ID: 1084973380

View in Genome Browser
Species Human (GRCh38)
Location 11:72783309-72783331
Sequence GTGAATGACCTTAGATCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084973374_1084973380 27 Left 1084973374 11:72783259-72783281 CCTGCAAAGTGAATCCTGGACAA 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1084973380 11:72783309-72783331 GTGAATGACCTTAGATCTCCAGG 0: 1
1: 0
2: 0
3: 2
4: 80
1084973378_1084973380 -8 Left 1084973378 11:72783294-72783316 CCTCATGAGGCCTGTGTGAATGA 0: 1
1: 0
2: 1
3: 9
4: 160
Right 1084973380 11:72783309-72783331 GTGAATGACCTTAGATCTCCAGG 0: 1
1: 0
2: 0
3: 2
4: 80
1084973376_1084973380 13 Left 1084973376 11:72783273-72783295 CCTGGACAATGTGCTGCAGGTCC 0: 1
1: 0
2: 3
3: 15
4: 160
Right 1084973380 11:72783309-72783331 GTGAATGACCTTAGATCTCCAGG 0: 1
1: 0
2: 0
3: 2
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084973380 Original CRISPR GTGAATGACCTTAGATCTCC AGG Intronic
900392269 1:2438837-2438859 CTGAAGGACCCTAGATCTGCAGG - Intronic
901586389 1:10297383-10297405 GAGAATGAACTTAAATCTCCCGG + Intronic
908080384 1:60571232-60571254 GTGAATGAGCTTAGTTTTCAAGG + Intergenic
914701999 1:150143053-150143075 CTTACTCACCTTAGATCTCCAGG - Intronic
917069913 1:171139305-171139327 ATTAATGACCTTATATCTCATGG - Intronic
918797355 1:188918426-188918448 GTAAATGTTCTTAGATTTCCAGG - Intergenic
920973013 1:210758542-210758564 GTGCTTGAGGTTAGATCTCCAGG - Intronic
921424714 1:214988205-214988227 GTGAATGCCTCTAGATCTTCAGG + Intergenic
924080690 1:240394541-240394563 ATGAATTATCTTAGATCTTCTGG - Intronic
1063886010 10:10579498-10579520 GTTATTGACCTTAGACCCCCGGG + Intergenic
1064971487 10:21071652-21071674 GTGACTGAACTGGGATCTCCAGG + Intronic
1067943981 10:50679129-50679151 GTGAATGAGCTGGGGTCTCCAGG - Intergenic
1068087918 10:52398121-52398143 CTGAATTACCTAAGAACTCCAGG - Intergenic
1068546320 10:58349968-58349990 ATGAATGAACTTACAGCTCCAGG - Intronic
1070776466 10:79112704-79112726 GGAAATGTCCTTAGATCTGCAGG - Intronic
1070865472 10:79705998-79706020 GTGAATGAGCTGGGGTCTCCAGG - Intronic
1070879266 10:79844129-79844151 GTGAATGAGCTGGGGTCTCCAGG - Intronic
1071632372 10:87228219-87228241 GTGAATGAGCTGGGGTCTCCAGG - Intronic
1071645825 10:87360437-87360459 GTGAATGAGCTGGGGTCTCCAGG - Intronic
1076935450 10:133565648-133565670 GAGAATTACCTCACATCTCCAGG - Intronic
1079079309 11:17402846-17402868 GTGAATGGCCTTACCTCTCTAGG + Intronic
1084973380 11:72783309-72783331 GTGAATGACCTTAGATCTCCAGG + Intronic
1087140346 11:94759649-94759671 GTGAATTACCTGAGATCACATGG - Intronic
1087621283 11:100545829-100545851 GTGCATGATCTTAAATCTCATGG + Intergenic
1088205975 11:107393004-107393026 GTGGATTGCCTTAAATCTCCTGG + Intronic
1091871741 12:3897245-3897267 CTAAATAAGCTTAGATCTCCAGG + Intergenic
1095849889 12:46790957-46790979 GTGACTTACCTTTTATCTCCTGG - Intronic
1099745711 12:86701982-86702004 ATCAATGATCTTAGATCTTCTGG - Intronic
1106594933 13:31127797-31127819 CTCAATGACCTTAGAGCCCCTGG + Intergenic
1106986779 13:35362583-35362605 GTGAGTCATCTTAGATCTCACGG - Intronic
1109435759 13:62299232-62299254 GTGAATAATTTTATATCTCCGGG - Intergenic
1109960001 13:69617301-69617323 GTGAATGGTCATAGGTCTCCTGG + Intergenic
1120978476 14:90270548-90270570 GTGAATGACGCTAAATCACCTGG + Exonic
1124055017 15:26234363-26234385 GTTAATCACCTGAGATCTCAGGG - Intergenic
1130646582 15:85733071-85733093 GTGACTGACCTAAGAACTTCTGG - Intronic
1134784586 16:16930225-16930247 GTGAGTTACCTTACATCTCTGGG - Intergenic
1149794655 17:59508117-59508139 GTTTATGACCTTATAGCTCCAGG - Intergenic
1155922019 18:31612968-31612990 GTGAATGACCTAACATTTCTAGG + Intergenic
1156429397 18:37055157-37055179 GTGAAGGAGCTTAAACCTCCTGG + Intronic
1158802925 18:60934145-60934167 GTGACTAACCTTAGAGCTACAGG + Intergenic
1165123212 19:33576468-33576490 GTGAATGAACTATGATATCCTGG + Intergenic
1168228364 19:55012581-55012603 GTGAATGAGCTTAGACTTACTGG + Intergenic
929399714 2:41565923-41565945 GTGAGTGAAATTAGATCACCTGG - Intergenic
929986601 2:46740189-46740211 GTGAATGACCTTACCTTACCTGG + Intronic
943679694 2:190755311-190755333 ATGAATGAACTTAGATATCAGGG - Intergenic
945916524 2:215710422-215710444 GTGGATGAGCTGAGATCTCCTGG - Intergenic
946054866 2:216892132-216892154 GTGAATGAGCGTAGAGTTCCTGG + Intergenic
946280418 2:218662140-218662162 GGGAATGAACGTAGATATCCGGG + Intronic
1170479581 20:16752728-16752750 GTCAATGACCTTCCAACTCCTGG - Intronic
1171811471 20:29746992-29747014 GTTAATGGACTAAGATCTCCTGG - Intergenic
1175217577 20:57399693-57399715 TTGAATGTCCCTAGACCTCCCGG + Intronic
1178773897 21:35530645-35530667 CTGAATGCCCTTTGACCTCCTGG + Intronic
1182535246 22:30996793-30996815 ATGAATGACCTAAGGTCTCGTGG - Intergenic
950652563 3:14416454-14416476 GTAAGTGACCTTGGACCTCCAGG + Intronic
951049900 3:18082609-18082631 CTGAATGACCTCAGATCTTTGGG - Intronic
963243072 3:143030107-143030129 ATCAATGACCTCAGATCTTCTGG - Intronic
966160320 3:176960768-176960790 GTGAAGAACCCTAGATCTCAGGG + Intergenic
966188826 3:177252597-177252619 GTGAATGACCTCAAAGCACCTGG - Intergenic
971193401 4:24448688-24448710 GTGATTAACCTTCGATCTTCTGG - Intergenic
980218604 4:129884024-129884046 GTTAAAGAATTTAGATCTCCAGG + Intergenic
982927950 4:161363498-161363520 GAGAATTACATCAGATCTCCAGG + Intergenic
984191273 4:176608583-176608605 TTGAATTTCCTTACATCTCCAGG - Intergenic
984241086 4:177219892-177219914 GTAAGAGACCTTAGATCTCATGG + Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
989147162 5:38260024-38260046 GATAATGACCTTAGATTTCAAGG - Intronic
991398714 5:66231794-66231816 GTCCATGACCTTAGATGACCCGG - Intergenic
992935584 5:81700660-81700682 ATCAATGATCTTAGATCTTCTGG + Intronic
995479661 5:112581702-112581724 GAGAATGACCATAGATTACCAGG + Intergenic
1000607230 5:163338150-163338172 GTGAATGACCTTAGCTTTTTTGG - Intergenic
1002711750 5:181199072-181199094 GTGAGTGACCTCACAGCTCCTGG - Intronic
1008446836 6:51601536-51601558 TTGAATAAACTTAGATCTCTTGG - Intergenic
1009264953 6:61542195-61542217 GTGAATAACATTAGAGTTCCCGG + Intergenic
1015746164 6:136512087-136512109 GTGATTGATCTGATATCTCCAGG + Intronic
1027139555 7:75647633-75647655 GTGAATTGCCTGAGAGCTCCGGG - Intronic
1028132368 7:87190806-87190828 GTAAATGACTTCAGGTCTCCAGG + Intronic
1037363430 8:18097658-18097680 TTGTATGACCTTATTTCTCCTGG + Intergenic
1039087699 8:33796215-33796237 GAGTATGACCTTAATTCTCCTGG + Intergenic
1039720166 8:40155422-40155444 GTGAATTACCTCACATCTGCTGG + Intergenic
1043550215 8:81363144-81363166 GTGAATGACCTTGGCTGTCTAGG + Intergenic
1048436614 8:134424372-134424394 GTGAATGGCCTTATATGTCATGG - Intergenic
1055648968 9:78388498-78388520 GTGAATGACTGTAGTTCCCCCGG - Intergenic
1057276797 9:93680486-93680508 GTGAATGACCACAGGTCTGCGGG - Intergenic
1197234509 X:124044453-124044475 CTGAATTACCTTACATCTCTAGG + Intronic