ID: 1084978042

View in Genome Browser
Species Human (GRCh38)
Location 11:72814119-72814141
Sequence ACGCGGGTGGAGCGCTCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 36}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084978042_1084978052 -3 Left 1084978042 11:72814119-72814141 CCTCCGGAGCGCTCCACCCGCGT 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1084978052 11:72814139-72814161 CGTGGGGGAAGCCTCCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 110
1084978042_1084978051 -6 Left 1084978042 11:72814119-72814141 CCTCCGGAGCGCTCCACCCGCGT 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1084978051 11:72814136-72814158 CCGCGTGGGGGAAGCCTCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084978042 Original CRISPR ACGCGGGTGGAGCGCTCCGG AGG (reversed) Intergenic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
905124434 1:35707426-35707448 CCGTGGGTGGAGCTGTCCGGTGG + Intergenic
923628736 1:235635558-235635580 ATGGGGGTGGAGCCCTCCTGAGG + Intronic
1065529317 10:26652903-26652925 AGGCGGGAGGATCGCTCAGGAGG + Intergenic
1065926027 10:30434334-30434356 CCGCGGCTGGAGCGCTCGGCCGG + Exonic
1069486518 10:68827415-68827437 AGGCCGGCGGAGCGCTCTGGAGG - Intergenic
1074923712 10:118046485-118046507 ACCCGGGCGGAGGGCTGCGGGGG + Exonic
1075375410 10:121974790-121974812 GCGCGGGGGGAGGGCACCGGAGG - Intronic
1076903518 10:133351320-133351342 ACGCGGGTGGAGGACACCTGGGG - Intronic
1084960131 11:72712244-72712266 ACGGGGGTGGAGCCCCCAGGCGG + Exonic
1084978042 11:72814119-72814141 ACGCGGGTGGAGCGCTCCGGAGG - Intergenic
1089496368 11:118910391-118910413 CCACGGCTGGAGCGCTCTGGGGG - Exonic
1103509745 12:121466668-121466690 TCGGGGCTGGAGCGCTCCCGGGG - Intronic
1104983325 12:132583407-132583429 TCGCGGTAGGGGCGCTCCGGGGG - Exonic
1121562937 14:94887766-94887788 CCCCGGGTTGAGCTCTCCGGAGG + Intergenic
1147200878 17:38800099-38800121 CCGCGGGTGGAGCGCGCCCGGGG - Intronic
1147265464 17:39231841-39231863 AAGGGGGTGGAGCCCTGCGGAGG + Intergenic
1147754813 17:42761271-42761293 CTCCGGGTGGAGCGCGCCGGCGG + Exonic
1151301972 17:73233030-73233052 AGGCGGCTGGAGAGCGCCGGAGG + Intronic
1156171686 18:34493795-34493817 AAGCGGGCGGAGAGCGCCGGCGG + Intronic
1160541580 18:79626916-79626938 AGGTGGGTGGAGAGCTCTGGAGG - Intergenic
931947353 2:67324938-67324960 ACCCGGGTGGAATGCTCAGGGGG - Intergenic
937208570 2:120252826-120252848 ACGCCGGAGGCGCGCTCGGGGGG + Exonic
946279897 2:218659310-218659332 ATGCGGGTGGAGCGAGCTGGAGG - Exonic
1169143736 20:3239556-3239578 ACGCGGGGGAAGCCCTCCCGGGG - Intergenic
1185398427 22:50604072-50604094 ACGCGGGCGGCGCGCGCCTGGGG + Exonic
957072878 3:75579948-75579970 ACGCGGGCGCAGGGGTCCGGGGG - Intergenic
969737465 4:9001066-9001088 ACGCGGGCGCAGGGGTCCGGGGG + Intergenic
980102227 4:128553181-128553203 CCCCGGGAGGAGAGCTCCGGAGG - Intergenic
987123738 5:14792077-14792099 ACGAGGGTGGAGGGCTCTGAGGG + Intronic
1017666102 6:156721435-156721457 ACCTGGGTGGAGAGATCCGGGGG + Intergenic
1020125382 7:5530297-5530319 GCTCGGGAGGCGCGCTCCGGGGG - Intronic
1035683205 8:1503880-1503902 ACGTGGGTGGAGGACTCTGGAGG + Intronic
1045231409 8:100310170-100310192 ACGCGGGCGGCGCGCTGGGGCGG - Intronic
1053230162 9:36401120-36401142 AAAAGGGAGGAGCGCTCCGGTGG - Intronic
1054775785 9:69122276-69122298 ACGCGGGCGGAGCGCGGCGCTGG + Intronic
1057773434 9:97985373-97985395 GCGAGGGTGGGCCGCTCCGGGGG + Intronic
1062463668 9:136672103-136672125 ACCCGGGAGGAGGGCTCTGGAGG - Intronic