ID: 1084978051

View in Genome Browser
Species Human (GRCh38)
Location 11:72814136-72814158
Sequence CCGCGTGGGGGAAGCCTCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 90}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084978041_1084978051 -3 Left 1084978041 11:72814116-72814138 CCGCCTCCGGAGCGCTCCACCCG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1084978051 11:72814136-72814158 CCGCGTGGGGGAAGCCTCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 90
1084978039_1084978051 -1 Left 1084978039 11:72814114-72814136 CCCCGCCTCCGGAGCGCTCCACC 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1084978051 11:72814136-72814158 CCGCGTGGGGGAAGCCTCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 90
1084978035_1084978051 14 Left 1084978035 11:72814099-72814121 CCCGGGCCTTGAGGGCCCCGCCT 0: 1
1: 0
2: 2
3: 17
4: 268
Right 1084978051 11:72814136-72814158 CCGCGTGGGGGAAGCCTCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 90
1084978038_1084978051 8 Left 1084978038 11:72814105-72814127 CCTTGAGGGCCCCGCCTCCGGAG 0: 1
1: 0
2: 2
3: 101
4: 814
Right 1084978051 11:72814136-72814158 CCGCGTGGGGGAAGCCTCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 90
1084978040_1084978051 -2 Left 1084978040 11:72814115-72814137 CCCGCCTCCGGAGCGCTCCACCC 0: 1
1: 0
2: 0
3: 7
4: 200
Right 1084978051 11:72814136-72814158 CCGCGTGGGGGAAGCCTCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 90
1084978042_1084978051 -6 Left 1084978042 11:72814119-72814141 CCTCCGGAGCGCTCCACCCGCGT 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1084978051 11:72814136-72814158 CCGCGTGGGGGAAGCCTCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 90
1084978036_1084978051 13 Left 1084978036 11:72814100-72814122 CCGGGCCTTGAGGGCCCCGCCTC 0: 1
1: 0
2: 0
3: 29
4: 275
Right 1084978051 11:72814136-72814158 CCGCGTGGGGGAAGCCTCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 90
1084978044_1084978051 -9 Left 1084978044 11:72814122-72814144 CCGGAGCGCTCCACCCGCGTGGG 0: 1
1: 0
2: 0
3: 2
4: 99
Right 1084978051 11:72814136-72814158 CCGCGTGGGGGAAGCCTCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084978051 Original CRISPR CCGCGTGGGGGAAGCCTCCC CGG Intergenic