ID: 1084978042

View in Genome Browser
Species Human (GRCh38)
Location 11:72814119-72814141
Sequence ACGCGGGTGGAGCGCTCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 36}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084978042_1084978052 -3 Left 1084978042 11:72814119-72814141 CCTCCGGAGCGCTCCACCCGCGT 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1084978052 11:72814139-72814161 CGTGGGGGAAGCCTCCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 110
1084978042_1084978051 -6 Left 1084978042 11:72814119-72814141 CCTCCGGAGCGCTCCACCCGCGT 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1084978051 11:72814136-72814158 CCGCGTGGGGGAAGCCTCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084978042 Original CRISPR ACGCGGGTGGAGCGCTCCGG AGG (reversed) Intergenic