ID: 1084971072

View in Genome Browser
Species Human (GRCh38)
Location 11:72772326-72772348
Sequence TGCCATAGCCACAGTGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 235}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084971062_1084971072 21 Left 1084971062 11:72772282-72772304 CCCGGTGCTGCCATAGTGGGCAT 0: 1
1: 2
2: 2
3: 8
4: 107
Right 1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG 0: 1
1: 1
2: 0
3: 14
4: 235
1084971067_1084971072 -9 Left 1084971067 11:72772312-72772334 CCTGTGCCCAGTGCTGCCATAGC 0: 1
1: 0
2: 6
3: 17
4: 249
Right 1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG 0: 1
1: 1
2: 0
3: 14
4: 235
1084971059_1084971072 27 Left 1084971059 11:72772276-72772298 CCTGTGCCCGGTGCTGCCATAGT 0: 2
1: 1
2: 1
3: 12
4: 99
Right 1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG 0: 1
1: 1
2: 0
3: 14
4: 235
1084971066_1084971072 -8 Left 1084971066 11:72772311-72772333 CCCTGTGCCCAGTGCTGCCATAG 0: 1
1: 4
2: 3
3: 22
4: 256
Right 1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG 0: 1
1: 1
2: 0
3: 14
4: 235
1084971065_1084971072 11 Left 1084971065 11:72772292-72772314 CCATAGTGGGCATGGCTCTCCCT 0: 1
1: 1
2: 4
3: 18
4: 150
Right 1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG 0: 1
1: 1
2: 0
3: 14
4: 235
1084971063_1084971072 20 Left 1084971063 11:72772283-72772305 CCGGTGCTGCCATAGTGGGCATG 0: 1
1: 2
2: 1
3: 13
4: 127
Right 1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG 0: 1
1: 1
2: 0
3: 14
4: 235
1084971058_1084971072 28 Left 1084971058 11:72772275-72772297 CCCTGTGCCCGGTGCTGCCATAG 0: 3
1: 1
2: 6
3: 19
4: 153
Right 1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG 0: 1
1: 1
2: 0
3: 14
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084971072 Original CRISPR TGCCATAGCCACAGTGGGCA CGG Intronic
900088992 1:911125-911147 TGGCACAGCCACAGTGGGGCGGG - Intergenic
900280368 1:1863423-1863445 GGCAGCAGCCACAGTGGGCAAGG - Intronic
900392213 1:2438635-2438657 TGCCCTAGCCGCAGTGGCCGGGG - Intronic
900689796 1:3973649-3973671 TGCCCTAGACACTGTGGGGAAGG - Intergenic
902470633 1:16645765-16645787 AGCCAGAGGCTCAGTGGGCATGG + Intergenic
902488170 1:16761695-16761717 AGCCAGAGGCTCAGTGGGCATGG - Intronic
904786583 1:32987533-32987555 TGCCATTGCCTCAGTGGGGCAGG - Intergenic
905272720 1:36797448-36797470 TGCCATGGGGACAGAGGGCACGG + Exonic
905466587 1:38158944-38158966 TGGCATAGGCACCATGGGCAAGG - Intergenic
906208494 1:43999533-43999555 GGCCATAGCCCCAGAAGGCATGG + Intronic
906594946 1:47067637-47067659 GGCCATAGAACCAGTGGGCAGGG - Exonic
907522595 1:55033941-55033963 TCCCATAGCCCCAGAGGGCAAGG - Intergenic
907806152 1:57822381-57822403 TGCCATGGCCACACTGGTTAGGG + Intronic
911035124 1:93534848-93534870 TGCCAAAACCACAGTAGGAAAGG + Exonic
916988499 1:170216883-170216905 TGCCGGAGCCCCAGAGGGCAAGG - Intergenic
917283001 1:173397012-173397034 TGCCAAAGACAAGGTGGGCATGG + Intergenic
917394808 1:174581940-174581962 TGCCATTACCACAGTGGGGTAGG + Intronic
919430585 1:197486864-197486886 TGCCACGGCCACTGTGGGGATGG - Intergenic
920533768 1:206723888-206723910 TGCCCCTGCCACAGTTGGCAGGG + Intronic
920590574 1:207214880-207214902 GGCCATAGACACAGTGGAGATGG + Intergenic
921219535 1:212963328-212963350 TGCAGTGGCCCCAGTGGGCAGGG - Intronic
921632923 1:217456222-217456244 TCCCAAAGCCCAAGTGGGCATGG - Intronic
922180103 1:223226756-223226778 TGACATGGCCACAGAAGGCAAGG + Intronic
922749532 1:228064089-228064111 TGCTAGGGCCACAGTGGGGATGG - Intergenic
1062878919 10:962843-962865 TGCCGTAGCCTCAGTGAGCTCGG + Intergenic
1062924944 10:1309349-1309371 TGACAAGGCCACAGTCGGCATGG - Intronic
1066279939 10:33906589-33906611 TGTCTTAGCCCCAGTGGGGAAGG + Intergenic
1068182147 10:53534612-53534634 TGCAATAGGCACAGTGGAGATGG + Intergenic
1070680156 10:78443414-78443436 TGTCATAGACGCAGTGGTCAGGG - Intergenic
1072896585 10:99372407-99372429 TGCAAGAGCAAGAGTGGGCAAGG + Intronic
1073348657 10:102803201-102803223 TGCCACTGCCACAGTGGAAAAGG - Intronic
1073947921 10:108773544-108773566 TGGCATAGCCAGAGAGAGCATGG - Intergenic
1075138210 10:119806450-119806472 TGCCATCGCGAGAGTGGTCATGG + Exonic
1075275008 10:121085506-121085528 GGCCACAGCCACAATGGGCGGGG - Intergenic
1075343819 10:121667791-121667813 TGTCATAGACACAGTGGCCAGGG - Intergenic
1077555093 11:3222154-3222176 AGCCTCAGCCACAGTGCGCAAGG + Intergenic
1078525193 11:12095455-12095477 TGCTGTCGCCACTGTGGGCAGGG + Intronic
1081591760 11:44427960-44427982 TGCCATCGCCATATTGGGGAAGG - Intergenic
1082000145 11:47389715-47389737 TGCCCCAGCCCCAGTGGCCAGGG + Intergenic
1082078213 11:47991345-47991367 AGCCATAGCCAGAGTTGGCCAGG - Intronic
1082926315 11:58551103-58551125 TGGCATTGCCACAGTGCCCAAGG - Exonic
1084971027 11:72772135-72772157 TGGCACTGCCATAGTGGGCATGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1088577411 11:111285277-111285299 TGCCATTTACACAGTGGGGAAGG - Intronic
1090289414 11:125528768-125528790 TGCCATACCCAGAGAGGGCATGG + Intergenic
1091795289 12:3294493-3294515 TGCCAGAGCCAGCCTGGGCAGGG - Intergenic
1099134030 12:78871462-78871484 TGCCATACAAACAGTGGACATGG + Intronic
1102057860 12:109910266-109910288 TGCCCTGACCGCAGTGGGCAGGG - Intronic
1102591206 12:113958151-113958173 GGCCATGGACACGGTGGGCATGG - Intronic
1102953854 12:117046946-117046968 TGCCAAAGCCAGAGGGGTCAGGG + Intronic
1103322197 12:120098781-120098803 TGGCAGAGCCACAGTGGCCCAGG + Intronic
1103590705 12:121990243-121990265 TGCCATGCACACAGTGGCCAGGG - Intronic
1104715950 12:131016301-131016323 TGCCAAGGCCACTGCGGGCAGGG - Intronic
1105453645 13:20521592-20521614 CGCAATAGTCACAGTGGGAAGGG - Intronic
1106310158 13:28547175-28547197 TGCCATAGCTACTATGGGGAAGG + Intergenic
1109205412 13:59477791-59477813 TGACATGCCCAGAGTGGGCATGG + Intergenic
1109792123 13:67262752-67262774 TGCCCTAGCCAGAGTGGGGAGGG - Intergenic
1110614385 13:77524757-77524779 AGCCATAGCCACCATGGGAAAGG - Intergenic
1112327769 13:98454719-98454741 TGCCAAAACCACGGTGGCCATGG - Intronic
1113499795 13:110764259-110764281 TGCCAGAGCCACAGAGTCCAAGG + Intergenic
1114678231 14:24459958-24459980 GGCCACAGCCACAGTGGAGATGG - Intergenic
1114756841 14:25269349-25269371 TGCTATGGCCACTGTGGGGATGG + Intergenic
1116742644 14:48776435-48776457 AGCCATGGCCATAGTTGGCATGG - Intergenic
1117199443 14:53373267-53373289 TGCAATAGGCACAGGAGGCAGGG + Intergenic
1121549685 14:94789412-94789434 TGCCATAGTCATGATGGGCAAGG - Intergenic
1122232531 14:100313875-100313897 TCCCATTGTCACAGTGGGTATGG + Intergenic
1124140461 15:27072753-27072775 TGCCAGAGGCACTGTGGGCCAGG + Intronic
1125725837 15:41867713-41867735 TGCCATACCCAGAGTGCCCATGG - Intronic
1127052987 15:55104031-55104053 TCCCATTGCCACAGTGCACATGG - Intergenic
1127377855 15:58401671-58401693 TCCCATGGCCACTGTGAGCAGGG - Intronic
1130715571 15:86330110-86330132 GGCAGCAGCCACAGTGGGCAGGG - Intronic
1132294522 15:100725721-100725743 GGACATAGCCACAGAGGCCAAGG + Intergenic
1132425065 15:101709266-101709288 TTCCATAGCCAGTGAGGGCAGGG - Intronic
1132871177 16:2116446-2116468 GGCGAGACCCACAGTGGGCAGGG + Intronic
1134521350 16:14920448-14920470 GGCGAGACCCACAGTGGGCAGGG - Intronic
1134709025 16:16319099-16319121 GGCGAGACCCACAGTGGGCAGGG - Intergenic
1134950580 16:18349546-18349568 GGCGAGACCCACAGTGGGCAGGG + Intergenic
1136271579 16:29151955-29151977 TGCCAGGGCCGCACTGGGCAGGG + Intergenic
1136925449 16:34368574-34368596 TGCCAAAGCCACACTGTGGAGGG + Intergenic
1136979125 16:35043232-35043254 TGCCAAAGCCACACTGTGGAGGG - Intergenic
1138476027 16:57271034-57271056 TGCCATAGCCCCAGGAAGCAGGG - Intronic
1138482231 16:57311054-57311076 AGCCAGAGACACGGTGGGCAGGG + Intergenic
1139212361 16:65092106-65092128 TGCCATAGTCATAGATGGCAGGG + Intronic
1140069172 16:71634400-71634422 GGCCATTGCCACAGTGACCATGG - Intronic
1141485991 16:84340731-84340753 TTCCACAGCCACAGGGAGCAGGG + Intergenic
1141724776 16:85780559-85780581 TGCCCCAGCCAGCGTGGGCACGG - Intronic
1141761911 16:86034133-86034155 TGCCATTGCCAGGCTGGGCAAGG + Intergenic
1142075194 16:88113939-88113961 TGCCAGGGCCGCACTGGGCAGGG + Intronic
1142102994 16:88285478-88285500 TGCCACAGCCAGCGTGGGCAGGG + Intergenic
1142277921 16:89132668-89132690 TGCCCCAGCCCCTGTGGGCAAGG + Intronic
1144414097 17:15029875-15029897 TGGCTTGGCCACTGTGGGCAGGG - Intergenic
1144468324 17:15515097-15515119 GCCCATACCCACAGTGGGCATGG + Intronic
1146455301 17:33004869-33004891 TGCCATAGGCACAGAGGTGATGG - Intergenic
1147545685 17:41399585-41399607 AGCCAAAGCCACAGTGGAGATGG - Intergenic
1148474292 17:47916835-47916857 AGCCACAGCCACAGGGGGCTGGG - Exonic
1150160465 17:62893850-62893872 TGCCATTGCCAGAGTGGACTGGG - Intergenic
1153110524 18:1580858-1580880 TGCCAAAGACACACTGGGGATGG + Intergenic
1153754239 18:8263789-8263811 TGGCACATCCACAGAGGGCATGG + Intronic
1156438420 18:37158513-37158535 GGCCATAGTCACAGAGGGGATGG + Intronic
1157370184 18:47103730-47103752 GGCCATGGAAACAGTGGGCATGG - Intergenic
1158227136 18:55213184-55213206 TGCCAAAGGCAAGGTGGGCAAGG - Intergenic
1159721583 18:71898486-71898508 TGGCATTGCTACGGTGGGCAAGG + Intergenic
1160435328 18:78847674-78847696 TGCCCTCGCCACTGTGGCCATGG - Intergenic
1160870906 19:1277423-1277445 GGCCATGGCCCCACTGGGCAGGG + Intronic
1161580440 19:5077804-5077826 TGCCAAAGAAACAGAGGGCAGGG + Intronic
1163634276 19:18431175-18431197 TGCAGTAGCCACAGTGGTCCTGG + Intronic
1164644039 19:29845025-29845047 GGCCAGAGCAACAGTGGGCGGGG + Intergenic
1165377708 19:35454793-35454815 TGCCATGGCCACAGTAAACATGG + Intergenic
1165448093 19:35867909-35867931 TGCTGCATCCACAGTGGGCATGG + Intronic
1202703028 1_KI270713v1_random:2545-2567 AGCCAGAGGCTCAGTGGGCATGG + Intergenic
926058956 2:9793341-9793363 TCCCTTAGCCTCAGGGGGCAGGG - Intergenic
927252004 2:21004322-21004344 AGCCGTAGGCACCGTGGGCATGG - Exonic
928108893 2:28490588-28490610 TGCCACTGCCACGGTGGGGAAGG + Intronic
929443685 2:41986316-41986338 TGCCAGAGCCCCTGAGGGCAAGG + Intergenic
930026933 2:47034711-47034733 TCCCCTCTCCACAGTGGGCAAGG + Intronic
932055065 2:68435000-68435022 TGGCAAAAGCACAGTGGGCATGG + Intergenic
932312562 2:70755382-70755404 TGCTTTAGCCAGAGTGGTCAGGG - Intronic
933443754 2:82350174-82350196 TCCCAAAGCCGAAGTGGGCATGG - Intergenic
933629431 2:84639131-84639153 CCCCATACCCACTGTGGGCATGG + Intronic
937851710 2:126642147-126642169 TGCCAGAGCCACAGGGGTCTGGG - Intergenic
939036241 2:137134584-137134606 TTCCATAGTCACATGGGGCAAGG + Intronic
939665451 2:144945794-144945816 TGTCATAGCCACTGTAGGAAGGG - Intergenic
939755058 2:146099999-146100021 TGCCAAAGACAAGGTGGGCATGG + Intergenic
940866907 2:158826302-158826324 TGCCAGAGCCACGGGGGACAAGG + Intronic
941978123 2:171427673-171427695 TGCTTTAGCCAGAGTGGTCAGGG - Intronic
942312578 2:174669146-174669168 TGCCATGGCCACAGAAGTCAGGG - Intronic
942617946 2:177813998-177814020 TCCCTTAGCCACAGTGGAAAAGG + Intronic
946338987 2:219056549-219056571 TGCAGTAGACACAGTTGGCAGGG + Intronic
946632931 2:221690853-221690875 TGGCAGAGCCAAAGTAGGCAGGG + Intergenic
947527217 2:230886125-230886147 TGACATGGCCAGGGTGGGCAGGG - Intergenic
947639237 2:231697040-231697062 TGCCCCAGCCACAGTGGGACAGG - Intergenic
947709977 2:232307870-232307892 TGCCAAGGCCACAGAGGTCAAGG + Intronic
947874424 2:233459005-233459027 TGTCAAAGCCGCAGTGGGGACGG + Intronic
948556856 2:238817992-238818014 TGCCACAGCCCCACTGGGCCTGG - Intergenic
1169996950 20:11569210-11569232 AGCCAAAGCCACAGAGAGCAGGG - Intergenic
1171023708 20:21609751-21609773 TGCCATGACCACAGTGGGTTGGG + Intergenic
1172020096 20:31908051-31908073 TGCCATGTCCTCAGTGAGCAAGG + Intronic
1173224811 20:41156254-41156276 TACCATAGCCACATTTGGAATGG + Intronic
1174938489 20:54898161-54898183 TGGCTTAGCCACAGTGGGATAGG + Intergenic
1175457769 20:59128192-59128214 TGCAATAGTCACAGTGAGGAGGG + Intergenic
1178217263 21:30613724-30613746 AGCCATAGCCACAGAGGGAGCGG + Exonic
1179247057 21:39643088-39643110 TGGGATAGACACAGTGGGGAGGG + Intronic
1179275606 21:39889119-39889141 TGCCAGATCCACAGGGGACAAGG - Intronic
1179458439 21:41515886-41515908 TGCCAAAGGCAAGGTGGGCATGG - Intronic
1181056786 22:20264014-20264036 TGTCAAAGCCTCAGTGGGCTAGG + Intronic
1182647143 22:31819346-31819368 TGGGATGGCCAAAGTGGGCATGG - Intronic
1183590819 22:38778374-38778396 AGGCATAGCCCCAGTGGACATGG - Intronic
1184238816 22:43200832-43200854 TGCCCTGGGCACACTGGGCATGG + Exonic
1184300433 22:43555678-43555700 TGACCTCCCCACAGTGGGCACGG + Intronic
1184415302 22:44348779-44348801 TCCCATTGCCCCAGTAGGCAAGG + Intergenic
1185129250 22:49028318-49028340 TGGCAGAGCCAGAGTGGACAAGG + Intergenic
950333318 3:12174416-12174438 TGCCCTAGCCACACTGGTAAGGG + Intronic
953147300 3:40290657-40290679 TGGCTTGTCCACAGTGGGCATGG - Intergenic
953215016 3:40909852-40909874 TGCCACTGCCATAGTGGGCCAGG + Intergenic
954298797 3:49688489-49688511 AGCCAGAGGCTCAGTGGGCATGG - Intronic
954387482 3:50251906-50251928 TGGCAGGGCCACAGTGGTCAAGG - Intronic
954631707 3:52051255-52051277 TGCCCTACCCACACTGGGCTTGG - Intronic
954637736 3:52080456-52080478 TACCTCAGCCACAGTGGGAATGG + Intronic
958889811 3:99770926-99770948 TGCCTTCGCCAGAGTGGTCAAGG + Intronic
960588743 3:119345384-119345406 TGCCATAACCCCAGTGTGCTGGG - Intronic
961343091 3:126243457-126243479 TCTCAAAGCCCCAGTGGGCATGG + Intergenic
961623816 3:128245369-128245391 TGCTACAGCCACAGAGGGGATGG - Intronic
961629567 3:128286232-128286254 TGCCAGAGCCACAAAGGGAAGGG - Intronic
961653848 3:128430776-128430798 ATCCTTAGCCAAAGTGGGCACGG + Intergenic
961663029 3:128480471-128480493 AGCCAAAGCCAGAGTGGCCACGG - Exonic
963299609 3:143584111-143584133 AGCCAGAGCCACAGAGGGGAGGG - Intronic
967636732 3:191809734-191809756 TGCCATAGGCACAGTGTTGATGG + Intergenic
968566477 4:1316216-1316238 AGCTGTAGCCACAGAGGGCAAGG - Intronic
971232329 4:24809693-24809715 TGACAGAGCCACAGTGGGACTGG + Intronic
974402640 4:61425815-61425837 TACCATAGCCCCAGGGGGGAGGG - Intronic
977711940 4:100136261-100136283 GGACATAGCCAAAGTGGTCAAGG + Intergenic
979810139 4:125026690-125026712 GGCAAAAGTCACAGTGGGCAGGG + Intergenic
980342958 4:131574891-131574913 TGCCATATCTGCAGTGGGAAAGG + Intergenic
981020790 4:140025959-140025981 TGACATAGCCACAGTGATCAGGG - Intronic
981311159 4:143299278-143299300 TGGCAGAGCCAAGGTGGGCAGGG - Intergenic
990005375 5:50938940-50938962 TACCATAGCCACTGTGGGTGTGG - Intergenic
991016217 5:61935367-61935389 AGCTATAGCCCCAGTGGGTATGG - Intergenic
992206295 5:74433590-74433612 TACCATATCCACAGCGGGGAGGG - Intergenic
993200197 5:84806036-84806058 TGCCATAGCCACATGTGCCACGG + Intergenic
994017913 5:94989894-94989916 TGTCACAGCCAGAGAGGGCATGG + Intronic
996520510 5:124420786-124420808 TGCATTAGCCTCAGTGGCCATGG + Intergenic
997653139 5:135536609-135536631 TGCCAGAGGCACAGGGCGCAGGG + Intergenic
1001667063 5:173442007-173442029 TGCCATGGCCTCAGGGAGCATGG - Intergenic
1004291080 6:14368141-14368163 TAGAAAAGCCACAGTGGGCAGGG + Intergenic
1005915872 6:30351137-30351159 TGTCAAGGTCACAGTGGGCAGGG - Intergenic
1007094594 6:39205496-39205518 GGCCATAGCCACCCTGGGCAGGG - Intronic
1010127013 6:72444308-72444330 TCCTGAAGCCACAGTGGGCAGGG + Intergenic
1011523635 6:88238998-88239020 AGCGATAGAGACAGTGGGCAGGG + Intergenic
1012217806 6:96609814-96609836 TGCCATGGCCATAGTGAGCTAGG - Intronic
1016017903 6:139204932-139204954 TGCCACAGCCACTGTGGGGATGG - Intergenic
1017403525 6:154091906-154091928 ATCCATGACCACAGTGGGCAAGG - Intronic
1018399138 6:163404909-163404931 TGCCCTAGAAACAGTGGGCCTGG - Intergenic
1018465002 6:164035823-164035845 TCCCAGAGCCACAGTGGTCAGGG + Intergenic
1019161197 6:170067934-170067956 GGCCTTTGCCACAGTGGCCAGGG - Intergenic
1019261790 7:86071-86093 TGACAACGCCACAGTGTGCAGGG + Intergenic
1022227363 7:28377011-28377033 AGGCATTGCCACAGAGGGCATGG - Intronic
1023844822 7:44114656-44114678 TCCCATAGCCAGAGTGCCCAGGG + Intergenic
1024674095 7:51622675-51622697 TGCCATACCCACAGAGGACTTGG - Intergenic
1024889666 7:54185595-54185617 AGCCACAGCCACAGTGGCAAAGG + Intergenic
1025071320 7:55901655-55901677 TGCCATGCCCAGAGAGGGCATGG + Intronic
1027426082 7:78062609-78062631 TGACAAAGCCACATTGGACAGGG - Intronic
1028197129 7:87920236-87920258 TGCCATGGCCACTGTGGGGATGG - Intergenic
1029043431 7:97601387-97601409 TGGCACACCCACAGTGGGAAGGG + Intergenic
1030113876 7:106048887-106048909 TGCATTAGCTACAGTGTGCACGG - Intergenic
1032091073 7:128911832-128911854 AGCCTTTGCCACAGGGGGCAGGG + Intergenic
1033967882 7:147000589-147000611 TGCAATAGCTGCAGTGGTCACGG - Intronic
1034232604 7:149543637-149543659 TGCCACAGCCTCAGTAAGCAGGG - Intergenic
1034483000 7:151337535-151337557 TGCCATAGTCACTGTGAGAAAGG + Intergenic
1035388718 7:158490927-158490949 TGCCAGACACACAGAGGGCATGG - Intronic
1036687007 8:10918460-10918482 TGCCATGGCCAAGCTGGGCATGG - Intronic
1036696221 8:10976869-10976891 TGCCTGAGCCCCAGTGGGCTGGG + Intronic
1036730457 8:11258641-11258663 TGGCCCAGACACAGTGGGCATGG + Intergenic
1036752834 8:11454199-11454221 TGCCAAAGCCAGGGTGGGCTTGG + Intronic
1039536932 8:38324908-38324930 TGGCATGGCCAGAGAGGGCATGG + Intronic
1039664892 8:39514572-39514594 GGCAATAGCCAAAGTGGGTAAGG - Intergenic
1043598836 8:81915660-81915682 CGCCTAAGCCACAGTGGTCAGGG + Intergenic
1044030776 8:87233758-87233780 TGCCACAGCCAAACTGGGCATGG - Intronic
1044110710 8:88269405-88269427 AGCCATAACAAAAGTGGGCAAGG + Intronic
1044614973 8:94130662-94130684 TGGGATACCCACTGTGGGCATGG - Exonic
1046124150 8:109883075-109883097 TTCAATGGCCACATTGGGCATGG + Intergenic
1047665073 8:127082666-127082688 TGCCATATCCCCAGTGGAGATGG - Intergenic
1048036571 8:130682930-130682952 TGGCAGAGCCACAGGGAGCACGG - Intergenic
1048504424 8:135007957-135007979 TCCCACAGCCAGAGTGGGAATGG - Intergenic
1049808747 8:144553744-144553766 TGCCATCACCACACTGGCCAAGG + Intronic
1049917332 9:330889-330911 TGCCCTGGCTGCAGTGGGCAAGG - Intronic
1050710112 9:8451807-8451829 TGGCAGAGCCACAATGGGAAGGG - Intronic
1052100919 9:24445521-24445543 GGCCATAGCCAGATTGGCCATGG + Intergenic
1052802305 9:32980393-32980415 TGCCAGAGCCACATTGGACAAGG - Intronic
1053164080 9:35832492-35832514 AGCCATCCCCACAGTGGCCAGGG - Intronic
1053434801 9:38067877-38067899 TTCCAGAGCCACGGTGCGCACGG - Intronic
1053544356 9:39007708-39007730 TGGCATAGAGACAGAGGGCAGGG - Intergenic
1053808787 9:41831202-41831224 TGGCATAGAGACAGAGGGCAGGG - Intergenic
1054621805 9:67356226-67356248 TGGCATAGAGACAGAGGGCAGGG + Intergenic
1056465177 9:86846742-86846764 TGCTACAGACACAGAGGGCAGGG + Intergenic
1056915317 9:90741045-90741067 TGTGATAGTCACTGTGGGCATGG + Intergenic
1058906632 9:109487312-109487334 TGCTCTTGCCACAGTGGCCAGGG - Intronic
1059557326 9:115294418-115294440 TGCCATAGCATCAGTGAGGATGG - Intronic
1062003233 9:134227164-134227186 GGACATAGCTGCAGTGGGCAGGG + Intergenic
1188413084 X:29898278-29898300 TGCTATAGCTGCCGTGGGCATGG + Intronic
1189931251 X:46013562-46013584 AGCCACAACCACAGTGGGAATGG + Intergenic
1190023887 X:46904223-46904245 TGACATGGCAACAGTGGGGAGGG - Intergenic
1190640842 X:52481898-52481920 TGACATAGCCTCATTGGGAAGGG + Intergenic
1190646830 X:52530967-52530989 TGACATAGCCTCATTGGGAAGGG - Intergenic
1190732553 X:53234922-53234944 GGCCATAGCCACGGTGGCCTGGG - Exonic
1192800340 X:74459487-74459509 TGGCAGAGCCCCAGTGGGGAGGG - Intronic
1195927256 X:110038412-110038434 TCCCTGAGCCAAAGTGGGCATGG - Intronic
1196114658 X:111985839-111985861 TGCCAAAGACAAGGTGGGCATGG - Intronic
1196750813 X:119115873-119115895 TGCTATAGTCACAGGGGGCATGG - Intronic
1197703997 X:129620673-129620695 TGCCAAGGCCTCAGGGGGCAGGG - Intergenic
1200914518 Y:8559763-8559785 TGCCATCCCCACAGATGGCATGG + Intergenic