ID: 1084973902

View in Genome Browser
Species Human (GRCh38)
Location 11:72785936-72785958
Sequence GCAAATTCACAGGTTGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 203}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084973894_1084973902 12 Left 1084973894 11:72785901-72785923 CCTCAGGGGTAACCCTGCCTGCC 0: 1
1: 0
2: 2
3: 20
4: 220
Right 1084973902 11:72785936-72785958 GCAAATTCACAGGTTGTGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 203
1084973882_1084973902 30 Left 1084973882 11:72785883-72785905 CCTTCTCCCCCACCCCCTCCTCA 0: 1
1: 2
2: 53
3: 708
4: 6104
Right 1084973902 11:72785936-72785958 GCAAATTCACAGGTTGTGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 203
1084973892_1084973902 16 Left 1084973892 11:72785897-72785919 CCCTCCTCAGGGGTAACCCTGCC 0: 1
1: 0
2: 2
3: 14
4: 192
Right 1084973902 11:72785936-72785958 GCAAATTCACAGGTTGTGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 203
1084973890_1084973902 18 Left 1084973890 11:72785895-72785917 CCCCCTCCTCAGGGGTAACCCTG 0: 1
1: 0
2: 1
3: 23
4: 224
Right 1084973902 11:72785936-72785958 GCAAATTCACAGGTTGTGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 203
1084973893_1084973902 15 Left 1084973893 11:72785898-72785920 CCTCCTCAGGGGTAACCCTGCCT 0: 1
1: 0
2: 3
3: 20
4: 204
Right 1084973902 11:72785936-72785958 GCAAATTCACAGGTTGTGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 203
1084973886_1084973902 24 Left 1084973886 11:72785889-72785911 CCCCCACCCCCTCCTCAGGGGTA 0: 1
1: 0
2: 7
3: 49
4: 499
Right 1084973902 11:72785936-72785958 GCAAATTCACAGGTTGTGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 203
1084973889_1084973902 21 Left 1084973889 11:72785892-72785914 CCACCCCCTCCTCAGGGGTAACC 0: 1
1: 0
2: 0
3: 39
4: 346
Right 1084973902 11:72785936-72785958 GCAAATTCACAGGTTGTGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 203
1084973888_1084973902 22 Left 1084973888 11:72785891-72785913 CCCACCCCCTCCTCAGGGGTAAC 0: 1
1: 0
2: 4
3: 20
4: 238
Right 1084973902 11:72785936-72785958 GCAAATTCACAGGTTGTGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 203
1084973896_1084973902 0 Left 1084973896 11:72785913-72785935 CCCTGCCTGCCAGTTTTGATGGA 0: 1
1: 1
2: 1
3: 16
4: 161
Right 1084973902 11:72785936-72785958 GCAAATTCACAGGTTGTGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 203
1084973897_1084973902 -1 Left 1084973897 11:72785914-72785936 CCTGCCTGCCAGTTTTGATGGAG 0: 1
1: 0
2: 3
3: 14
4: 169
Right 1084973902 11:72785936-72785958 GCAAATTCACAGGTTGTGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 203
1084973898_1084973902 -5 Left 1084973898 11:72785918-72785940 CCTGCCAGTTTTGATGGAGCAAA 0: 1
1: 0
2: 0
3: 15
4: 133
Right 1084973902 11:72785936-72785958 GCAAATTCACAGGTTGTGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 203
1084973891_1084973902 17 Left 1084973891 11:72785896-72785918 CCCCTCCTCAGGGGTAACCCTGC 0: 1
1: 0
2: 1
3: 13
4: 153
Right 1084973902 11:72785936-72785958 GCAAATTCACAGGTTGTGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 203
1084973899_1084973902 -9 Left 1084973899 11:72785922-72785944 CCAGTTTTGATGGAGCAAATTCA 0: 1
1: 0
2: 0
3: 15
4: 147
Right 1084973902 11:72785936-72785958 GCAAATTCACAGGTTGTGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 203
1084973887_1084973902 23 Left 1084973887 11:72785890-72785912 CCCCACCCCCTCCTCAGGGGTAA 0: 1
1: 0
2: 2
3: 32
4: 326
Right 1084973902 11:72785936-72785958 GCAAATTCACAGGTTGTGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084973902 Original CRISPR GCAAATTCACAGGTTGTGCA GGG Intronic
900492050 1:2955184-2955206 GCAAATACACAGGTTCCACATGG + Intergenic
904313767 1:29646587-29646609 GGAAATTCACATGTTCTCCAGGG - Intergenic
905492602 1:38356156-38356178 GCAAAGAGACAGCTTGTGCAGGG - Intergenic
905841580 1:41184779-41184801 GAAAATTCACAGGTTGTAAAGGG + Intronic
910861077 1:91742809-91742831 TCAAATACAAATGTTGTGCATGG - Intronic
913134770 1:115877725-115877747 GGAAATTCACACATTATGCATGG + Intergenic
913647835 1:120877671-120877693 GCAAAGAGACAGCTTGTGCAGGG - Intergenic
913989393 1:143596455-143596477 TCAAATACTCAGGTTGTTCATGG + Intergenic
914078793 1:144385177-144385199 GCAAAGAGACAGCTTGTGCAGGG + Intergenic
914100386 1:144581325-144581347 GCAAAGAGACAGCTTGTGCAGGG - Intergenic
914173699 1:145253722-145253744 GCAAAGAGACAGCTTGTGCAGGG + Intergenic
914298607 1:146356357-146356379 GCAAAGAGACAGCTTGTGCAGGG + Intergenic
914528360 1:148494908-148494930 GCAAAGAGACAGCTTGTGCAGGG + Intergenic
914638031 1:149572197-149572219 GCAAAGAGACAGCTTGTGCAGGG - Intergenic
917736105 1:177921697-177921719 GCAATTACACAGGTTGTAAAGGG + Intergenic
919475429 1:198027167-198027189 GCAAATAGAGAGCTTGTGCAGGG - Intergenic
920685086 1:208103137-208103159 CCAAACTTACATGTTGTGCAGGG + Exonic
923048856 1:230376108-230376130 GCAGAGTCACAGGGTGTCCAAGG + Intronic
923049480 1:230380777-230380799 GCTCAATCACAGCTTGTGCAGGG + Intronic
1063335790 10:5211894-5211916 GCAAAGAGACAGCTTGTGCAGGG + Intronic
1064791588 10:18962584-18962606 GCAAAGACAGAGTTTGTGCAGGG + Intergenic
1065806433 10:29397491-29397513 CCAAATCCACAAGATGTGCAGGG - Intergenic
1065995931 10:31059573-31059595 CCAGGATCACAGGTTGTGCAGGG - Intergenic
1066528447 10:36308530-36308552 ACAAATACACAGGCTGGGCATGG + Intergenic
1067739456 10:48883366-48883388 GCAAATAGAAAGTTTGTGCAAGG + Intronic
1067898523 10:50212852-50212874 GCAAATGCTCAGGTTGTGCTGGG - Intronic
1071320733 10:84454377-84454399 TCATATTCACAGGTTCTGGATGG + Intronic
1071727025 10:88209229-88209251 TCACATTCACAGGTTCTGGATGG - Intergenic
1072075662 10:91970490-91970512 GCAAAGACAGAGCTTGTGCAGGG + Intronic
1073893742 10:108129937-108129959 GAGAATCCCCAGGTTGTGCATGG - Intergenic
1074898798 10:117799333-117799355 TCAAATCCAGAGGATGTGCAAGG + Intergenic
1075076658 10:119356254-119356276 ACAAATTCTCAGGGTGTGGAGGG + Intronic
1075938112 10:126360986-126361008 GCAAAGAGAGAGGTTGTGCAGGG + Intronic
1076225744 10:128773678-128773700 GCAAACAGAGAGGTTGTGCAGGG - Intergenic
1077195451 11:1277584-1277606 GCAAATTCACGAGTTCTGAAGGG - Intronic
1078760104 11:14244940-14244962 GCAAAATCAAAGCTTGTTCAAGG - Intronic
1080088386 11:28314867-28314889 GCAAAATGAGAGCTTGTGCAGGG - Intronic
1080702406 11:34655108-34655130 ACAAATTCACAGGAAATGCAAGG - Intronic
1081978448 11:47250823-47250845 CCAAATTCACAGTTTGGGCATGG + Intronic
1082652197 11:55807281-55807303 GCAAAAACAGAGCTTGTGCAGGG + Intergenic
1084659467 11:70538445-70538467 GCAAAATCACAGGTGGCACATGG + Intronic
1084973902 11:72785936-72785958 GCAAATTCACAGGTTGTGCAGGG + Intronic
1086269480 11:85044079-85044101 GCAAAGTAACAGCATGTGCATGG - Intronic
1086779949 11:90891421-90891443 GCAAATTCTCAGGATCAGCAGGG - Intergenic
1086868245 11:92006292-92006314 GCTAATTCACAGGAAGTCCAAGG - Intergenic
1087954980 11:104274830-104274852 GAAAATACACAGGTTGTGGTTGG - Intergenic
1090108833 11:123883182-123883204 GGGAATTCACAGTGTGTGCACGG + Exonic
1090680813 11:129055738-129055760 GAAAGATCACAGGTTGTGAAGGG + Intronic
1091101301 11:132876303-132876325 GATACTTCAGAGGTTGTGCATGG - Intronic
1092864326 12:12746668-12746690 GTACATGCACAGGTTGTACATGG + Intronic
1093683106 12:22025094-22025116 ACAAAATCACAGGTTTTTCAGGG + Intergenic
1094303644 12:28994003-28994025 GCAAATTCACAGTGTGGGGAGGG + Intergenic
1096205882 12:49721564-49721586 GCAAAGAGACAGCTTGTGCACGG + Intronic
1097522899 12:60690310-60690332 GCAAAAAGAAAGGTTGTGCAGGG - Intergenic
1097820282 12:64121543-64121565 GCAACATCACAGGCTGGGCATGG - Intronic
1101437993 12:104680385-104680407 GCAAACACAAAGGCTGTGCAAGG + Intronic
1102162975 12:110784227-110784249 ACAAACTCACAGGTTCAGCAGGG + Intergenic
1104010064 12:124923972-124923994 GCAAATTCACAGTTTAAGAATGG - Intergenic
1104054164 12:125216644-125216666 GCAAATTGACAGGATGTTAAAGG + Intronic
1104074899 12:125380409-125380431 TCATATTCACAGGTTCTGGATGG + Intronic
1107110134 13:36688501-36688523 GAAAATTCTCAGGCTGGGCATGG - Intronic
1108270919 13:48758787-48758809 TCATATTCACAGGTTTTGGATGG - Intergenic
1108819027 13:54323064-54323086 GAAAACTCACAGGCTGTGAAGGG + Intergenic
1110927002 13:81165647-81165669 GCAAAGACAGAGATTGTGCAGGG + Intergenic
1111325950 13:86695949-86695971 GCAAATAGAGAGCTTGTGCAGGG + Intergenic
1112496882 13:99912252-99912274 TACAATTCACAGTTTGTGCACGG - Intergenic
1114755551 14:25255549-25255571 GTAAATTCACAAGTTCTGAAGGG - Intergenic
1115437015 14:33386765-33386787 GGAAGTTCACAGATTTTGCAAGG + Intronic
1118944285 14:70369383-70369405 GCAAGTTCATAGGCTGGGCATGG - Exonic
1119805651 14:77480389-77480411 CCAAATCCTCAGGGTGTGCAGGG + Intronic
1120836709 14:89044941-89044963 GCAAAGTCACAGATACTGCAAGG - Intergenic
1122069062 14:99194063-99194085 GCAAATTCAGTGATTTTGCAAGG + Intronic
1122938163 14:104969455-104969477 GCAAATTCACAGACTGAGCTTGG + Intronic
1129800363 15:78409307-78409329 ACAAATTCCCAGTTTGTGCCAGG - Intergenic
1132213504 15:100045095-100045117 CCAAATTAACAGGCTGGGCATGG - Intronic
1134280944 16:12816545-12816567 TCAAATTCACAGGTTCTAGATGG - Intergenic
1134597414 16:15507086-15507108 GTAAAGGCAGAGGTTGTGCAGGG + Intronic
1135405478 16:22194638-22194660 GAAAGTTCACTGGTTGGGCACGG - Intergenic
1135677400 16:24428475-24428497 GGAAATTCACACTTTGGGCAGGG + Intergenic
1135951539 16:26918894-26918916 GCAAATAGAGAGCTTGTGCAGGG - Intergenic
1140113904 16:72025548-72025570 GCACATTCACAAGGTGTTCACGG - Intronic
1141967704 16:87458171-87458193 TAAGATTCACAGGGTGTGCAGGG + Intronic
1142148906 16:88504137-88504159 GCAAATGAACAGGCTGAGCAGGG + Intronic
1147955808 17:44133757-44133779 ACAAATTCACAGCTTGTTCTAGG - Intergenic
1151984626 17:77534321-77534343 GCAAAGAGAGAGGTTGTGCAGGG - Intergenic
1153151179 18:2095350-2095372 AAACATTCACAGGCTGTGCACGG + Intergenic
1153206863 18:2712544-2712566 TCATATACACAGGTTCTGCAGGG + Intronic
1153608764 18:6860607-6860629 GCACATTCAAAGGTTCTGCTGGG + Intronic
1156462906 18:37331721-37331743 GCAAATTCATGGGGTGGGCAGGG + Intronic
1156657013 18:39300381-39300403 GCAAAATCAAAGGTAGTGCCAGG + Intergenic
1159637294 18:70820762-70820784 AGAAATGCACTGGTTGTGCATGG + Intergenic
1159641070 18:70863814-70863836 GCAAAAACAGAGCTTGTGCAGGG - Intergenic
1160616649 18:80135732-80135754 GCAAATACACAGTTTGGGCAAGG - Exonic
1161540555 19:4848463-4848485 CTATATTCACAGGTTGTCCAAGG - Intronic
1162161172 19:8718350-8718372 TGAAATTCACAGGCTGGGCATGG - Intergenic
1164509239 19:28883947-28883969 GGAAATTGACAGGTTGTCCCAGG - Intergenic
1164605064 19:29591945-29591967 GGAATTTCAAAGGGTGTGCAGGG + Intergenic
1165738304 19:38191520-38191542 GCAAAGACACAGGTCGGGCACGG + Intronic
925245834 2:2381715-2381737 GCAAACTCAGAGGCTGTCCAGGG + Intergenic
925569792 2:5296761-5296783 TCAAATGCACATGTTGTGAAAGG - Intergenic
928289513 2:30025163-30025185 GCTAATTCACTGCTTGTCCATGG + Intergenic
929214240 2:39393796-39393818 TCATATACACAGGTTCTGCAGGG - Intronic
930909139 2:56609707-56609729 GCAAGTTCACAGGAAGTGAAGGG - Intergenic
932769857 2:74494713-74494735 GCAATTTCTCAGGCTGGGCACGG + Exonic
932785156 2:74594581-74594603 GTAAATTTACAGGCTGGGCATGG + Intronic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
940109570 2:150136714-150136736 GGAAATTCAACGGATGTGCATGG - Intergenic
941050019 2:160722246-160722268 TAAAATGCACAAGTTGTGCATGG + Intergenic
942752353 2:179302349-179302371 GCAAAAAGAGAGGTTGTGCAGGG - Intergenic
944060151 2:195563336-195563358 TCACATTCACAGCTTGGGCAGGG - Intergenic
946534677 2:220613422-220613444 GCTATTTCACAGGTTGTTGAGGG - Intergenic
947348723 2:229220626-229220648 GAAAAGACCCAGGTTGTGCAGGG - Intronic
947642485 2:231714726-231714748 GCAGATACCCAGGCTGTGCAGGG - Intergenic
948841880 2:240655141-240655163 GCAAAGACAGAGCTTGTGCAGGG + Intergenic
948892088 2:240912413-240912435 GCAAATTATCAAGTTGAGCAGGG - Intergenic
1169832048 20:9836273-9836295 TCATATTCACAGGTTCTGGATGG - Intronic
1173297039 20:41768864-41768886 GTGAGTTCACAGGTTCTGCAAGG - Intergenic
1175663102 20:60834636-60834658 ACTAATTCACAGGTTGTCAAAGG + Intergenic
1179775934 21:43662213-43662235 GCAAATGCAGAGGTTATGCGGGG + Intronic
1180937721 22:19637100-19637122 GCCAGATCACAGGTTGTGCAGGG - Intergenic
1181561324 22:23703499-23703521 GCAAAATCCCAGGCTGAGCACGG + Intergenic
950468368 3:13169253-13169275 GCAAAGACAGAGCTTGTGCAGGG - Intergenic
954397394 3:50299933-50299955 GCAGATTCAGGGGTCGTGCAGGG + Exonic
955502098 3:59595652-59595674 GCAAATAGAGAGCTTGTGCAGGG - Intergenic
957704744 3:83765953-83765975 GCAAATTCATATTTTGTGCAAGG + Intergenic
957749005 3:84388020-84388042 GCAAATTCCCTGGCTGGGCACGG - Intergenic
958916231 3:100053591-100053613 TCACATTCACAGGTTTTGCTAGG + Intronic
960187737 3:114664185-114664207 TCAAAATCTCAGGTTTTGCAAGG - Intronic
965492807 3:169360696-169360718 GCAAATTCACAGGATGGCCAGGG + Intronic
965777185 3:172243480-172243502 GCAAAAAAAGAGGTTGTGCAGGG + Intronic
966156174 3:176919207-176919229 TGAAATTCACAGATTGTGCTGGG - Intergenic
969052893 4:4385790-4385812 GCAAGTTCCCAGGCTGTGCCTGG + Intronic
970121605 4:12759482-12759504 GCAAAGAGACAGCTTGTGCAGGG - Intergenic
971568453 4:28177264-28177286 GCAAATTCACTGAGTGTGAACGG + Intergenic
975224066 4:71849135-71849157 GCATATTCACAGGCTCTGCAGGG + Intergenic
976614767 4:87065245-87065267 GCAAAGAGAGAGGTTGTGCAGGG + Intronic
976670857 4:87651617-87651639 GTACATTTACAGGTTGTACATGG + Intronic
977468699 4:97414618-97414640 GGAAATTCACAGCTTGTCCTGGG - Intronic
978862972 4:113472970-113472992 GCAAATTCAGAGGCTGTGCCAGG + Intronic
979108540 4:116719334-116719356 GCAAAGAGAGAGGTTGTGCAGGG + Intergenic
979719773 4:123885115-123885137 GCAAAGTGAGAGCTTGTGCAGGG - Intergenic
982771140 4:159398655-159398677 GCAAACTCACAGGCTACGCAAGG - Intergenic
983302788 4:165948579-165948601 GCAGAGTCACAGGCAGTGCAGGG + Intronic
984868067 4:184300065-184300087 GAGAATTCACAGGCTGGGCATGG - Intergenic
985110187 4:186540287-186540309 ACATATTCACAGGGTCTGCAGGG - Intronic
985759227 5:1736440-1736462 GCAGATGCATAGGATGTGCAAGG - Intergenic
987733711 5:21810350-21810372 GCAAATTCATAGGTGGAGAAAGG + Intronic
988886158 5:35560160-35560182 GCAAAGAGACAGCTTGTGCAGGG + Intergenic
989497508 5:42126044-42126066 GCAAAGAGACAGCTTGTGCAGGG - Intergenic
994326703 5:98456159-98456181 GCAGATTCTCAGGTTTTCCAAGG + Intergenic
994553000 5:101260777-101260799 GCAAAGAGACAGTTTGTGCAGGG - Intergenic
994853323 5:105085125-105085147 GCAAATAGAGAGCTTGTGCAGGG - Intergenic
996290288 5:121844675-121844697 TCACATTCACAGGTTCTGGATGG + Intergenic
997155433 5:131551221-131551243 GTTAATTCACAGGCTGGGCAGGG + Intronic
999176120 5:149632843-149632865 GCAAATTCAGAGGCTGTTCCAGG + Exonic
1003217175 6:4124907-4124929 GCATCTTTGCAGGTTGTGCAAGG - Intronic
1003760367 6:9172800-9172822 GCCCATTCACAGGATGTGCAAGG + Intergenic
1004032072 6:11880289-11880311 GCAAAGAGAGAGGTTGTGCAGGG + Intergenic
1008004797 6:46399875-46399897 TCACATTCACAGGTTCTGGATGG + Intronic
1010330577 6:74618850-74618872 GCAAAGACAGAGCTTGTGCAGGG + Intergenic
1011537086 6:88387640-88387662 GCAAGCTCACAGGCTGTGAAAGG + Intergenic
1015880894 6:137868834-137868856 GCAGTTTTACAGGCTGTGCAAGG + Intronic
1016128678 6:140437857-140437879 CCAAATTAACAGGGTGTGGATGG + Intergenic
1017292955 6:152762617-152762639 GCAAAAACAGAGCTTGTGCAGGG + Intergenic
1020814845 7:12892871-12892893 GCAAACTCACAGGGTGGACATGG - Intergenic
1021673245 7:23053903-23053925 GCAAAAAGACAGCTTGTGCAGGG + Intergenic
1021681996 7:23142421-23142443 GCAAATTGACAGGTTGGACCTGG + Intronic
1023265104 7:38396336-38396358 GCAAAAACAGAGCTTGTGCAGGG - Intronic
1023615354 7:42014130-42014152 GCAACTTGCCAGGTTTTGCAAGG + Intronic
1025157890 7:56625805-56625827 GGAAGTTCACACCTTGTGCAGGG + Intergenic
1026660605 7:72298840-72298862 GCAAAAGCAGAGTTTGTGCAGGG - Intronic
1027676797 7:81169643-81169665 TCACATTCACAAGTTGTGGACGG + Intergenic
1027864855 7:83632512-83632534 GCAAAGACAGAGTTTGTGCAGGG - Intronic
1030144815 7:106342335-106342357 GCAAAGTGAGAGCTTGTGCAGGG + Intergenic
1030315949 7:108114532-108114554 GCAAATTCTCTGCATGTGCAAGG - Intronic
1030941933 7:115661101-115661123 TCAAACTCACATGTTGTTCAAGG + Intergenic
1031438551 7:121763816-121763838 GCAAATAGAGAGCTTGTGCAGGG + Intergenic
1031878934 7:127174253-127174275 GCAAACTCAGATGTTGTGCATGG + Intronic
1032060061 7:128716776-128716798 CCAAATGCTCAGGTTGTGCCTGG + Intronic
1033031723 7:137833380-137833402 GCAAAGAGACAGCTTGTGCAGGG + Intronic
1033181372 7:139182530-139182552 GGAAATTAACAGGCTGTGCTTGG + Intronic
1035011694 7:155723840-155723862 GCATATACACATGTTGTACAAGG - Intronic
1036975098 8:13402081-13402103 GCAAGTTTTCAGTTTGTGCAGGG + Intronic
1037956706 8:23065990-23066012 CCAAAATCATAGGTTGCGCACGG + Intronic
1043993271 8:86781580-86781602 GCAAAGAGAGAGGTTGTGCAAGG - Intergenic
1046276854 8:111972759-111972781 GAAAAATCATAGGTTATGCAAGG - Intergenic
1046405828 8:113770634-113770656 GCAAAAACAGAGTTTGTGCAGGG - Intergenic
1046560901 8:115836181-115836203 TCAAATTCATAGGTTGGGCTGGG - Intergenic
1047513927 8:125537173-125537195 GCAAAGTGAGAGCTTGTGCAGGG + Intergenic
1047865757 8:129022747-129022769 GCAAATAGAGAGTTTGTGCAGGG - Intergenic
1048864047 8:138746277-138746299 GCACATGCTCAGGCTGTGCAAGG - Intronic
1049050000 8:140187234-140187256 TCATATACACAGGTTCTGCAAGG + Intronic
1049270942 8:141695990-141696012 GCAAGTTCACAGGCTGTGGGTGG + Intergenic
1053397944 9:37791531-37791553 GCAAATAGAGAGCTTGTGCAGGG + Intronic
1053619975 9:39805000-39805022 GCAAAGTGAGAGCTTGTGCAGGG - Intergenic
1053626720 9:39878942-39878964 GCAAAGTGAGAGCTTGTGCAGGG + Intergenic
1054217167 9:62371761-62371783 GCAAAGTGAGAGCTTGTGCAGGG - Intergenic
1054264181 9:62902444-62902466 GCAAAGTGAGAGCTTGTGCAGGG + Intergenic
1055579163 9:77690161-77690183 GCAAAGAGACAGCTTGTGCAGGG + Intergenic
1057450134 9:95151056-95151078 GCACATTTACAGGATGTGCCTGG + Intronic
1058882928 9:109301021-109301043 GTAAAATTACAGGTTGAGCAGGG - Intronic
1059124872 9:111674866-111674888 TCATATACACAGGTTCTGCAGGG - Intergenic
1060456579 9:123804192-123804214 GCAAAGACAGAGCTTGTGCATGG - Intronic
1185956462 X:4496169-4496191 CCAAATTGACAGGATGTGCTAGG + Intergenic
1186974627 X:14888455-14888477 GCAAAGAGAGAGGTTGTGCAGGG - Intronic
1190838731 X:54126448-54126470 TCATATACACAGGTTCTGCAGGG + Intronic
1192334503 X:70205988-70206010 GCAAACTTACAGTTGGTGCATGG - Intergenic
1193153587 X:78149087-78149109 GCAAAGACAGAGATTGTGCAGGG - Intergenic
1193601659 X:83513921-83513943 GAAAATGCAGAGGTTGTGGAGGG + Intergenic
1194299296 X:92164886-92164908 GCAAAAACAGAGCTTGTGCAGGG - Intronic
1197069512 X:122279238-122279260 GAAAATTCAAAGGATGTGCCTGG + Intergenic
1197943436 X:131813466-131813488 GCAAATTCAAAGGTTCAACAGGG + Intergenic
1200616900 Y:5389720-5389742 GCAAAAACAGAGCTTGTGCAGGG - Intronic
1201959243 Y:19660548-19660570 GCAAAGACAGAGCTTGTGCAGGG + Intergenic
1202085275 Y:21129744-21129766 GAAAATGCACAGGTTTTTCAAGG + Intergenic