ID: 1084972709

View in Genome Browser
Species Human (GRCh38)
Location 11:72780533-72780555
Sequence CAGGGTGCAGAAAGCGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 454}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084972709 Original CRISPR CAGGGTGCAGAAAGCGGGGA AGG Intronic
900475608 1:2875004-2875026 CATGGCGCAGAAAGTGGGGCAGG + Intergenic
901738998 1:11330149-11330171 CAGGGAGCAGACAGCAGAGATGG - Intergenic
902161172 1:14531531-14531553 GAGGGTGTAGAATGTGGGGAAGG + Intergenic
902555076 1:17241987-17242009 CAGGTTGCAGGAGGTGGGGAGGG + Intronic
902723480 1:18320306-18320328 CGTGGTGCTGAAGGCGGGGAAGG - Intronic
902817345 1:18923892-18923914 GAGGGTGCAGAACTCGGGGCAGG - Intronic
903838176 1:26219481-26219503 CAGGATGCAGAGAGCTGGGTGGG + Intergenic
904021704 1:27471561-27471583 GAGGCTGCAGAAAGCCGAGATGG + Intronic
904675151 1:32194710-32194732 CATGGTGCAGAAAAGGGGCACGG - Intronic
905124529 1:35707790-35707812 GAGGGCGCACAAAGCAGGGAGGG - Intergenic
905409419 1:37757988-37758010 CAGGGTGGAGACAGAGGGGCTGG - Intronic
906619273 1:47261321-47261343 CAGGTTGCAGAGAGCTGAGATGG + Intronic
906695506 1:47820636-47820658 CAGGGTGCTGGAAGCAGTGAGGG - Intronic
907276046 1:53317144-53317166 CAGGGTCCAGGAAGTGGGGGAGG + Intronic
909222827 1:72984425-72984447 CAGGGTGCAGAAATAAGTGATGG + Intergenic
910459779 1:87436699-87436721 CAGGGAGCAGACAGCAGGAATGG - Intergenic
911449811 1:98048597-98048619 GAGGGTGGAGAAGGGGGGGAGGG - Intergenic
912540535 1:110411545-110411567 CAGGGCAGAGAAAGCGGGGGTGG - Intergenic
913703343 1:121396102-121396124 CGGGGTGCAAAAAGCGGCGGGGG - Intergenic
913938999 1:125085838-125085860 CGGGGTGCAAAAAGTGGCGAGGG + Intergenic
914827071 1:151144311-151144333 CAGGGAGCAGAAAGAGGGGCTGG - Intronic
915331421 1:155115072-155115094 GAGGTTGCAGAAAGGAGGGAAGG - Intergenic
916085913 1:161269238-161269260 CAGGGTGCTGAGGGTGGGGAAGG + Intronic
916361966 1:163980427-163980449 AAGGGTACAAAAAGCAGGGAGGG - Intergenic
916691840 1:167197507-167197529 CTGGTTGGAGAAAGAGGGGAAGG + Intergenic
917443160 1:175084383-175084405 CAGGGTGCAGTGAGCAGGGGTGG + Intronic
918228941 1:182510590-182510612 GAGGTTGCAGTGAGCGGGGATGG + Intronic
920053040 1:203174937-203174959 CAGTGAGGAGAAAGCGGGAATGG - Intronic
920237524 1:204518089-204518111 AAGGCTGCAGCAAGCCGGGATGG + Intronic
920915420 1:210254374-210254396 CAGGGAGCAGAAGGTGGGGCTGG - Intergenic
921254211 1:213325008-213325030 CTGGGTGCAGAAAGGGGGCAGGG - Intergenic
922453082 1:225752277-225752299 CAGGGGGAAGAAAATGGGGAGGG - Intergenic
923745960 1:236700522-236700544 CAGGGTGCAGTACGAGGAGAGGG - Intronic
923962587 1:239102312-239102334 CAGAGTGCAGAAATAAGGGATGG - Intergenic
1064425403 10:15225296-15225318 CTGGGTGCAGTAGGCAGGGAAGG + Intronic
1064553929 10:16529386-16529408 CAGGGTGGAGAGATAGGGGAAGG - Intergenic
1064949182 10:20827922-20827944 GAGGGTGAAGAAGGAGGGGAGGG + Intronic
1066750017 10:38645062-38645084 GAGGTTGCAGTAAGCTGGGATGG - Intergenic
1067306858 10:45072351-45072373 AAGGCTGCAGTGAGCGGGGATGG - Intergenic
1067467764 10:46513723-46513745 GATGTTGCAGAAAGTGGGGAGGG + Intergenic
1067619422 10:47870882-47870904 GATGTTGCAGAAAGTGGGGAGGG - Intergenic
1067905336 10:50284960-50284982 CAGGGTGAGGAAAGTTGGGAAGG - Intergenic
1068931340 10:62593689-62593711 CAGGCTGCAGTAAGCTGTGATGG - Intronic
1069635700 10:69923564-69923586 AAGGGTACAGAATGCAGGGAAGG + Intronic
1069743442 10:70700018-70700040 ACGGGTGCAGAAAGCGGGATGGG + Intronic
1069942926 10:71967316-71967338 GAGGGTGGAGACAGTGGGGAGGG - Intronic
1070253811 10:74796919-74796941 CAGGTTGCAGTAAGCCGAGATGG - Intergenic
1070312582 10:75284358-75284380 GAGGGAGCAGCAGGCGGGGAGGG + Intergenic
1070757975 10:79005298-79005320 CAGGGTGCAGCCAGCAGGCAGGG + Intergenic
1071268401 10:83984582-83984604 CAGGGAGAAGAAATCAGGGAAGG + Intergenic
1072475312 10:95754241-95754263 GAGGGTGCAGTAAGCTGAGATGG + Intronic
1073251227 10:102121246-102121268 AAGGCTGGAGAAAGGGGGGAAGG - Intergenic
1073285899 10:102387905-102387927 CAGGTTGCAGTAAGCCGAGATGG + Intergenic
1074137916 10:110644127-110644149 CTGGGCGCAGGAAGCGGGGAGGG - Intergenic
1074139993 10:110663416-110663438 CAGAGTGCAGAAAAAGCGGATGG + Intronic
1075070534 10:119317213-119317235 CAGGGTCCAGAAAGCACGGCAGG + Intronic
1075122239 10:119672558-119672580 CAGGGTGCATCGAGCCGGGAGGG + Exonic
1075311930 10:121421682-121421704 CAGGGGGCAGAAAGCGGGAGAGG - Intergenic
1075539481 10:123300120-123300142 CAGGGGACAGAAAGCTGGGTTGG + Intergenic
1075713399 10:124542649-124542671 CAGGGTGCACAGGGCTGGGATGG - Intronic
1077027631 11:448308-448330 CAGGGTGCAGAGGCCGGGGCGGG - Intronic
1077245273 11:1533929-1533951 GAGGTTGCAGTAAGTGGGGATGG - Intergenic
1077443755 11:2580769-2580791 CAGGCTGAAGAAAGCAGGGGTGG - Intronic
1077467363 11:2739796-2739818 CAGGGGACAGAGAGAGGGGAGGG + Intronic
1077702361 11:4454212-4454234 CTGGGTGCAGCAAGGAGGGAAGG - Intergenic
1077850958 11:6074434-6074456 CAGGGTGCGGAAATAAGGGATGG + Intergenic
1078421198 11:11214440-11214462 CAGGGGACAGAAAGCAAGGAAGG + Intergenic
1078548326 11:12262580-12262602 CGGGGTGCGGAAAGCGGGTTGGG - Intronic
1079928479 11:26526389-26526411 CAAGGTGCAGAAAACGGCCAAGG - Intronic
1080042069 11:27769470-27769492 CAGGGTGCAGAAAGGGTGGGAGG + Intergenic
1081193649 11:40135040-40135062 CAGAATGCAGATAGCAGGGATGG + Intronic
1081725845 11:45328555-45328577 CAGTGTGCGGAAAGCAGAGAGGG - Intergenic
1083372400 11:62192644-62192666 CAGGGAGAAGAAGGCAGGGAGGG + Intronic
1084068984 11:66721559-66721581 CGGGGTGAAGAAAGGGGTGATGG + Intronic
1084204200 11:67582203-67582225 CAGGGTGCAGGATGGGAGGAAGG - Intergenic
1084509866 11:69596878-69596900 CAGGGGACAGAATGCTGGGAGGG - Intergenic
1084945818 11:72637811-72637833 CAGGTTGGAGAAAGTGGTGAGGG + Intronic
1084972709 11:72780533-72780555 CAGGGTGCAGAAAGCGGGGAAGG + Intronic
1085280460 11:75326683-75326705 CAGTGTGTAGTAAGAGGGGATGG - Intronic
1085409903 11:76284693-76284715 CAGGGTGAAGACAGCAGGGCGGG + Intergenic
1086090241 11:82997983-82998005 CAAGGTGCAGAAGGGGTGGAAGG - Intronic
1086514384 11:87594965-87594987 CAGGGTGAAGAGTGAGGGGAGGG + Intergenic
1087102725 11:94380774-94380796 CTGGGGGCAGGAAGTGGGGAGGG + Intronic
1088318878 11:108534513-108534535 CAAGGTGCAGAGAGTGGAGAAGG - Intronic
1088428564 11:109731799-109731821 TAGGGTGGAGGGAGCGGGGAGGG + Intergenic
1088900804 11:114115614-114115636 CAGGCTTCAGAAAGACGGGAAGG - Intronic
1088911432 11:114195419-114195441 CAGGGAGCAGGAAAGGGGGATGG + Intronic
1089162640 11:116451286-116451308 CAGGCTGGGGAAAGTGGGGAAGG + Intergenic
1089329096 11:117677474-117677496 CAGGGGGCAGGGAGAGGGGAGGG + Intronic
1089384596 11:118059501-118059523 CAGAGTGCAGAATGTGTGGAAGG + Intergenic
1090773022 11:129938511-129938533 CAGGGTGGCAAAAGCGGGGATGG - Intronic
1091450003 12:566437-566459 CTGGCTGGAGAAAGCCGGGAGGG + Intronic
1091599705 12:1910449-1910471 CAGGATGTTGATAGCGGGGAAGG + Intronic
1091740975 12:2960012-2960034 CAGGGTGCGGGAAGGTGGGATGG - Exonic
1092409751 12:8243742-8243764 CAGGGTGTGGGAAACGGGGAGGG + Intergenic
1092842597 12:12557390-12557412 GAGGCTGCAGAAAGCCGAGATGG + Intronic
1093802247 12:23388510-23388532 GAGGGTGGAGAAAGGGAGGAGGG + Intergenic
1093884364 12:24442510-24442532 CAGGGAGCAGAGAGCGGGTGCGG + Intergenic
1094146706 12:27236412-27236434 CAGGCTGCAGTGAGCTGGGATGG - Intergenic
1094317564 12:29149691-29149713 CAAAGGGCAGAAAGCCGGGAAGG + Intronic
1095902339 12:47340972-47340994 AAGTGTGCAGAAAGCTGGCAGGG - Intergenic
1095976368 12:47943189-47943211 CAGGCTGCAGGGAGCGGGGCTGG + Intergenic
1096148214 12:49293581-49293603 CAGGACGCACAAAGGGGGGAGGG + Intronic
1096994623 12:55830872-55830894 CAGGGTGGAGAAAGGGGACAGGG - Intergenic
1098022466 12:66170100-66170122 CTGGGCGGAGAAAGCGGGGATGG + Intergenic
1098162068 12:67655378-67655400 GAGGGTGCAGAGAGCGAGGCTGG + Intronic
1098843691 12:75509651-75509673 CAGGCTGCAGTGAGCTGGGATGG - Intronic
1099723066 12:86389186-86389208 GAGGGTGCAGAATGGGAGGACGG - Intronic
1100023914 12:90104483-90104505 CAGTGTGCACAAAGCTGGGAAGG + Intergenic
1100602620 12:96124947-96124969 CAGCCTGCAGAAAGGGGAGAAGG + Intergenic
1101090913 12:101284233-101284255 GAGGGTGGAGGAAGTGGGGATGG - Intronic
1101563709 12:105884648-105884670 AATGGGGCAGAAAGCAGGGAAGG + Intergenic
1101898336 12:108772159-108772181 CAGGGCACAGAAAGTGGGCAGGG + Intergenic
1102028198 12:109725440-109725462 CAGGGTGCAGACCTAGGGGAGGG - Intronic
1102505959 12:113384785-113384807 CAGGGTGGGGAAAGCTGGGGAGG + Intronic
1102683089 12:114703779-114703801 TCAGGTGCAGAAAGCTGGGAGGG + Intergenic
1103349860 12:120276652-120276674 CTGGGTGTGGAAAGCGAGGACGG - Intergenic
1103446159 12:120996560-120996582 CAGGGTGCTGACAGGGGGGAGGG - Exonic
1104601290 12:130155541-130155563 GAGGCTGCAGAAAGTGGGAAGGG + Intergenic
1104815086 12:131640973-131640995 AAGGGTGCAGAATGCTGGGCAGG + Intergenic
1104896801 12:132168738-132168760 CAGGGAGCAGGATGCGGGGTTGG + Intergenic
1104896962 12:132169232-132169254 CAGGGGGGAGACAGCGGGGAGGG + Intergenic
1104896988 12:132169300-132169322 CAGGGGGGAGACAGCGGGGAGGG + Intergenic
1106042860 13:26110361-26110383 CGGGGTGGGGAAAGGGGGGAGGG + Intergenic
1106346815 13:28887312-28887334 CAGGGAGCCGAAAGGGGCGAGGG - Intronic
1109514069 13:63418039-63418061 CAGGGTGGGGAGAGGGGGGAGGG + Intergenic
1112030787 13:95454527-95454549 CAGGGTGGGGAGAGAGGGGAGGG - Intronic
1112069705 13:95836111-95836133 GAGGTTGCAGAGAGCGGAGATGG - Intronic
1112214609 13:97417376-97417398 CAGGGTGGAGAATGAGGTGAAGG - Intergenic
1112651034 13:101398778-101398800 CAGGGTGCACAGCGTGGGGAGGG + Intronic
1113538788 13:111090238-111090260 CAGGGTGCAGCAGGCTGGGTGGG + Intergenic
1113813774 13:113158203-113158225 GAGGAGGGAGAAAGCGGGGAAGG - Intergenic
1113885928 13:113658364-113658386 CAGGGTGAGGAAAGCGGGCCTGG - Intergenic
1113925245 13:113938351-113938373 CAGGGTGCTGAAGGCAGGGCTGG + Intergenic
1115677479 14:35695166-35695188 CAGGCTGCAGTAAGCTAGGATGG + Intronic
1115904636 14:38191907-38191929 CAGGGTGCAGAAATAAGGGATGG - Intergenic
1116330926 14:43596896-43596918 CAGGGTACAGAGAGCTGGAAAGG + Intergenic
1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG + Intronic
1119421603 14:74510740-74510762 CAGGGTTCAGAATGCTGGGAGGG - Intronic
1121455743 14:94038021-94038043 CAGAGTGCAGAGAGCGGCCAGGG - Intronic
1122037703 14:98960693-98960715 CTGGGTGCAGAAGGCAAGGAAGG - Intergenic
1122320546 14:100852717-100852739 AAGTGTGCAGAAGGCGGGGAAGG + Intergenic
1122873071 14:104650425-104650447 CAGGGAGAGGGAAGCGGGGATGG - Intergenic
1122883723 14:104701320-104701342 CAGGGAGCCGTCAGCGGGGAGGG - Intronic
1123398805 15:19963801-19963823 CAGGATGCAGATAGTGGAGAAGG + Intergenic
1123413188 15:20075874-20075896 ACGGGTGGGGAAAGCGGGGAGGG + Intergenic
1123522530 15:21082987-21083009 ACGGGTGGGGAAAGCGGGGAGGG + Intergenic
1123807714 15:23891991-23892013 AAGGCTCCAGAAAGCAGGGAAGG - Intergenic
1128806929 15:70538145-70538167 CAGGGAGCAGGAGGTGGGGAGGG - Intergenic
1130162227 15:81413488-81413510 CACAGTGCAGAAAGCAGGCATGG + Intergenic
1131506769 15:93026501-93026523 GAGGGTTCAGCAAGCGGGGTGGG - Exonic
1131788025 15:95933997-95934019 CAGGGTGCAGAGAGGGGGAGGGG - Intergenic
1132340955 15:101078462-101078484 CAGGGTGCAGAGAGGAAGGAAGG - Intergenic
1132540159 16:504744-504766 GAGGGTGCAGGAAGAGGTGAGGG - Intronic
1132690093 16:1178277-1178299 GAGGGTCCAGAAAGAGGGGGCGG - Intronic
1133183935 16:4081689-4081711 CAGGGTGCAGGAGGGGAGGAGGG + Intronic
1133422565 16:5659366-5659388 GAGGTTGCAGTGAGCGGGGATGG - Intergenic
1134179247 16:12034302-12034324 CAGGGAACCGAAAGCAGGGATGG - Intronic
1134379077 16:13707745-13707767 CATGGACCAGGAAGCGGGGAAGG - Intergenic
1134925705 16:18157603-18157625 GAGGGTGTAGAAGGAGGGGAGGG + Intergenic
1135062062 16:19279515-19279537 GAGGTTGCAGAAAGCTGAGATGG - Intergenic
1135164610 16:20128065-20128087 CAGGGGCCAGAGAGAGGGGAAGG - Intergenic
1135394823 16:22123195-22123217 TGGGGTGCAGAAAGTGGGGACGG + Intronic
1135405197 16:22192562-22192584 CAGGGAGAAGAAAGAGAGGAAGG - Intergenic
1135607438 16:23836430-23836452 CAGGGTGCGGAGGGCGCGGAGGG - Intronic
1135735834 16:24931203-24931225 CGGGGTGCTGAGAGCTGGGAGGG + Exonic
1135985444 16:27180447-27180469 CAGGGAGCTGAAACCGTGGATGG - Intergenic
1136699093 16:32116070-32116092 CGGGGTGCAAAAAGCGGCGGGGG - Intergenic
1137507621 16:49068219-49068241 CAGGGTGCTGAATGAGGAGATGG + Intergenic
1138617710 16:58184093-58184115 CAGGATGCAGAAAGTGGCTAGGG - Intronic
1140224567 16:73067226-73067248 CAGGCTGCGGAAAGAGGGGTCGG - Intergenic
1140444607 16:75015646-75015668 CAGGCTGCAGTAAGCGGTGATGG - Intronic
1141487461 16:84350314-84350336 GAGGGTGCAGACTGCGGGGCAGG + Intergenic
1141497515 16:84420165-84420187 CAGGGTGTACAGAGCAGGGAGGG - Intronic
1141643716 16:85356374-85356396 CAGGGGGCAGCACCCGGGGAGGG + Intergenic
1142046517 16:87928831-87928853 CAGGGTGCAGTGAGCCGAGATGG - Intronic
1143170802 17:4929090-4929112 CAGGTTGCAGTGAGCGGAGATGG + Intergenic
1143645761 17:8228965-8228987 AAGACTGCAGACAGCGGGGAGGG - Intronic
1144233315 17:13231110-13231132 GAGGGTGCAGGAAGAAGGGAAGG - Intergenic
1147744203 17:42685141-42685163 AAGTGTGCAGAGAGCGCGGAGGG + Intronic
1147791336 17:43015888-43015910 CAGAGGTCAGGAAGCGGGGAGGG + Exonic
1147993921 17:44351174-44351196 CAGGGTGCAGATACAGGGGTGGG + Intronic
1148102280 17:45099538-45099560 CAGGGGGCAGAGAGAGGGCAAGG + Intronic
1148605757 17:48927789-48927811 AAGGGTGAGGAAAGAGGGGAGGG - Exonic
1149995850 17:61405608-61405630 CAGGGTGCAGGAAGAGCGGCTGG - Exonic
1151195884 17:72430881-72430903 GGGGGTGCAGAAGGCAGGGAGGG - Intergenic
1151386243 17:73757105-73757127 CAAGGTGCAGACACCAGGGATGG + Intergenic
1151579760 17:74971468-74971490 CAGGGTGGGGAAAGGGGTGAGGG + Intronic
1152036249 17:77874901-77874923 AAGGGTGCAGGGAGAGGGGAGGG + Intergenic
1152036261 17:77874937-77874959 GAGGGTGCAGGGAGAGGGGATGG + Intergenic
1152612250 17:81321619-81321641 CAGAGTGAAGAAAGCTGGGGTGG - Intronic
1152676250 17:81642709-81642731 CAGGGTGCAGGAGGGGGTGAAGG + Intronic
1152683450 17:81682106-81682128 CAGGATGCAGAGAGCTGGGTGGG + Exonic
1152691973 17:81722436-81722458 CAGGGTGCAGAGGGTGGGGTGGG + Intergenic
1153180947 18:2432315-2432337 CAGGGTGGAGAATGGTGGGAAGG + Intergenic
1153791393 18:8582812-8582834 CAGGCTGCAGTAAGCCGTGATGG + Intergenic
1155285417 18:24283198-24283220 GAGGTTGCAGTAAGCGGAGATGG + Intronic
1156957998 18:42991974-42991996 CGGGGTGCAGAAATAAGGGATGG - Intronic
1157546323 18:48549146-48549168 CAGGGTGCACATAGGGGTGATGG + Intronic
1157600382 18:48889739-48889761 CAGGGTGCAGAGTGCGCGGCAGG - Intergenic
1157807915 18:50672147-50672169 CAGGGTGCAGGGAGTGGAGAAGG + Intronic
1157994998 18:52544482-52544504 CAGGAAGCAGACAGCAGGGAAGG - Intronic
1158015356 18:52776613-52776635 CAGGTTGCAGGAGGTGGGGATGG + Intronic
1158710753 18:59835900-59835922 CAGGGAGCAGAATGCGGGGAAGG + Intergenic
1160223287 18:76992625-76992647 CTGGGTGCTGAATGCTGGGAAGG - Intronic
1160492294 18:79348514-79348536 CAGCCTGCAGAGAGCCGGGAGGG - Intronic
1160814842 19:1030236-1030258 CCGGGTGCAGAAAGGTGGCAGGG + Intronic
1160906754 19:1455301-1455323 CAGGGTGCGGGAAGCGGCGTGGG + Intronic
1161123194 19:2541370-2541392 GAGGGTGCAGTGAGCTGGGATGG + Intronic
1161675709 19:5647370-5647392 CAAGGTGCAGAGAGATGGGATGG + Intronic
1162070454 19:8149379-8149401 AAGGGTGGAGAAGGCGGGGGCGG - Intronic
1162367212 19:10256835-10256857 CAGGGTGGAGGGGGCGGGGAGGG + Intronic
1162437077 19:10667558-10667580 CAGGGAGCAGAAAGTAGAGAAGG - Intronic
1163156734 19:15443839-15443861 GAGGGTGCAGAAGGCAGGGATGG - Intronic
1163167445 19:15508026-15508048 CAGGATCCAGAGAGAGGGGAAGG + Intergenic
1163318008 19:16554751-16554773 GAGGTTGCAGTAAGCTGGGATGG + Intronic
1163421262 19:17214893-17214915 CAGGCTACAGAAATCGGGAAGGG + Intergenic
1163453488 19:17392693-17392715 CAGGGGGCAGAAAAGGGGTAGGG + Intergenic
1163703525 19:18799062-18799084 GTGGCTGCAGCAAGCGGGGAGGG + Intergenic
1164917849 19:32066224-32066246 CAGGGTGCAGGAGGCGAGGCGGG - Intergenic
1165119965 19:33552648-33552670 GAGGGTGCTGAAGGCAGGGATGG - Intergenic
1165266131 19:34664874-34664896 GAGGATGAAGAAAGAGGGGAGGG - Intronic
1165479123 19:36051558-36051580 CAGGATGCAGGAAGAGGAGAGGG + Intronic
1166131748 19:40749827-40749849 AGAGGTTCAGAAAGCGGGGAGGG + Exonic
1166182660 19:41119874-41119896 GAGGGTGCAGCAAGCTGAGATGG + Intronic
1166856573 19:45785378-45785400 CAGGCAGCAGAAAGAGGGGTGGG - Intronic
1166988193 19:46674878-46674900 CTGGGTGCAGGAAGAGGGGGTGG - Intronic
1167697355 19:51023103-51023125 CAGCGTGCAGGAAGGGGGCAAGG - Exonic
1168493979 19:56835173-56835195 CAGGGTGCAGAAGGGGAGGGTGG - Intronic
925233052 2:2252818-2252840 AAGGGGGAAGAAAGAGGGGAAGG - Intronic
925402083 2:3582040-3582062 CAGGGTGAAGACAGCGGAAATGG - Intergenic
926231494 2:11007533-11007555 CCGGGTGCGGGGAGCGGGGAGGG + Intergenic
926312857 2:11686948-11686970 CAGGATTCAGAATGCTGGGAGGG - Intronic
926337408 2:11875053-11875075 CAGGGTGCTGGAGGCGGGGCAGG - Intergenic
927689962 2:25201650-25201672 CATGGGGCAGAAAGGTGGGATGG - Intergenic
928086161 2:28347712-28347734 CAGGGAAGAGAAAGCAGGGAGGG + Intergenic
928946510 2:36776728-36776750 GAGGGTGCAGTAAGCTGAGATGG + Intronic
930730445 2:54723679-54723701 CCGGGTGCGGGAGGCGGGGAGGG + Intronic
932338398 2:70943885-70943907 CAGGGAGGAGAAAGCTTGGACGG - Intronic
932457521 2:71858776-71858798 CAGGGTTCAGGGAGAGGGGAAGG - Intergenic
934261206 2:91478144-91478166 CAGGGGGCAAAAAGCCGCGACGG - Intergenic
934766257 2:96881734-96881756 CAGGGGGCAGGGAGGGGGGAGGG + Intronic
935061876 2:99615608-99615630 GAGGGAGCTGAAAGCGTGGATGG + Intronic
935496731 2:103791595-103791617 CAGGGGGTGGAAAGAGGGGATGG + Intergenic
935834104 2:107031534-107031556 TAGGGTGGAGGTAGCGGGGATGG - Intergenic
935948926 2:108311687-108311709 TAGGGTGCACACAGCAGGGAAGG - Intergenic
937703565 2:124891948-124891970 CAGGGAGAAGAAAGCAGGGACGG - Intronic
938387482 2:130877220-130877242 CATGGGGCAGAAAGTGGAGAGGG + Intronic
939728036 2:145747776-145747798 AAGGTTGCAGAAAACAGGGAAGG + Intergenic
939734379 2:145825908-145825930 AAGGTTGCAGAAAGCGAAGATGG - Intergenic
940359090 2:152778072-152778094 TGGGGTGGGGAAAGCGGGGAGGG + Intergenic
940816898 2:158306678-158306700 CAGGGTGGGGGAAGGGGGGAGGG + Intronic
941682945 2:168418588-168418610 AAGGGTGTGGAAAGTGGGGAGGG + Intergenic
942060745 2:172226594-172226616 CTGGGTGGAGAAGGCGGGGGCGG + Intergenic
942068599 2:172295042-172295064 CAGGTAGCAGAAAGCAGGAAGGG + Intergenic
942642362 2:178073007-178073029 AAGGGAGCAAGAAGCGGGGAAGG - Intronic
943308996 2:186303644-186303666 CAGGGTAGAGAAAGTTGGGAGGG - Intergenic
943984028 2:194595771-194595793 CAGGTTGGAGAAAATGGGGATGG - Intergenic
946344715 2:219099901-219099923 TAGGGCCCAGAAACCGGGGAAGG + Intronic
946893070 2:224297674-224297696 CGGGGTGCGGAAAGAAGGGATGG - Intergenic
947523709 2:230866086-230866108 CAGGGGGCAGAACGCGTGGCGGG + Intronic
948084137 2:235232387-235232409 CAGGGTGCAGGCAGCCGGGCTGG + Intergenic
948436784 2:237959194-237959216 GAGGCTGCAGAAAGCAAGGAAGG - Intergenic
948551942 2:238778651-238778673 CAGAGTGCAGAAAGCATAGAGGG - Intergenic
948665443 2:239531924-239531946 CAGGGTGCAAAAAGCCAGGCTGG - Intergenic
948795232 2:240399170-240399192 CAGGATGCAGACACCTGGGAAGG + Intergenic
949072366 2:242033329-242033351 CAGTGGGCAGAAGGAGGGGATGG + Intergenic
1168895433 20:1320439-1320461 CAGAGTGCAGAGGGTGGGGAAGG + Intronic
1170604191 20:17863644-17863666 CAGGGAGCACACAGCAGGGACGG - Intergenic
1170931550 20:20773406-20773428 CAGGGTGGAGAGAGTGGGGAAGG - Intergenic
1172216473 20:33239214-33239236 GAGAGTGCAGAAAGGGTGGAAGG - Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172394226 20:34588185-34588207 GAGGGTGCAGTGAGCGGAGATGG + Intronic
1172456903 20:35083543-35083565 GAGGTTGCAGAAAGCTGAGATGG + Intronic
1173167476 20:40695636-40695658 CAGGTTGAAGAAAGATGGGATGG - Intergenic
1173192342 20:40886245-40886267 CAGGGTTCAGAGAGCTGGGGAGG - Intergenic
1173848802 20:46204795-46204817 TAGGGTGGAGAAAATGGGGAGGG + Intronic
1174057111 20:47805750-47805772 CAGGGTCCAGAGAACGGAGAGGG + Intergenic
1174221960 20:48963109-48963131 GAGGTTGCAGTAAGCTGGGATGG + Intronic
1174388004 20:50198254-50198276 GAGGATGGAGAAAGCGGGGAGGG + Intergenic
1175069802 20:56323899-56323921 CAGGGTGGAGAAGGCGAGAAGGG - Intergenic
1175379933 20:58555951-58555973 CAGGGTACGGAAAGCCTGGATGG - Intergenic
1175544815 20:59771376-59771398 CAGTGTGCAGAAGCTGGGGATGG + Intronic
1175928210 20:62481088-62481110 CAGGGTGGAGACTGGGGGGAGGG - Intergenic
1176745492 21:10648544-10648566 CAGGATGCAGATAGTGGAGAAGG + Intergenic
1179453727 21:41483692-41483714 CCGGGTGCAGATAGCTGGAAGGG - Intronic
1179505795 21:41839529-41839551 CAGGGGGCAGAGGGCGGGGCGGG - Intronic
1179583817 21:42362126-42362148 CTGAGTGCAGAAAGCAGGGATGG - Intergenic
1179950978 21:44708718-44708740 CAGGGAGCAGCATTCGGGGAGGG - Intronic
1180319530 22:11307704-11307726 CAGGGTGCAGAGAGGGGTGGTGG + Intergenic
1180949762 22:19715704-19715726 CAGGGTGCAGCAGGCAGGGCAGG + Intronic
1181392423 22:22593450-22593472 CAGGGTGCAGGAGGCAGGGCAGG + Intergenic
1181404393 22:22672443-22672465 CAGGGTGCAGGAGGTGGGGCAGG + Intergenic
1181411045 22:22719969-22719991 CAGGGTGCAGGAGGCGGTGCAGG + Intergenic
1182138827 22:27933922-27933944 CAGGCTGCAGTAAGCAGTGATGG + Intergenic
1182351349 22:29701791-29701813 CAGGGTGCAGGTGGAGGGGATGG - Intergenic
1182977730 22:34639039-34639061 GAGGATGCAGAGAGAGGGGATGG - Intergenic
1183043151 22:35198381-35198403 CAGGGTGAAGAAGGGGGAGAGGG - Intergenic
1183177177 22:36232817-36232839 CAGGGTCCAGGAGGAGGGGAGGG - Intronic
1183620408 22:38968708-38968730 TAGGGTGCACAGAGCGGGGCTGG + Intronic
1183747082 22:39698232-39698254 CAGGCTGCAGGAAGCGCGGGAGG + Intergenic
1183751488 22:39723582-39723604 CAGGAGGCAGAAGGCGGGCACGG - Intergenic
1183953841 22:41367732-41367754 CAGGGTGCAGAGTGCGGAGAGGG + Intronic
1184871415 22:47241171-47241193 CGGGGTGGAGGGAGCGGGGAGGG - Intergenic
949362410 3:3245371-3245393 GAGGGTGCAGAGAGCTGAGATGG + Intergenic
949604337 3:5636906-5636928 CAGGGGGCAGAATGAGGGGGTGG - Intergenic
950261120 3:11544008-11544030 CAGACTGCACAAAGCAGGGAAGG - Intronic
950972290 3:17201435-17201457 CTTGGGGCAGAAAGCTGGGAGGG + Intronic
951305304 3:21053159-21053181 CAGGGTGGAGGAAGTGAGGAGGG + Intergenic
951399774 3:22217275-22217297 CAGGGAGCAGAAAAAGGGAAGGG - Intronic
951552941 3:23893732-23893754 GAGGGTGCAGTAAGCCGAGATGG + Intronic
953345564 3:42172508-42172530 CAGTGTGCAGCAATGGGGGAGGG - Intronic
953533556 3:43759313-43759335 GAGGGTGGAGAAAGCCTGGAAGG - Intergenic
954345669 3:49996033-49996055 CAGGGTGTGGGAAGTGGGGAGGG - Intronic
954363076 3:50132734-50132756 CAGGGGGCAGAAAGCCAGGCTGG - Intergenic
955927599 3:64023210-64023232 CAGGCTCCGGAACGCGGGGACGG + Intronic
956013100 3:64852566-64852588 CCGGGTGCAGAAATGGGAGATGG + Intergenic
957054990 3:75435872-75435894 CAGGGTGTGGGAAACGGGGAGGG + Intergenic
957132105 3:76235913-76235935 TAGGATGAAGAAAGCAGGGAAGG + Intronic
958030327 3:88100810-88100832 TGGGGTGGGGAAAGCGGGGAGGG + Intronic
958567660 3:95835417-95835439 CGGGGTGCAGGAAGGTGGGAGGG + Intergenic
958945327 3:100355467-100355489 CAGAGAGCAGAAAGCTGGGCTGG + Exonic
959652959 3:108769752-108769774 CAAGGTGCAGCAAGAGGAGATGG - Intergenic
961369827 3:126422535-126422557 CAGGGTGGAGCAGGCTGGGAGGG + Intronic
961553790 3:127683809-127683831 CAGCGAGCAGCAAGTGGGGAAGG + Intergenic
961888664 3:130112271-130112293 CAGGGTGTGGGAAACGGGGAGGG + Intronic
962812437 3:138971277-138971299 CAGGGTGCTGAAGGTGGGGTGGG - Intergenic
963605421 3:147408890-147408912 CCGGGTGCAGCAGGCGGGGATGG - Intronic
966201621 3:177364603-177364625 CAGGGTGCAGTAAGCCAGGATGG - Intergenic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
968001933 3:195212201-195212223 GAGGGAGCAGGAAGCGGGGGTGG + Intronic
968672346 4:1858320-1858342 CAGGGTGGAGACTGCGGGGAGGG - Intergenic
968710822 4:2116006-2116028 CAAGGTGCAGAAAGCTGGAATGG - Intronic
969446004 4:7245038-7245060 CAGAGTTCAGCAAGCGTGGATGG + Intronic
969597690 4:8158354-8158376 CAGGCTGCAGAAAGCGGTCAGGG - Intronic
969696354 4:8737320-8737342 CAGGGTGCAGGAGGCAGGAAGGG + Intergenic
969756197 4:9152476-9152498 CAGGGTGTGGGAAACGGGGAGGG - Intergenic
969816521 4:9691642-9691664 CAGGGTGTGGGAAACGGGGAGGG - Intergenic
969897581 4:10319650-10319672 CAGGATGCAGAAAGTGAGAAAGG + Intergenic
969996595 4:11318798-11318820 CAGGGTGCAGAAATAAGGGGAGG + Intergenic
972638396 4:40904364-40904386 CAGGTTGCAGTAAGCCGAGATGG + Intronic
973709081 4:53608958-53608980 GAGGGTGGAGAAAGGGAGGAGGG + Intronic
976665815 4:87589874-87589896 CAGGGTGCTGAATGTGGAGATGG - Intergenic
979056115 4:115997238-115997260 CAGGGTGTGGGGAGCGGGGAGGG + Intergenic
979850480 4:125566233-125566255 CGGGGTGCAGAAATAAGGGATGG + Intergenic
980021395 4:127714415-127714437 CAGGGGCCAGAGAGAGGGGAAGG - Intronic
980388742 4:132119296-132119318 CAGGGTGCAGAAATAAGGGATGG - Intergenic
981290133 4:143065404-143065426 GAGGGTGCAGAGAGAAGGGAAGG - Intergenic
982289034 4:153761150-153761172 CAGGCTGCAGTAAGCCGTGATGG + Intergenic
985134996 4:186777783-186777805 CAGGGTGGGGCAAGAGGGGAGGG - Intergenic
985573740 5:664183-664205 CAGGGTGCAGCTAGTGAGGACGG + Exonic
986344831 5:6824609-6824631 CAGGGTGCTGATAGTGGGGGAGG + Intergenic
986416050 5:7529352-7529374 CAGGGTGCAACAAGCTGGGCAGG + Intronic
989475649 5:41870176-41870198 CAGGCTGGAGAGAGCGGGTAGGG + Intronic
990566941 5:57039657-57039679 CAGGGTGGAGGAAACGGGCAGGG + Intergenic
993385038 5:87252538-87252560 CGGGCTGCAGGGAGCGGGGAGGG + Intergenic
994033032 5:95167057-95167079 TAGGGTGCAGGGAGTGGGGAAGG - Intronic
996191660 5:120550791-120550813 CAGTGTGCCTAAAGCAGGGAAGG + Intronic
996380313 5:122856578-122856600 GAGGTTGCAGTAAGCGGAGATGG - Intronic
996877881 5:128259938-128259960 GAGAGTGCAGAAAGCGGGAGTGG - Intronic
998128915 5:139641342-139641364 CAGGCTGCAGCAAGAGCGGAAGG + Intergenic
1000974984 5:167754892-167754914 AAGGGAGCAGAAAGGGAGGAGGG + Intronic
1002065832 5:176651215-176651237 CAGGGTGCAGAAAGGAGGCTAGG + Intronic
1002137627 5:177117581-177117603 TAGGGTGCAGTGAGCGGTGATGG + Intergenic
1002533118 5:179860553-179860575 CAGGGGGTGGAAAACGGGGAAGG - Exonic
1002600382 5:180351407-180351429 CAGGGTGGGGGAAGTGGGGAGGG - Intronic
1004025915 6:11818475-11818497 CAGGTAGCAGGAAGCTGGGAGGG - Intergenic
1004299026 6:14440468-14440490 CAGGGCACTGAAAGTGGGGAGGG + Intergenic
1004525027 6:16399572-16399594 GAGGTGGCAGCAAGCGGGGAGGG + Intronic
1005840909 6:29744197-29744219 CAGGGTGGGGATAGCAGGGACGG - Intergenic
1005898335 6:30196750-30196772 CAGGGGGCAGGAAGGGGAGAAGG + Intronic
1006033846 6:31197038-31197060 CAGAGTGGAGAAAGGAGGGAAGG - Intergenic
1010605920 6:77889770-77889792 AAGGCTGCATAAAGCAGGGAGGG - Intronic
1012210368 6:96510853-96510875 CAGGGGGAAGAAAGAGGGAAAGG - Intergenic
1012311714 6:97733489-97733511 GAGGTTGCAGAAAGCTGAGATGG + Intergenic
1018058324 6:160071035-160071057 CAGGGCCCAGAAGGCTGGGAGGG + Intronic
1018341044 6:162851258-162851280 CAGGGTGCAGAAGGGAGGCAAGG - Intronic
1018398545 6:163400251-163400273 GTGGGTGCAGTCAGCGGGGATGG - Intergenic
1019219553 6:170463265-170463287 CTGGGTGCATAAAGTGGTGATGG + Intergenic
1019343343 7:518607-518629 CGGGGTGCGGGGAGCGGGGAAGG - Intronic
1019563569 7:1669329-1669351 CGGGGGACAGGAAGCGGGGAGGG + Intergenic
1019764148 7:2837190-2837212 CACGAGGCAGAAAGAGGGGATGG + Intronic
1019835459 7:3378765-3378787 CAGGGAGCATATAGCGGGGCAGG + Intronic
1019875410 7:3806486-3806508 CTGGGTGGAGAAGGCAGGGAAGG - Intronic
1019927734 7:4204513-4204535 GAGAGAGCAGAAAGTGGGGAGGG + Intronic
1020797798 7:12697615-12697637 CAGGGGGAAGCAAGTGGGGAAGG - Intergenic
1022070965 7:26913895-26913917 GAGGTTGCAGTAAGCGGAGATGG + Intronic
1022098999 7:27158093-27158115 GAGGGTGCGGTAAACGGGGACGG - Intergenic
1022362088 7:29670680-29670702 CAGGTTGCAGTAAGCCGAGATGG + Intergenic
1022514339 7:30965853-30965875 CTGAGCGCACAAAGCGGGGAAGG - Intronic
1023058133 7:36305823-36305845 CAGGCTGCAGAGAGCTGTGATGG + Intergenic
1023452769 7:40305059-40305081 CAGGGTGAAGAAAGGAGGAAAGG - Intronic
1023738085 7:43252254-43252276 CTGGGGGCAGAAACCTGGGAAGG - Intronic
1025553579 7:62276469-62276491 GAGGGGGCAAAAAGCAGGGACGG + Intergenic
1026901506 7:74039972-74039994 AAAGGAGGAGAAAGCGGGGAGGG - Intronic
1027558140 7:79692302-79692324 CAGGGTGCAATGAGCTGGGAGGG - Intergenic
1029686992 7:102155851-102155873 CTGGGTGCAGGGAGTGGGGAAGG - Intronic
1030745101 7:113155771-113155793 TAGGGTCCAGAAAGCCAGGAAGG - Intergenic
1031044723 7:116875022-116875044 GAGGTTGCAGTGAGCGGGGATGG + Intronic
1031483936 7:122306681-122306703 CAGGCTGAAGAAATGGGGGAGGG + Intronic
1032126788 7:129201109-129201131 GAGGTTGCAGTAAGCGGAGATGG - Intronic
1033801670 7:144909180-144909202 CAGGGAGCAGCAGGTGGGGAAGG - Intergenic
1033829548 7:145235684-145235706 TGGGGTGGAGAGAGCGGGGAGGG - Intergenic
1033969772 7:147025325-147025347 CAGGGAGAAGAAAGGGGGGAGGG + Intronic
1033969867 7:147025506-147025528 CGGGGAGAAGAAAGTGGGGAGGG + Intronic
1034278770 7:149837466-149837488 GAGGCTGCAGTAAGCCGGGATGG - Intergenic
1034285344 7:149880198-149880220 CAGGGGGCAGAGGGCGGGGCTGG - Exonic
1035343894 7:158185880-158185902 AAGGGTGCAGAAAGCCAGGGTGG - Intronic
1035358471 7:158294635-158294657 CAGGCAGGAGCAAGCGGGGAGGG + Intronic
1035514640 8:222246-222268 AAGGGTGCAGTAAGCAGAGATGG + Intergenic
1035971264 8:4251867-4251889 GAGGGTGGAGGAAGAGGGGAAGG + Intronic
1036850120 8:12194831-12194853 CAGGGTGTGGGAAACGGGGAGGG + Intergenic
1036871484 8:12437104-12437126 CAGGGTGTGGGAAACGGGGAGGG + Intergenic
1036911318 8:12759558-12759580 CAGGGTGCACAAAGTGCGCAAGG + Intergenic
1038400329 8:27279649-27279671 CAGGGTGTAGACAGGGGAGAGGG + Intergenic
1038782513 8:30580207-30580229 CAGAGGGCAGAAAGCGGAGCAGG + Intronic
1039506243 8:38054588-38054610 CAGGGTCCAGGCAGCGGGGTGGG - Intronic
1039649796 8:39329244-39329266 CAGGATCCAGAAACCAGGGAAGG - Intergenic
1040874931 8:52141495-52141517 CAGAGGGCACAAAGTGGGGACGG - Intronic
1041778295 8:61548989-61549011 CATGGTGCAGGAAGTGGGCAGGG - Intronic
1042021853 8:64377669-64377691 GGGGGTGCAGAATGCGGGAACGG + Intergenic
1042155745 8:65842197-65842219 CAGGGTGCAGAACACAAGGAAGG - Intronic
1042233670 8:66586108-66586130 GAGGGTGCAGTGAGCTGGGATGG - Intronic
1042477175 8:69261737-69261759 GAGGTTGCAGTAAGCCGGGATGG - Intergenic
1042484252 8:69333751-69333773 CAGTGGGCAGAAGGAGGGGAAGG + Intergenic
1043822814 8:84889538-84889560 CAGGGTGTAGAAAGAGAAGATGG - Intronic
1045497234 8:102718950-102718972 CAGGGTGCAGTGAGCTGTGATGG + Intergenic
1045519587 8:102892202-102892224 TTGGTTGCAGAAAGCGGGGCTGG - Intronic
1046097303 8:109577076-109577098 AAGGGTGCAGACTGCGAGGAAGG - Intronic
1047821776 8:128529108-128529130 CAGGGAGCAGAAAGCAGTAAAGG - Intergenic
1047861604 8:128973062-128973084 CAGGATGCAGAAAATTGGGATGG - Intergenic
1048099266 8:131330821-131330843 CAGGGTTCAGAAATTGGGGGAGG + Intergenic
1048216932 8:132504827-132504849 CTGGGTGCAGTAAGAGGTGAGGG + Intergenic
1048308084 8:133297356-133297378 GAGGGAGCAGGGAGCGGGGAAGG - Exonic
1048360983 8:133697006-133697028 CAGGGAGCATAGAGCTGGGAGGG - Intergenic
1048658770 8:136572743-136572765 AATGGTTCAGAAAGTGGGGAAGG - Intergenic
1048886553 8:138914163-138914185 CAGGGGGCTGGGAGCGGGGAGGG + Intergenic
1048931724 8:139320695-139320717 CAGGGTCCAGTAAGCTGAGATGG - Intergenic
1049521875 8:143095450-143095472 GAGGGTGAGGAAAGCGAGGAAGG + Intergenic
1049784268 8:144443105-144443127 CAGGAGGCAGAAAACGCGGAGGG + Intronic
1050900633 9:10944079-10944101 GAGGGTGCAGTGAGCCGGGATGG - Intergenic
1052049585 9:23830208-23830230 CAGGGAGAAGAACGGGGGGAGGG - Intergenic
1052822331 9:33147312-33147334 GAGGTTGCAGTAAGCCGGGATGG - Intronic
1053570742 9:39303234-39303256 CAGGGTGCAGAAATCTAGGCTGG - Intergenic
1053836686 9:42144152-42144174 CAGGGTGCAGAAATCTAGGCTGG - Intergenic
1054092363 9:60862253-60862275 CAGGGTGCAGAAATCTAGGCTGG - Intergenic
1054113777 9:61137846-61137868 CAGGGTGCAGAAATCTAGGCTGG - Intergenic
1054126403 9:61315778-61315800 CAGGGTGCAGAAATCTAGGCTGG + Intergenic
1057353845 9:94319798-94319820 GGAGATGCAGAAAGCGGGGAGGG + Intronic
1057367555 9:94437339-94437361 CAGGGTGGGGAGAGCAGGGATGG - Intronic
1057466245 9:95317253-95317275 CAGGGCGGGGAAAGCGGGGGCGG - Intronic
1057655773 9:96950714-96950736 CAGGGTGGGGAGAGCAGGGATGG + Intronic
1057810266 9:98251977-98251999 CTGGGTGCAGGAAGAGGGGAAGG + Intronic
1058597451 9:106630197-106630219 CAGAGTGCAGAAGGTGGGGTGGG + Intergenic
1058711584 9:107683754-107683776 CAGAGTCCACAAAGCAGGGAAGG - Intergenic
1059703679 9:116800171-116800193 CAGACAGCAGAAGGCGGGGAAGG - Intronic
1060549153 9:124477037-124477059 TAGGGGGCAGAAAGAGGGGGAGG - Intronic
1060636099 9:125200682-125200704 CCGGGTGCAAAGAACGGGGAAGG + Exonic
1060730442 9:126033663-126033685 CAGGGTGCAGAGGGCAGAGAGGG + Intergenic
1061185850 9:129052716-129052738 CAGGTTGCAGAACAAGGGGAGGG + Intronic
1061451720 9:130670521-130670543 CAGGGTGCAGAGAGCACTGAAGG + Intronic
1061598001 9:131645034-131645056 CAGGGTGCAGGACCCAGGGATGG - Intronic
1061775700 9:132962200-132962222 GAGGTTGCAGAAAGCTGAGATGG - Intronic
1061777908 9:132978083-132978105 CAGGGTGCTGAACTTGGGGAGGG + Intronic
1061922461 9:133789514-133789536 GAGGGTGCAGAAGACCGGGAAGG + Intronic
1062386087 9:136312056-136312078 AGGGGTGCAGCAAGCTGGGAGGG - Intergenic
1203773844 EBV:62164-62186 GAGGGTGAAGAAAGCGGTGGTGG - Intergenic
1185464468 X:346425-346447 CAGGCCGCGGAAAGCGGGGAGGG + Intronic
1185608250 X:1379568-1379590 CAGGGTGGAGGAAGCAGGGCCGG + Intronic
1187352890 X:18537662-18537684 CAGGGGTTAGAAAGAGGGGAAGG - Intronic
1187478272 X:19630985-19631007 CAGGGTGGAGGATGCAGGGAAGG - Intronic
1187714455 X:22089084-22089106 GAGGTTGCAGCAAGCTGGGATGG - Intronic
1189082665 X:37991391-37991413 CAGAGAGCTGAAGGCGGGGAAGG + Intronic
1189308180 X:40002943-40002965 CAGGGTGCAGAGAGGGGAGGAGG + Intergenic
1189753076 X:44242760-44242782 CAGGGTGCAGTAGGAGGAGATGG - Intronic
1191047581 X:56155455-56155477 TGGGGTGGAGGAAGCGGGGAGGG + Intergenic
1192677604 X:73214701-73214723 CTGGGTGCAGAGGGCGGCGACGG + Exonic
1192744305 X:73923628-73923650 CAGAGTGCACAAAGAAGGGAGGG - Intergenic
1192765361 X:74134205-74134227 CAGGATCCAGAAACCAGGGAGGG + Intergenic
1193452854 X:81691718-81691740 TTGGGTGCGGGAAGCGGGGAGGG + Intergenic
1194336850 X:92658741-92658763 AAGGGGGCATAAAGTGGGGATGG + Intergenic
1194680298 X:96843808-96843830 CAGGAGGCAGATAACGGGGAGGG - Intronic
1195056668 X:101152479-101152501 GAGGTTGCAGTAAGCCGGGATGG - Intronic
1195282447 X:103349002-103349024 CAGGGTGAAGGAAGAGTGGAGGG - Intergenic
1196376658 X:115040241-115040263 CGGGATACAGAAAGGGGGGAGGG + Intergenic
1200048128 X:153413383-153413405 CAGGGTGCTCCACGCGGGGAGGG - Intergenic
1200812257 Y:7498461-7498483 GAGGGTGCAGGAAGGGAGGAGGG + Intergenic
1201248992 Y:12036715-12036737 TGGGGTGGAGGAAGCGGGGAGGG + Intergenic
1201591216 Y:15616883-15616905 CAGGGTGCAGGGAGTGGGGAGGG + Intergenic