ID: 1084977426

View in Genome Browser
Species Human (GRCh38)
Location 11:72809942-72809964
Sequence CTGATCAATATGAAGGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084977421_1084977426 -8 Left 1084977421 11:72809927-72809949 CCAGCCTGTCCTATCCTGATCAA No data
Right 1084977426 11:72809942-72809964 CTGATCAATATGAAGGTGTGAGG No data
1084977420_1084977426 -1 Left 1084977420 11:72809920-72809942 CCACAGACCAGCCTGTCCTATCC No data
Right 1084977426 11:72809942-72809964 CTGATCAATATGAAGGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084977426 Original CRISPR CTGATCAATATGAAGGTGTG AGG Intergenic
No off target data available for this crispr