ID: 1084973268

View in Genome Browser
Species Human (GRCh38)
Location 11:72782641-72782663
Sequence CTGGGCTCTCTTACCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084973260_1084973268 24 Left 1084973260 11:72782594-72782616 CCTGCTATGGACTAGACTAGGCT 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1084973268 11:72782641-72782663 CTGGGCTCTCTTACCTCCCCAGG 0: 1
1: 0
2: 2
3: 34
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084973268 Original CRISPR CTGGGCTCTCTTACCTCCCC AGG Intronic
900973812 1:6005665-6005687 CTGGGCTTCCGTGCCTCCCCGGG - Intronic
901065552 1:6492518-6492540 CTGGGATCTGAGACCTCCCCAGG - Intronic
901079417 1:6575384-6575406 GTGGGCTCTCTTACCTGCCAGGG - Exonic
901154157 1:7124224-7124246 CTGTGCTCTTTTCCCTCTCCTGG + Intronic
901207720 1:7506293-7506315 CTGGGCTCACTTCCCTCCTCTGG - Intronic
902301694 1:15506762-15506784 CTGGGCCGTCCTACCTCCCATGG + Intronic
902368754 1:15992901-15992923 CTGGGCTCTCTCACCCACCGTGG + Intergenic
906663129 1:47596631-47596653 CTGGGCTCTGTGGCCACCCCTGG + Intergenic
907281454 1:53349744-53349766 CAGGGTTCTCTTGCCTCCCGGGG - Intergenic
907341289 1:53738106-53738128 CTGTGCTGTCTCCCCTCCCCAGG - Intergenic
909961879 1:81856033-81856055 CTGGGCAATATGACCTCCCCTGG - Intronic
911871534 1:103107021-103107043 CTGGGCTCCCTGACCTCCAAAGG + Intronic
912490412 1:110059698-110059720 CTGGGCTCTGTCACCTGCCTAGG - Intronic
915204068 1:154256276-154256298 CTTAGCCCTCATACCTCCCCAGG - Intronic
915219073 1:154359531-154359553 CTGGGCTCTCATTCTTGCCCTGG - Intergenic
917722856 1:177802654-177802676 CTGGCCTCCTTTCCCTCCCCTGG + Intergenic
919252524 1:195075552-195075574 CTTCCCTCTCTTCCCTCCCCTGG + Intergenic
919728774 1:200900082-200900104 CTGGTCTCTGCTTCCTCCCCAGG + Exonic
919753604 1:201053334-201053356 CTGCCCTCTGTTAGCTCCCCAGG + Intronic
919856325 1:201708755-201708777 CTGGGCTCTGTTTTGTCCCCAGG + Intronic
920414797 1:205791718-205791740 CTGGGCCCTTTTGTCTCCCCAGG - Exonic
923622360 1:235588953-235588975 CAGGGCCCTCCTTCCTCCCCAGG + Intronic
923888324 1:238182167-238182189 CTGGGCTCTGACACCTCACCTGG + Intergenic
924037715 1:239953860-239953882 CTGGCATCTCTTTCCTTCCCAGG + Intergenic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1063020608 10:2123535-2123557 CTGGCCTCTCTCACCTTACCTGG + Intergenic
1063086292 10:2821113-2821135 CAGGGCTTTCTTACCTCAGCAGG - Intergenic
1064991875 10:21263546-21263568 GTGTGCTCTCCTATCTCCCCGGG + Intergenic
1066243932 10:33563623-33563645 CTGGGCTGACTTACATCGCCTGG - Intergenic
1067287995 10:44921412-44921434 CTGTGCTGTCTTTCCTGCCCAGG - Intronic
1070702256 10:78612768-78612790 CTGGCCTCTCTTACCCTTCCTGG - Intergenic
1072171007 10:92861618-92861640 CAGGGCTCTCTTTCCTGCCAGGG - Intronic
1072624097 10:97099763-97099785 CCGGGGTCTCTGGCCTCCCCTGG - Intronic
1073464142 10:103684067-103684089 CTGGGCTCTCTGGCCCTCCCTGG - Intronic
1074032094 10:109699114-109699136 CTCTGATCTCCTACCTCCCCAGG - Intergenic
1074565933 10:114577965-114577987 CTTCCCTCTCTTGCCTCCCCAGG + Intronic
1075479362 10:122766808-122766830 CTGTGCTCTCTCACCACGCCTGG - Intergenic
1075948860 10:126460407-126460429 CTGGGCACTCTGAGCTCCCAAGG - Intronic
1076266658 10:129114035-129114057 CTTGGCTCTCTTACCTGCAGAGG - Intergenic
1077289346 11:1781757-1781779 CTGGGAGCTGTTACCTCCCAGGG + Intergenic
1077304404 11:1862696-1862718 CTGGGTGATCTCACCTCCCCTGG + Intronic
1077304429 11:1862772-1862794 CTGGGTGATCTCACCTCCCCTGG + Intronic
1077494572 11:2880668-2880690 CTGGTCTCCTGTACCTCCCCGGG - Intergenic
1079248965 11:18773353-18773375 ATGGGCTCTGTCACCTTCCCAGG - Intronic
1081858875 11:46320688-46320710 CTGGCCTCTCTTCTCTCTCCAGG + Exonic
1081897362 11:46598041-46598063 CTGGGCTCTCTCTCCTTCCCTGG - Intergenic
1082032728 11:47617503-47617525 CAGGGGTCTCTTCCCTCCCCTGG - Exonic
1084164041 11:67366870-67366892 CTGGGCTCTCTGAACACCTCTGG + Intronic
1084301981 11:68258121-68258143 CTGAGCTCTCTGAGCTCCCCAGG + Intergenic
1084973268 11:72782641-72782663 CTGGGCTCTCTTACCTCCCCAGG + Intronic
1085470045 11:76752162-76752184 CTGGGTTCTCTTATATCCCTCGG + Intergenic
1086369670 11:86143821-86143843 CTGTGGTCACTTCCCTCCCCTGG - Intergenic
1089302953 11:117509582-117509604 CTGGGCTCTCTTCCCCCTCCAGG - Intronic
1089412040 11:118252240-118252262 CTGCGCTCTCTTCCCTCTGCTGG - Exonic
1089837761 11:121386344-121386366 CTGGGCTCTCTCACATGTCCAGG - Intergenic
1090423546 11:126591909-126591931 TTGGGCCCTCTCACCACCCCTGG + Intronic
1091400101 12:176215-176237 CGGGGCTCGCTGACCTCCCAGGG + Exonic
1092536707 12:9395632-9395654 CTGGGCTCTCCCACTCCCCCAGG - Intergenic
1092548090 12:9469007-9469029 CTGGGCTCTCCCACTCCCCCAGG + Intergenic
1092557968 12:9577689-9577711 CTGGGCTCTCCCACTCCCCCAGG + Intergenic
1093310015 12:17568517-17568539 GTGGGCTCTCTAGCCTGCCCTGG - Intergenic
1094504908 12:31053440-31053462 CTGGGCTCTCCCACTCCCCCAGG - Intergenic
1094513327 12:31110232-31110254 CTGGGCTCTCCCACTCCCCCAGG - Intergenic
1095244835 12:39907836-39907858 CTGAGCGTTCTTGCCTCCCCTGG + Intronic
1095515484 12:43000619-43000641 ATGAGTTCTCTCACCTCCCCTGG + Intergenic
1096505147 12:52087940-52087962 CTGGGCTCCCTGCCCTTCCCTGG + Intergenic
1096558806 12:52421587-52421609 CTGCCCCCTCTGACCTCCCCTGG + Intergenic
1096654274 12:53079049-53079071 CTGGGCCCTGTCTCCTCCCCGGG + Intronic
1096683163 12:53270281-53270303 CTGGGCTCTGTCAGCTCTCCAGG + Intronic
1096808336 12:54154242-54154264 CTGGGGTCTGTGACCTCCCAGGG - Intergenic
1099202398 12:79691051-79691073 CTCGGCTCCCTTCCCGCCCCTGG - Exonic
1100690621 12:97035121-97035143 CTGGCCTGTCTTCCCTCTCCAGG - Intergenic
1100979496 12:100153602-100153624 CTGGGCTTTCTGACCACCCAGGG + Intergenic
1101542420 12:105676990-105677012 CTGGCCCCTCCTGCCTCCCCTGG - Intergenic
1101821850 12:108190547-108190569 CTGTGGTTCCTTACCTCCCCTGG - Intronic
1101992310 12:109496479-109496501 CTGTGCTATTTTACCTTCCCAGG + Intronic
1102492566 12:113297935-113297957 CTGGGCCCTTCTTCCTCCCCAGG + Exonic
1103253856 12:119523548-119523570 CTGGGTTCTCTGCCCTCACCTGG - Intronic
1104786606 12:131454320-131454342 ATAAGCCCTCTTACCTCCCCAGG - Intergenic
1106080783 13:26498706-26498728 ATGGGCTTTCTTATCTCCCGAGG - Intergenic
1108494380 13:51009270-51009292 CTGGGCTCTCATGACACCCCCGG + Intergenic
1109157908 13:58934614-58934636 CAGGGCTCTGATACCTCACCTGG - Intergenic
1110280400 13:73686667-73686689 CTGGGCACTCTTAACTCCCTGGG + Exonic
1110639571 13:77806604-77806626 CTGGGCTCTCTTTCTGCTCCTGG + Intergenic
1110664910 13:78105827-78105849 CAGGGCTCTCTTCCCTCCAATGG + Intergenic
1112180468 13:97073963-97073985 CTGCACTCTCTAACCTCACCTGG + Intergenic
1114620921 14:24095492-24095514 CTGAGCTTTCTTCCTTCCCCAGG + Intronic
1115871923 14:37814261-37814283 CTGGGCTCCCTTGCTGCCCCAGG + Intronic
1117956928 14:61130285-61130307 CTGCCCCCTTTTACCTCCCCAGG - Intergenic
1118910384 14:70057398-70057420 CTGGGATCTCTGATCTCCCCTGG - Intronic
1119441462 14:74631370-74631392 CTGGGGCCTCCTCCCTCCCCAGG - Intergenic
1122049863 14:99049015-99049037 CTGGGTTCTCTTTCCTTCTCTGG - Intergenic
1122131566 14:99606845-99606867 CTGGGCCCTCTCACCTCCTCTGG - Intergenic
1122603716 14:102933886-102933908 CTGGGCACGCGTGCCTCCCCAGG - Intronic
1123049173 14:105532377-105532399 CTGGCCTCTGTGATCTCCCCTGG + Intergenic
1124335601 15:28854437-28854459 CTCCCCTCTCCTACCTCCCCTGG + Intergenic
1125406577 15:39358454-39358476 CTGGGCTCTCTTTAGTCCTCAGG - Intergenic
1125510137 15:40288343-40288365 CTGGGCTCAGTTTCCTCACCTGG - Exonic
1126364173 15:47876795-47876817 CTGGGCTGACTTACCACACCAGG - Intergenic
1127829063 15:62733978-62734000 CTGGGCTTTCTGACCTCTCGTGG + Intronic
1128147054 15:65337624-65337646 CTGGGCTTACTTACCTCCCTTGG - Intronic
1128308185 15:66613761-66613783 CTGGGAATTCTCACCTCCCCAGG - Intronic
1128897958 15:71393106-71393128 CTTGGCTTTCATTCCTCCCCAGG - Intronic
1130100743 15:80892079-80892101 CTGGTGCCTCTCACCTCCCCGGG + Intronic
1130647662 15:85742980-85743002 CTGGGTTCTCTTAGCTGCCTGGG - Intronic
1132300263 15:100770992-100771014 CTGAGCCCCCTTCCCTCCCCGGG + Intergenic
1132994605 16:2816748-2816770 CTGGGCTCTCTTCACTTCTCTGG - Intergenic
1133689010 16:8195066-8195088 CTGGGAGCTCTTTTCTCCCCGGG - Intergenic
1135609560 16:23854467-23854489 CTGGGCTCATTTACCTTCCTGGG + Intronic
1136008988 16:27350090-27350112 CTGTGCTCTTTTTCCTCCCATGG + Intronic
1136409981 16:30070456-30070478 CTGGGCTCTGCTACCTCCCCAGG - Intronic
1136518957 16:30784307-30784329 TTGGTCTCTCTTCCCTCCCCCGG + Intronic
1137594215 16:49713311-49713333 CTGGGCTCTCTTAGATCCTGCGG - Intronic
1137718765 16:50614893-50614915 CTGGGCCCTCTCACCTACACGGG - Intronic
1138207138 16:55133378-55133400 CTGGGGTCTCTTTTCTCCACAGG + Intergenic
1139602319 16:67994019-67994041 CTGCGCTCTCATCCCTCCACTGG - Intronic
1139654610 16:68379843-68379865 CTGGGCTTTCTGACTTCGCCAGG - Intronic
1139961607 16:70721299-70721321 CAGGGCTCTCATCCCTGCCCAGG - Intronic
1141031067 16:80589055-80589077 CTGAGCTCTCTTCCCTTCTCTGG + Intergenic
1141484807 16:84331680-84331702 CTGGGCTCTCTTGGCACCTCCGG - Intergenic
1141565431 16:84898487-84898509 CTGGGCTCTCATACGTTCCTGGG + Intronic
1142192394 16:88723852-88723874 CGGGGCTCTCCCACCTCACCTGG + Exonic
1142911224 17:3092933-3092955 CAGGACTCTCTGACATCCCCAGG + Exonic
1143017341 17:3897995-3898017 GGGGGTTCTCTTACCGCCCCTGG + Exonic
1143783559 17:9241464-9241486 CTGGGCTCTCTGCACTGCCCGGG + Exonic
1144102868 17:11959709-11959731 CAGGGCTCTTTTACATCCCATGG + Intronic
1144654879 17:17029091-17029113 CTGGGCACTCATTCCTCCTCAGG - Intergenic
1146502049 17:33372735-33372757 CTGGGAGCTGTTACCTCCCAGGG - Intronic
1147142170 17:38466079-38466101 CTGGGCTCCTTGACCTCCTCGGG + Intronic
1147161545 17:38572020-38572042 CTGAGGTCTCTTTCCTCCCCTGG + Intronic
1149214011 17:54333265-54333287 CAGGGCTCTGATACCTCACCTGG - Intergenic
1149685672 17:58533158-58533180 CCAGGCCCTCTTCCCTCCCCTGG - Intronic
1151469675 17:74310117-74310139 CTGGGCTCTCTACCCTCCAGAGG + Exonic
1151741556 17:75986209-75986231 CTGGGACCTATTACCTCCCCTGG + Exonic
1152375957 17:79919159-79919181 CTGGGCTGTCTCACTTCCCCTGG - Intergenic
1155099960 18:22601118-22601140 CCAAGCTCTCTAACCTCCCCAGG + Intergenic
1155762983 18:29589289-29589311 CTGGGATCTCTGACCTCCAGGGG - Intergenic
1156486208 18:37467304-37467326 CTGGGATCTCTGTTCTCCCCAGG - Intronic
1157600230 18:48889105-48889127 CTGGGTTCTCTGACCTAGCCAGG + Intergenic
1158495818 18:57954430-57954452 CTGGGCACTCTTCCCTCCTCTGG - Intergenic
1160058331 18:75507271-75507293 CTGGGCTCTCTTAATTACCTAGG - Intergenic
1161052537 19:2172060-2172082 CAGGGCCTTCTTTCCTCCCCTGG - Intronic
1161349675 19:3784884-3784906 CTGGACTCTGTCCCCTCCCCAGG - Exonic
1161762363 19:6183439-6183461 GTGGGCTCTCTTACCATCCAGGG - Intronic
1161988539 19:7670726-7670748 CTGGGGTCTCCGACCTCCCCAGG + Intergenic
1162017048 19:7851594-7851616 AGGGGCTCTCTTCCCTCCCCAGG - Intronic
1162152681 19:8656882-8656904 CTGGACTCCCCCACCTCCCCTGG - Intergenic
1164564437 19:29315789-29315811 CTGGAGCCCCTTACCTCCCCAGG + Intergenic
1164703120 19:30300340-30300362 CTGGGGTCTCTTTGCTCTCCAGG + Intronic
1164728082 19:30480253-30480275 CAGGTCTCTCTTCCTTCCCCGGG + Intronic
1165326975 19:35119489-35119511 CTGTGCTTTTCTACCTCCCCGGG + Intronic
1165931034 19:39358866-39358888 CTGGCCTCCCTCATCTCCCCAGG + Intronic
1166213849 19:41323491-41323513 CTGGGGTCTCCTCCCTCCCCTGG - Exonic
1167246411 19:48375830-48375852 CTGCTCTCACTTAGCTCCCCTGG + Intronic
1167424960 19:49425481-49425503 CTGGGGTCTCTTACCTGCTCTGG - Exonic
1167467767 19:49659134-49659156 CTGGGCACTGTCACCTCTCCTGG - Intergenic
1167579456 19:50333133-50333155 TCGGGCTGTCTTACCGCCCCCGG + Intronic
1168102243 19:54147449-54147471 CTGGGCTCTGCCACCTTCCCAGG + Intronic
1168153336 19:54460573-54460595 CTGGGGTCACTAACCCCCCCCGG + Intronic
926143751 2:10384391-10384413 CTGGGCTCTCCTCTCTCCCCAGG - Intronic
927711548 2:25329173-25329195 CTGGGCTCTTCTCCCTCCCTCGG - Intronic
927945074 2:27130708-27130730 CAGGGCTCTCTTACCTTCTGAGG + Exonic
928723720 2:34148025-34148047 CTGGCCTCTCTCCACTCCCCCGG - Intergenic
929533268 2:42765163-42765185 CTGGCCTCTCTTGGCTGCCCTGG + Intergenic
930030369 2:47054993-47055015 CTGAGCCCTCTCCCCTCCCCTGG + Intronic
930034079 2:47074806-47074828 CTGGGCTCTGTCCCCTCCTCAGG - Exonic
930095096 2:47560862-47560884 GTGGGCTCTGTGGCCTCCCCTGG + Intronic
932050541 2:68393727-68393749 CTGGGCTATTTGACTTCCCCTGG + Intronic
932220123 2:69992895-69992917 CAGGGCTCTGTCACCTCACCAGG - Intergenic
932221576 2:70003652-70003674 CTGGGCTCTCTCAACACCCAAGG - Intergenic
932398569 2:71464591-71464613 CTGACCTCTCTGACCTCCCCAGG - Intronic
932558035 2:72842792-72842814 ATGGGCTATCTTAGTTCCCCTGG + Intergenic
935809591 2:106784098-106784120 CTGTGTACTCTTACTTCCCCTGG + Intergenic
938373138 2:130786420-130786442 CTGGGCTCTGTTTCTTCCCAAGG - Intergenic
938724251 2:134092683-134092705 CTGGGCTCTCTTGCACCTCCAGG - Intergenic
939177501 2:138766389-138766411 CTGGGCTGTTTTTGCTCCCCAGG + Intronic
943250783 2:185518886-185518908 CTAGGCCCTCTGAGCTCCCCGGG - Intergenic
946057890 2:216917525-216917547 CTGAGCTCTCCTACCTGTCCTGG + Intergenic
946187844 2:217991180-217991202 CTGGGCCCTCCTCCCTCCTCTGG - Intronic
947911518 2:233803846-233803868 CTGGGCTCCCTCCCCACCCCAGG - Intronic
948280149 2:236740753-236740775 CTGGTCTCCCTAACCTCTCCAGG - Intergenic
948405732 2:237717509-237717531 CTGGGCTCTCTTGCTTTGCCGGG + Intronic
948915736 2:241034351-241034373 CTGGGCTCTTGGGCCTCCCCTGG - Intronic
948965053 2:241372748-241372770 CTGGGCTCTCTTGCCTCTGCTGG + Intronic
1169292718 20:4366365-4366387 CTGGGCTTTCTCACCTGCCTGGG - Intergenic
1170496676 20:16931382-16931404 CTGGGATCTCTGACCTCCAGGGG - Intergenic
1170951764 20:20943119-20943141 ATGGGTTCTCTTACTTCCCTAGG - Intergenic
1171306536 20:24112102-24112124 CCGGGCACTGTTCCCTCCCCAGG + Intergenic
1171365229 20:24618212-24618234 CCGGGCTCTCTCCCTTCCCCGGG - Intronic
1171365270 20:24618311-24618333 CTGGGCTCTCTGCCCTCACTGGG - Intronic
1172037889 20:32022846-32022868 CTGGGACATCTTCCCTCCCCTGG - Intronic
1172701445 20:36855909-36855931 CCTGGCTCTCCTCCCTCCCCAGG + Intronic
1173226367 20:41164592-41164614 CTGGTCTCCCTTAGCTCACCAGG + Intronic
1173729073 20:45316438-45316460 CTTGGTTCTCTCACCTCACCTGG + Intronic
1174348476 20:49949369-49949391 CTGGGCTCTGATCCCTCCCCTGG + Intronic
1175618955 20:60427113-60427135 CTGGGCTCACTGCCCTCCCCTGG - Intergenic
1175892768 20:62322786-62322808 CTGGGCCCTCTCACCCCCCCAGG + Intronic
1175935989 20:62514256-62514278 CTGGGCACCCTTCCCTCCCCTGG - Intergenic
1175987567 20:62771542-62771564 CTGGGGTCTCTGCCCTCTCCGGG + Intergenic
1176248699 20:64109836-64109858 CTGGGTCCTCTTCCCTCCACCGG + Intergenic
1178769782 21:35492367-35492389 CTTGGCTCCTTTACCTCACCAGG - Intronic
1179989645 21:44940404-44940426 CCTGGCTCTCTCCCCTCCCCGGG - Intronic
1180052346 21:45337023-45337045 CTGGGCTTCCTTCCCACCCCAGG - Intergenic
1180714198 22:17860411-17860433 TTGGGCTCTCGTACCGCCGCCGG + Intronic
1180931929 22:19598186-19598208 CTGGGCTGCCTTGTCTCCCCAGG + Intergenic
1181033249 22:20158149-20158171 CTGGGGCCTCTGCCCTCCCCGGG + Intergenic
1181779881 22:25184955-25184977 CTCAGCTCTCTTTTCTCCCCAGG + Exonic
1183442109 22:37829158-37829180 CTGAGCTCTCTTTCCTGCCCTGG + Intergenic
1184915421 22:47565584-47565606 CTGGCCTCTCTTCCCTTCTCTGG - Intergenic
1185061930 22:48611662-48611684 CTGGCCTTTCTTGCCTCTCCTGG + Intronic
1185063294 22:48618268-48618290 CCAGGCTCTCCTGCCTCCCCAGG + Intronic
1185289872 22:50017891-50017913 TTGGGCTCACTCACCTTCCCTGG - Intronic
949919612 3:8990670-8990692 CAGGGCTCTCGATCCTCCCCCGG + Exonic
950463803 3:13141413-13141435 CTGGGCACTCTGGACTCCCCGGG - Intergenic
950947088 3:16960318-16960340 CTGGTCCATCTTACCTCGCCTGG + Intronic
954301862 3:49704565-49704587 CTGGGCTCTCTCACCGTCCTGGG + Intronic
955348090 3:58175612-58175634 TTGGACTCGCTTATCTCCCCGGG + Intergenic
956643838 3:71437499-71437521 CTGGGCTCTCCTGACTCACCAGG + Intronic
961574290 3:127822515-127822537 CGGGGCTCCCCTCCCTCCCCAGG + Exonic
961782752 3:129330572-129330594 CTGGGCTCTCTTACCCTCCCTGG + Intergenic
962420992 3:135229140-135229162 CTGGGCTGTCTGCCCTCCTCTGG - Intronic
964188716 3:153978041-153978063 CTGGTTTCTCTGACCTGCCCAGG + Intergenic
964814908 3:160706855-160706877 CTGGGCACTATTACCACCTCTGG + Intergenic
966531817 3:180989611-180989633 CTGGGCTCCCTTGCTTCCACCGG + Exonic
968134509 3:196211335-196211357 CTGGTGGCTCTGACCTCCCCTGG - Exonic
968282273 3:197486000-197486022 CTGGTCTCTCTTAGAGCCCCTGG - Intergenic
971399029 4:26258083-26258105 CTGTGCTTTCTCACTTCCCCTGG - Intronic
977528319 4:98171074-98171096 CTTGGCGCTCTCACCTCACCAGG + Intergenic
978970426 4:114797291-114797313 CTGGGCTTTTTTTCTTCCCCTGG - Intergenic
979939608 4:126743863-126743885 CTGGATTCTCTTGCTTCCCCAGG - Intergenic
980750128 4:137077207-137077229 CTGGCCTCTCTCCCCTCCCAGGG - Intergenic
983153439 4:164314372-164314394 CTGCTCTCTCTTACCACCCAAGG + Intronic
986057582 5:4154007-4154029 AGGGGCTCTCTTAGCTCTCCGGG - Intergenic
986394014 5:7310554-7310576 CTCCCCTCTCCTACCTCCCCTGG + Intergenic
986753433 5:10811508-10811530 ATGGGTTATCTTACCTGCCCAGG + Intergenic
989102890 5:37837474-37837496 CTGGGCGTCCTTGCCTCCCCAGG - Intronic
989147217 5:38260785-38260807 CTGGGCTCATTTACATCCCTTGG + Intronic
992424139 5:76638377-76638399 CTGGGCTTTTTTCCCTCCCCGGG - Intronic
994263669 5:97689126-97689148 CTAGGCTCTCTTACCTCACAGGG + Intergenic
995142337 5:108748625-108748647 CTGGGCTCGCTCACCAGCCCGGG - Intronic
997725621 5:136117840-136117862 CTGGGCCCTCTTCCTTCCTCAGG + Intergenic
997759070 5:136427504-136427526 CTGGGCTCTCTCTTCACCCCAGG + Intergenic
997846733 5:137293268-137293290 TTGGGCTCTGTGAACTCCCCTGG - Intronic
998162882 5:139823291-139823313 CTGGGCTCTCTTGCCCTCGCAGG + Intronic
998555489 5:143119073-143119095 CTCAGCTCTCACACCTCCCCTGG - Intronic
999171540 5:149599322-149599344 CTGGGCTCTGTCCCCTCCTCAGG + Intronic
999266482 5:150270002-150270024 CTGGGCACTGTGACCTCCACAGG - Intronic
1000048561 5:157542091-157542113 CTGGTCTCTCTTATTTCACCTGG + Intronic
1002322263 5:178382972-178382994 GTGGAGTCTCTCACCTCCCCAGG - Intronic
1003243831 6:4367760-4367782 CTGGACTCTCTCACCCCCCTGGG - Intergenic
1003628806 6:7768064-7768086 CTGCCCGCTCTTGCCTCCCCAGG - Intronic
1005990284 6:30897998-30898020 GTGGGCTCTCTCTCCTCTCCTGG + Intronic
1006255562 6:32829630-32829652 CTGGGCCCTCCCACCTCCCGAGG - Intronic
1006315320 6:33288120-33288142 CTTGGCTCCTTTACCTCCTCAGG + Intronic
1006964437 6:37968252-37968274 CTTAGCCCTCTTGCCTCCCCAGG - Intronic
1008159519 6:48060285-48060307 CTCCGTTCTCTTACCTCACCAGG - Intronic
1010939388 6:81897758-81897780 GTGGGTTCTCTTTCCTTCCCAGG - Intergenic
1012203367 6:96434133-96434155 CTGGGACCTCTTACCACCACTGG - Intergenic
1012741088 6:103017906-103017928 CTGGGATCTCTGACCTCCAGGGG + Intergenic
1013536886 6:111071103-111071125 CTGGGCTTTCTTCCCTGACCTGG - Intergenic
1014804191 6:125811125-125811147 CTAGGCTCTCTGCCCTGCCCTGG - Intronic
1015386000 6:132624272-132624294 CTGGGGTATCTTGCCTCCCATGG - Exonic
1015826606 6:137319009-137319031 CTGGGATCTCAGACCTCCCCAGG + Intergenic
1016388123 6:143548711-143548733 CTGCAATTTCTTACCTCCCCGGG - Intronic
1017949222 6:159121723-159121745 CTGGGCTCTCTTCCCCCACATGG + Intergenic
1018070582 6:160161182-160161204 TTGGGCTCTCTTACCAGCCGAGG - Intergenic
1018896095 6:168018653-168018675 CGGGGCTCTCCTACCACCCTGGG - Intronic
1018935077 6:168269041-168269063 CTGGTCTCTCTTCTGTCCCCAGG - Intergenic
1025936195 7:66039624-66039646 CAGAGCTCTCTGCCCTCCCCAGG + Intergenic
1027352651 7:77327455-77327477 CTGGGCTCACTGACCAGCCCAGG - Intronic
1027858610 7:83545657-83545679 CAGGGCTCTCTTGCCTCTACTGG + Intronic
1028233266 7:88330407-88330429 CTGGCCTCTCTCCACTCCCCAGG + Intergenic
1028650426 7:93144718-93144740 CTGGGCTCACTCACCTCACTGGG + Exonic
1029129982 7:98322550-98322572 CTGTGGTCTCTTCCCTGCCCAGG + Intronic
1029203584 7:98855226-98855248 TGGAGCTCACTTACCTCCCCAGG + Exonic
1029371496 7:100153816-100153838 CTGTGCTCCCTTCCCTCTCCTGG + Intronic
1029401211 7:100347767-100347789 CTGGGCTCTTTTACTTCAGCAGG + Intronic
1029605665 7:101598190-101598212 CTTGGCTCTCATGCCTTCCCGGG - Intergenic
1029707937 7:102285486-102285508 CTCGGCTCTGTTCCCTCCGCAGG - Intronic
1033344895 7:140519027-140519049 CTGGGCACTTTCTCCTCCCCTGG - Intronic
1035022077 7:155805964-155805986 CAGGGCTGTCTTCCCTCGCCTGG + Intronic
1035023120 7:155810217-155810239 CTGGGCTCGCACACCTTCCCAGG - Intronic
1036000271 8:4594742-4594764 CATGGCTATCTTTCCTCCCCAGG + Intronic
1036686604 8:10915798-10915820 TTGGTCTCTCCTACTTCCCCAGG - Intronic
1038433487 8:27518621-27518643 CTGGGGGCTGTTTCCTCCCCTGG - Intronic
1038537742 8:28365990-28366012 CTGTGCTCTCCTACCACCCAGGG + Intronic
1039336493 8:36596422-36596444 CTGGGCTGTCTTACTTCCACTGG + Intergenic
1039804576 8:40987340-40987362 CTGTGCTCTCTCAGCCCCCCAGG + Intergenic
1041118458 8:54563389-54563411 CTCGGCTCAGTTACCTCCCCGGG + Intergenic
1042517282 8:69672892-69672914 CGGGGCTCTCTTCCAGCCCCGGG + Exonic
1042753385 8:72183366-72183388 CTGGTCTCTCTTACCTCAAGAGG - Intergenic
1043874430 8:85468243-85468265 CTGTGCTCTCTTAAGTCTCCTGG - Intronic
1048390605 8:133960229-133960251 CTGGGCCCTCCAGCCTCCCCAGG - Intergenic
1048544581 8:135374582-135374604 CTGGGCTCGCTCCCCTCACCAGG + Intergenic
1049251739 8:141592938-141592960 CTTGGCTCTATTTTCTCCCCGGG + Intergenic
1049273365 8:141707749-141707771 CTGGGCTCACTCCCCACCCCAGG - Intergenic
1049322125 8:142002124-142002146 CTGGGCTCTCTTGCAGCCTCTGG + Intergenic
1049428626 8:142549136-142549158 CTGGGCCCACCCACCTCCCCAGG + Intergenic
1049475133 8:142793804-142793826 TGGGCCTCTCTTCCCTCCCCTGG - Intergenic
1053607656 9:39677573-39677595 CTGGGTTCTCATAACTCCCTAGG - Intergenic
1054245878 9:62664833-62664855 CTGGGTTCTCATAACTCCCTAGG + Intergenic
1054560004 9:66699366-66699388 CTGGGTTCTCATAACTCCCTAGG + Intergenic
1057140349 9:92722944-92722966 CTGGGCTCCCTCTCCTCTCCAGG - Intronic
1057476653 9:95408619-95408641 CTGGGCTGTGTGACCACCCCTGG + Intergenic
1058510951 9:105716085-105716107 CTTGGATCTCTTACCTTCCTTGG + Intronic
1059465617 9:114467119-114467141 CTGGGGTCTCCTGCCTCCCCAGG + Intronic
1060301300 9:122375994-122376016 CCTGGCTCTCTCACCTGCCCAGG - Intronic
1060527978 9:124331356-124331378 GTGGTCTCTCTTACTTCCCTGGG - Intronic
1061283886 9:129611547-129611569 CAGGGCTCTCTTCCCTCGGCTGG + Intronic
1061711447 9:132490630-132490652 CTTGGCCCTCTTACCCTCCCTGG + Intronic
1062579575 9:137223334-137223356 CTGGGCTCCCGGCCCTCCCCAGG - Intergenic
1062617960 9:137406724-137406746 CTGGGCTCTCAGTACTCCCCCGG + Intronic
1062689667 9:137834751-137834773 CTTGGTTCTGTTCCCTCCCCAGG + Exonic
1186350402 X:8733167-8733189 CTGGGCTCTCCTACCTGCAAGGG - Intergenic
1186605374 X:11084600-11084622 TTGGGCTCTCTTAGGTACCCCGG - Intergenic
1187002975 X:15201052-15201074 CTGGGCTCCCTTCCCTCAACGGG - Intergenic
1187067885 X:15858373-15858395 CTGGGCACTTTTGCCTCCCAGGG + Intergenic
1189248929 X:39585026-39585048 CTGCACTCTCCTACCTGCCCTGG + Intergenic
1189305298 X:39982377-39982399 CTTGGCTCTCTTGCCTCAACTGG - Intergenic
1189992477 X:46608086-46608108 CTGGCCTCTCTGACCCCCTCAGG + Intronic
1193807532 X:86012732-86012754 CAGGGCTCTGATACCTCACCTGG + Intronic
1197251060 X:124216923-124216945 CTGGGAACTCTTTCCTCTCCTGG + Intronic
1198321480 X:135521843-135521865 CTGGCCCCTCCTTCCTCCCCCGG + Intronic
1200042419 X:153379770-153379792 CTGGGCTCTCCTCCTCCCCCAGG - Intergenic
1200279346 X:154763198-154763220 CTCGGCCCTCTCACCTCCCTGGG + Intronic
1200547266 Y:4533082-4533104 TTAGGCTCTCTTACATACCCTGG + Intergenic