGTTAAGG + Intronic
946632931 2:221690853-221690875 TGGCAGAGCCAAAGTAGGCAGGG + Intergenic
947527217 2:230886125-230886147 TGACATGGCCAGGGTGGGCAGGG - Intergenic
1176022369 20:62968297-62968319 CGCCATGGCCATGCTGGGCAGGG - Exonic
1179458439 21:41515886-41515908 TGCCAAAGGCAAGGTGGGCATGG - Intronic
1182647143 22:31819346-31819368 TGGGATGGCCAAAGTGGGCATGG - Intronic
1185129250 22:49028318-49028340 TGGCAGAGCCAGAGTGGACAAGG + Intergenic
950446573 3:13042241-13042263 TCCCATTGCCCTAGTGGCCAAGG + Intronic
951527716 3:23669825-23669847 TGCCATGGTAATACTGGGCATGG - Intergenic
953215016 3:40909852-40909874 TGCCACTGCCATAGTGGGCCAGG + Intergenic
954216188 3:49125762-49125784 GGCCAAAGCCATAGTAGCCAGGG + Exonic
958889811 3:99770926-99770948 TGCCTTCGCCAGAGTGGTCAAGG + Intronic
961653848 3:128430776-128430798 ATCCTTAGCCAAAGTGGGCACGG + Intergenic
961663029 3:128480471-128480493 AGCCAAAGCCAGAGTGGCCACGG - Exonic
965388973 3:168081381-168081403 TTCCATGGACATAGTAGGCAGGG + Intronic
977711940 4:100136261-100136283 GGACATAGCCAAAGTGGTCAAGG + Intergenic
977978572 4:103296111-103296133 GGACATAGGCATGGTGGGCAAGG + Intergenic
981020790 4:140025959-140025981 TGACATAGCCACAGTGATCAGGG - Intronic
981049152 4:140293791-140293813 TTCCATCACCATAGTGGCCATGG - Intronic
981126868 4:141117173-141117195 TACCATATCCATAGGTGGCAAGG + Intronic
981311159 4:143299278-143299300 TGGCAGAGCCAAGGTGGGCAGGG - Intergenic
985987966 5:3533298-3533320 TGCCATAGACATTTTGGGCCGGG - Intergenic
989203890 5:38792652-38792674 TGCTGTAGACATAGTGGGCCTGG + Intergenic
994017913 5:94989894-94989916 TGTCACAGCCAGAGAGGGCATGG + Intronic
997434072 5:133861584-133861606 TGCCAAAGCCATGGTGGGGGTGG - Intergenic
1005887479 6:30107809-30107831 TGCGAGAGCCATAGAGGGCCTGG - Intronic
1007094594 6:39205496-39205518 GGCCATAGCCACCCTGGGCAGGG - Intronic
1010028595 6:71248326-71248348 TTCCATACCCATATTAGGCAAGG + Intergenic
1012217806 6:96609814-96609836 TGCCATGGCCATAGTGAGCTAGG - Intronic
1015206241 6:130642746-130642768 CTCCATAGCCATACTTGGCATGG + Intergenic
1016017903 6:139204932-139204954 TGCCACAGCCACTGTGGGGATGG - Intergenic
1018465002 6:164035823-164035845 TCCCAGAGCCACAGTGGTCAGGG + Intergenic
1023844822 7:44114656-44114678 TCCCATAGCCAGAGTGCCCAGGG + Intergenic
1025071320 7:55901655-55901677 TGCCATGCCCAGAGAGGGCATGG + Intronic
1026245215 7:68613556-68613578 TTACATAGCCATAGCGTGCAGGG - Intergenic
1027429455 7:78095325-78095347 TGGAATATCCATAGTGGGGAAGG - Intronic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1028197129 7:87920236-87920258 TGCCATGGCCACTGTGGGGATGG - Intergenic
1031535929 7:122932614-122932636 GGCCCTGGCCATGGTGGGCAGGG - Intergenic
1036687007 8:10918460-10918482 TGCCATGGCCAAGCTGGGCATGG - Intronic
1036752834 8:11454199-11454221 TGCCAAAGCCAGGGTGGGCTTGG + Intronic
1038053247 8:23833248-23833270 TGCCATAGCCATTGAGCTCAAGG + Intergenic
1039536932 8:38324908-38324930 TGGCATGGCCAGAGAGGGCATGG + Intronic
1039664892 8:39514572-39514594 GGCAATAGCCAAAGTGGGTAAGG - Intergenic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1044030776 8:87233758-87233780 TGCCACAGCCAAACTGGGCATGG - Intronic
1044110710 8:88269405-88269427 AGCCATAACAAAAGTGGGCAAGG + Intronic
1047525620 8:125631901-125631923 TAAAATAGGCATAGTGGGCAGGG - Intergenic
1048504424 8:135007957-135007979 TCCCACAGCCAGAGTGGGAATGG - Intergenic
1051151707 9:14086922-14086944 TGACAGATCCATAGTGTGCATGG - Intronic
1052100919 9:24445521-24445543 GGCCATAGCCAGATTGGCCATGG + Intergenic
1052464174 9:28809030-28809052 TGACATAGATATAGGGGGCATGG + Intergenic
1052802305 9:32980393-32980415 TGCCAGAGCCACATTGGACAAGG - Intronic
1054792624 9:69270033-69270055 TGCCAAAGACATGGTGAGCACGG - Intergenic
1055062293 9:72082337-72082359 TGCCAGAGCCATAAGGAGCAGGG - Intergenic
1055193521 9:73557747-73557769 TGGCACAGTCATAGTAGGCAGGG - Intergenic
1055487211 9:76767857-76767879 GAGAATAGCCATAGTGGGCATGG - Intronic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1058447175 9:105064482-105064504 TGCCAGAAGCATAGTGGGGAAGG + Intergenic
1194920346 X:99758060-99758082 TGCCATAGCCCTTGGTGGCAAGG - Intergenic
1195541595 X:106068638-106068660 TCCCAGAGACATAGTGGGCCAGG + Intergenic
1195927256 X:110038412-110038434 TCCCTGAGCCAAAGTGGGCATGG - Intronic
1196114658 X:111985839-111985861 TGCCAAAGACAAGGTGGGCATGG - Intronic
1196750813 X:119115873-119115895 TGCTATAGTCACAGGGGGCATGG - Intronic