ID: 1084978393

View in Genome Browser
Species Human (GRCh38)
Location 11:72815520-72815542
Sequence GACTCACAGCTCCCTGGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 985
Summary {0: 1, 1: 0, 2: 3, 3: 72, 4: 909}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084978393_1084978400 1 Left 1084978393 11:72815520-72815542 CCCGACCCAGGGAGCTGTGAGTC 0: 1
1: 0
2: 3
3: 72
4: 909
Right 1084978400 11:72815544-72815566 GAGGGACTAGAGAGATCTGGAGG 0: 1
1: 0
2: 2
3: 17
4: 207
1084978393_1084978402 20 Left 1084978393 11:72815520-72815542 CCCGACCCAGGGAGCTGTGAGTC 0: 1
1: 0
2: 3
3: 72
4: 909
Right 1084978402 11:72815563-72815585 GAGGGCTGAAATCAGACTGAAGG 0: 1
1: 0
2: 0
3: 21
4: 233
1084978393_1084978401 2 Left 1084978393 11:72815520-72815542 CCCGACCCAGGGAGCTGTGAGTC 0: 1
1: 0
2: 3
3: 72
4: 909
Right 1084978401 11:72815545-72815567 AGGGACTAGAGAGATCTGGAGGG 0: 1
1: 0
2: 0
3: 32
4: 244
1084978393_1084978403 21 Left 1084978393 11:72815520-72815542 CCCGACCCAGGGAGCTGTGAGTC 0: 1
1: 0
2: 3
3: 72
4: 909
Right 1084978403 11:72815564-72815586 AGGGCTGAAATCAGACTGAAGGG 0: 1
1: 0
2: 2
3: 27
4: 293
1084978393_1084978399 -2 Left 1084978393 11:72815520-72815542 CCCGACCCAGGGAGCTGTGAGTC 0: 1
1: 0
2: 3
3: 72
4: 909
Right 1084978399 11:72815541-72815563 TCTGAGGGACTAGAGAGATCTGG 0: 1
1: 0
2: 3
3: 8
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084978393 Original CRISPR GACTCACAGCTCCCTGGGTC GGG (reversed) Intronic
900252593 1:1678828-1678850 GTCTCCTAGCTCCCTGGCTCAGG - Intronic
900620707 1:3586468-3586490 GACTCACAGACCCCTGTGCCAGG - Intronic
900631609 1:3639401-3639423 AGCTCTCAGCTCCCTGAGTCAGG - Intronic
900705829 1:4079565-4079587 GACTCACAGTTCCATGTGGCTGG + Intergenic
900773972 1:4567769-4567791 GACTCACAGTTCCATGCGGCTGG - Intergenic
900820973 1:4888350-4888372 GACTCACAGTTCCATGTGGCTGG + Intergenic
901124800 1:6921641-6921663 GACTCACAGTTCCATGTGGCTGG + Intronic
901397651 1:8993073-8993095 GACTCACAGTTCCATGTGGCTGG + Intergenic
901631337 1:10649628-10649650 GCCTCGCAGCTCCTGGGGTCGGG - Intronic
901677974 1:10897990-10898012 GATTCACAGGTCTCAGGGTCAGG - Intergenic
901816471 1:11796360-11796382 GCCTCAAAGCTCCCTGCTTCGGG + Exonic
901934269 1:12617056-12617078 GACTCTCAGCTCCCGGGCGCGGG + Intronic
902153193 1:14461486-14461508 GACTCACAGTTCCATGTGGCTGG - Intergenic
902268636 1:15287382-15287404 GACTCACAGTTCCCCAGGGCTGG + Intronic
902436375 1:16400609-16400631 GCCTCTCAGCTCCCTTGGCCTGG + Intronic
902688486 1:18094815-18094837 GACTCACAGTTCCATGTGGCTGG + Intergenic
902907926 1:19572797-19572819 GACTAACAGCTCCGTGTGGCTGG - Intergenic
903282500 1:22257887-22257909 CACTCACAGCTCCCTGGGCATGG + Intergenic
904005936 1:27363270-27363292 GAGTTACTGCTGCCTGGGTCGGG - Intronic
907688245 1:56635387-56635409 GACTCACAGTTCCATGTGACTGG - Intronic
908047190 1:60183844-60183866 GACTCACAGTTCCATGTGGCTGG + Intergenic
908047459 1:60185792-60185814 GACTCACAGTTCCATGTGGCTGG + Intergenic
908072004 1:60471300-60471322 GACTCACAGTTCCATGTGGCTGG + Intergenic
908525089 1:64980330-64980352 CACACAAAGCTCCCTGGGTTTGG + Intergenic
908882147 1:68744023-68744045 GACTCACAGTTCCATGAGGCTGG - Intergenic
909068259 1:70962505-70962527 GACTCACAGTTCCATATGTCTGG + Intronic
909313862 1:74189810-74189832 GACTCACAGTTCCATGTGGCTGG - Intronic
909313942 1:74191006-74191028 GACTCACAGTTCCATGTGGCTGG - Intronic
909376530 1:74948237-74948259 GACTCACAGTTCCATGGAGCTGG + Intergenic
909704158 1:78561594-78561616 GACTCACAGTTCCATGTGGCTGG - Intergenic
910278170 1:85470216-85470238 GACTCACAGTTCCATGTGACTGG + Intronic
911391380 1:97248442-97248464 GACTCACAGTTCCATGTGGCTGG - Intronic
911515891 1:98867500-98867522 GACTCACAGTTCCATGTGACTGG + Intergenic
911566409 1:99467556-99467578 GACTCACAGAGTCCTGAGTCTGG - Intergenic
911990380 1:104688966-104688988 GACTCACAGTTCCATGTGGCTGG + Intergenic
912024633 1:105153361-105153383 GACTCACAGCTCCATGTGGCTGG + Intergenic
912080775 1:105933025-105933047 GACTTACAGTTCCATGGGGCTGG - Intergenic
912575731 1:110671411-110671433 GAATGACAGTTCCCTGGCTCTGG + Intergenic
912858959 1:113196059-113196081 GGCTCACTGCCCCCGGGGTCTGG - Intergenic
912957515 1:114165829-114165851 GGGTCACAGCTCCATGGCTCAGG + Intergenic
913106173 1:115616090-115616112 GACTCACAGTTCCATGTGGCTGG + Intergenic
913112570 1:115669692-115669714 GACTCACAGTTCCATGTGGCTGG - Intronic
913511315 1:119565227-119565249 GACACACAGTACCCTGGGTTGGG - Intergenic
914323376 1:146586948-146586970 GACTCACAGTTCCATGTGGCTGG + Intergenic
915748199 1:158181292-158181314 AACTCGCTGCTCCCTGGCTCCGG + Intronic
915858762 1:159419502-159419524 GACTCACAGTTCCATGTGGCTGG - Intergenic
916184778 1:162120510-162120532 GACTCACAGTTCCATGTGGCTGG + Intronic
916374231 1:164134349-164134371 GACTCACAGTTCCATGTGGCTGG - Intergenic
918167727 1:181966353-181966375 GACTCACAGTTCCATATGTCTGG + Intergenic
918231417 1:182536652-182536674 GACTCACAGTTCCATGTGGCTGG + Intronic
918314538 1:183312053-183312075 GACTCACAGTTCCATGTGGCTGG - Intronic
918734340 1:188038928-188038950 GACTCACAGTTCCATGTGACTGG - Intergenic
919141929 1:193583398-193583420 GACTCACAGTTCCATGTGACTGG + Intergenic
919727896 1:200895598-200895620 GACTCATAGCCTCCTGGGTGGGG + Intronic
919737105 1:200959568-200959590 GAGACAGAGTTCCCTGGGTCGGG + Intergenic
920501691 1:206489618-206489640 AACTCCCAGCTCCCAGGCTCAGG - Intronic
921457167 1:215386045-215386067 GACTCACAGTTCCATGTGGCTGG + Intergenic
921928292 1:220731729-220731751 GACTCACAGTTCCATGTGGCTGG - Intergenic
922197406 1:223371921-223371943 GACTGACACCTCACTGGGCCGGG - Intergenic
922332073 1:224586273-224586295 GACTCACAGTTCCATGTGGCTGG + Intronic
922921466 1:229308653-229308675 GGCTAAGAGCTCCCTGGGACAGG + Intergenic
922963531 1:229668104-229668126 GACTCACAGATCCATGTGGCTGG + Intergenic
923015128 1:230120645-230120667 GACGCACAGCTCCCCAGGGCTGG + Intronic
923311847 1:232743059-232743081 GACTCACAGTTCCATGTGGCTGG - Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
923429492 1:233906112-233906134 GTCTCACAGGGCCCTCGGTCAGG + Intronic
923950386 1:238944770-238944792 GACTCACAGTTCCATGTGGCTGG - Intergenic
924198210 1:241632268-241632290 GACTCACAGTTCCATGTGGCTGG - Exonic
924564955 1:245189825-245189847 GACTCACAGTTCCATGTGGCTGG + Intronic
1063075339 10:2711056-2711078 GACTTACAGCTCCATGTGACTGG + Intergenic
1063111257 10:3039345-3039367 GACTCACAGTTCCATGTGGCTGG - Intergenic
1063410479 10:5833133-5833155 GACTCACAGCACCTTTGGCCAGG - Intronic
1063856068 10:10255540-10255562 GACTCACAGTTCCATGTGGCTGG + Intergenic
1063878069 10:10500586-10500608 GACTCACAGTTCCATGTGGCTGG - Intergenic
1063928223 10:11002097-11002119 GACTCACAGTTCCATGTGGCTGG + Intergenic
1063972631 10:11392099-11392121 GACTCACAGTTCCATGTGACTGG + Intergenic
1064098164 10:12439827-12439849 GACTCACAGTTCCATGTGGCTGG + Intronic
1064161217 10:12948259-12948281 GACTCACAGTTCCATGTGGCTGG - Intronic
1064293338 10:14054934-14054956 GACTCACAGTTCCATGTGGCTGG - Intronic
1064815289 10:19254069-19254091 GACTCACAGTTCCGTAGGGCTGG - Intronic
1065009945 10:21411965-21411987 GACTCACAGTTCCATGTGGCTGG + Intergenic
1065323740 10:24532537-24532559 GACTCACAGTTCCATGTGGCTGG + Intronic
1065436702 10:25710227-25710249 GACTCACAGTTCCATGTGGCTGG + Intergenic
1065642174 10:27794404-27794426 GACTCACAGTTCCATGGGGCTGG - Intergenic
1065678041 10:28199000-28199022 GACTCACAGTTCCATGCGGCTGG + Intronic
1066001978 10:31113146-31113168 GACTCAGAGCTGCCTGGGCTTGG - Intergenic
1066297233 10:34065604-34065626 GACTCACAGCTCCGTGTGGCTGG - Intergenic
1066426750 10:35314259-35314281 GACTCACAGTTCCATGTGGCTGG + Intronic
1066579733 10:36867102-36867124 ATCTCACAGTTCCCTGGGTCAGG - Intergenic
1067142828 10:43670671-43670693 GACTCAAAGTGCCCTGTGTCTGG - Intergenic
1067974768 10:51011884-51011906 GACTCACAGTTCCATGTGGCTGG + Intronic
1068049176 10:51927371-51927393 GACTCACAGTTCCATGTGGCTGG - Intronic
1068610382 10:59053611-59053633 GATTCACAGCTCCATGTGGCTGG + Intergenic
1068779795 10:60907134-60907156 GACTCACAGTTCCGTGTGGCTGG - Intronic
1069129969 10:64687305-64687327 GACTCACAGCTCCATATGGCTGG - Intergenic
1069488553 10:68841991-68842013 CACACACACCTCCCTGGGTGCGG - Intronic
1069613783 10:69793157-69793179 AACTCACAGCCCCCAGGTTCAGG - Intergenic
1070415117 10:76182144-76182166 GACTCACAGTTCCATGTGGCTGG + Intronic
1070524069 10:77279898-77279920 GACTCACAGTTCCATGTGGCTGG - Intronic
1070727569 10:78802785-78802807 GAATACCAGCTCCCTGGGCCAGG + Intergenic
1070755159 10:78987574-78987596 GGCTCACCTCTCTCTGGGTCAGG - Intergenic
1071032277 10:81198481-81198503 GACTCACAGCTCCATATGACTGG - Intergenic
1073128377 10:101167603-101167625 GACTCACACCTGGCTGGGTGTGG - Intergenic
1073942524 10:108714519-108714541 GACTCACAGTTCCATGTGGCTGG - Intergenic
1074025360 10:109628167-109628189 GACTCACAGTTCCATGTGGCTGG + Intergenic
1074222822 10:111455064-111455086 GACTCACAGTTCCATGTGGCTGG - Intergenic
1074578831 10:114696724-114696746 GACTCACAGTTCCATGTGACTGG - Intergenic
1074938853 10:118215272-118215294 GATTCACATCTCACTGGTTCTGG + Intergenic
1075225187 10:120622417-120622439 GACTCACAGTTCCATGTGGCTGG - Intergenic
1075377620 10:121991840-121991862 GACTCACAGTTCCGTGTGGCTGG + Intronic
1075516296 10:123111141-123111163 GACTCACAGTTCCGTGGGGCTGG - Intergenic
1075556207 10:123434436-123434458 GCCTCATAACTCCCTGGGCCAGG + Intergenic
1075835941 10:125452745-125452767 GACTCACAGTTCCATGTGGCTGG - Intergenic
1075938475 10:126365516-126365538 GACTCACAGTTCCGTGTGGCTGG + Intronic
1075958577 10:126546582-126546604 CACTGACATCTCCCTGGGTGGGG - Intronic
1075996069 10:126877210-126877232 GACTCACAGTTCCATGCGGCTGG - Intergenic
1076200327 10:128552635-128552657 GACTCACAGTTCCACGTGTCTGG - Intergenic
1076493047 10:130876785-130876807 GACTCACAGTTCCATGTGGCTGG + Intergenic
1076620167 10:131781968-131781990 AACTCACAGCTCCCAGGGCCAGG - Intergenic
1076662927 10:132067475-132067497 GACTGACAGCTCCCTTGCTGTGG - Intergenic
1077111245 11:863151-863173 GTCTCTCAGCTCCCTGGGACCGG + Intronic
1077165734 11:1137122-1137144 GACCCATAGTTGCCTGGGTCAGG + Intergenic
1077315692 11:1918467-1918489 GGCTCACAGTGCCCTGGGGCCGG - Intergenic
1077341769 11:2029400-2029422 GACCCCCAGCACCCTGGGGCTGG - Intergenic
1077631847 11:3816474-3816496 GAAGCTCAGTTCCCTGGGTCTGG + Intronic
1077827355 11:5825605-5825627 GACTCACAGCTCCACGTGGCTGG - Intronic
1078059927 11:8036704-8036726 GGGTCATAGCTCCCTGGGGCAGG - Intronic
1078301302 11:10134070-10134092 GACTCACAGTTCCATGTGGCTGG + Intronic
1079301040 11:19279020-19279042 GACTCACAGTTCCATGTGGCTGG - Intergenic
1080449870 11:32369899-32369921 GACTCACAGTTCCATGTGGCTGG + Intergenic
1080563263 11:33483822-33483844 GACTCACAGTTCCATGTGGCTGG - Intergenic
1080704564 11:34678193-34678215 GACTCACAGTTCCATGTGACCGG - Intergenic
1080740097 11:35055839-35055861 GACTCACAGCTCCGCAGGGCTGG - Intergenic
1080770809 11:35339556-35339578 GACTCACAGGACCCTCTGTCAGG + Intronic
1080786110 11:35476550-35476572 GACTCACAGCTCCGTGTGGCTGG - Intronic
1081101529 11:39007957-39007979 GACTCACAGTTCCATGTGGCTGG + Intergenic
1081223285 11:40489422-40489444 TACTCACAACTCTCTGGGTCAGG + Intronic
1081252310 11:40850751-40850773 AACTCCCATCTCCCTGGGACAGG - Intronic
1081659351 11:44878391-44878413 GGCTCCCTGCTCTCTGGGTCTGG + Intronic
1081690376 11:45073994-45074016 GCCCCAGAGCTCCCTGGGTTGGG + Intergenic
1082275016 11:50212118-50212140 GAGTCACAGTTCCATGTGTCTGG + Intergenic
1082934719 11:58644940-58644962 GACTCACAGTTCCATGTGGCTGG + Intronic
1083421604 11:62556416-62556438 GACTCAGGCCTCCCTGGGGCAGG + Intergenic
1083506355 11:63161067-63161089 GACTCACAGCTCCATGTGGCTGG + Intronic
1083746730 11:64741276-64741298 GGCTCACCCCTTCCTGGGTCTGG - Intronic
1084361768 11:68673346-68673368 GACTCACAGTTCCATGTGGCTGG + Intergenic
1084916268 11:72431325-72431347 GACTGAGAGTTCCCTGAGTCAGG - Intronic
1084954868 11:72685806-72685828 GGCTCCCAGCTCCCAGGGCCAGG + Intronic
1084954879 11:72685836-72685858 GACTCCCAGCTTCCAGGGCCAGG + Intronic
1084978393 11:72815520-72815542 GACTCACAGCTCCCTGGGTCGGG - Intronic
1085247282 11:75113128-75113150 GACTCACAGTTCCCTGTGGCTGG + Intronic
1086047394 11:82548920-82548942 GACTTACAGCTCCATGTGGCTGG + Intergenic
1086194099 11:84116427-84116449 GACTCACAGTTCCCTATGGCTGG + Intronic
1086287860 11:85270366-85270388 GACTCACAGTTCCATGTGGCTGG - Intronic
1086511560 11:87563578-87563600 GACTCACAGTTCCATGTGTCTGG - Intergenic
1086764459 11:90676854-90676876 GACTCACAGTTCCATGTGGCTGG - Intergenic
1086885984 11:92205993-92206015 GACTCACAGTTCCATGTGGCTGG - Intergenic
1086933677 11:92721748-92721770 GACTCACAGTTCCATGTGGCAGG + Intronic
1087236891 11:95729735-95729757 GACTCACAGCTCCATCTGGCTGG - Intergenic
1088111682 11:106268350-106268372 GACTCACAGTTCCATGTGTCTGG - Intergenic
1088582281 11:111327892-111327914 GACTGACGGCACCCTGGGACAGG - Intergenic
1088589908 11:111394528-111394550 GACTCACAGTTCCATGTGGCTGG - Intronic
1088591130 11:111404225-111404247 GACTCACAGTTCCATGTGGCTGG - Intronic
1088706194 11:112466659-112466681 GACTCACAGTTCCATGGGGCTGG + Intergenic
1089044272 11:115485698-115485720 GACTCACAGTTCCATGTGACTGG - Intronic
1089347524 11:117799972-117799994 GATTCCCAGCTCCTTGGCTCTGG - Intronic
1090422773 11:126587032-126587054 GACTCCCAGCTCCCTGAGGCAGG - Intronic
1090512940 11:127394773-127394795 GACTCACAGTTCCATGTGGCTGG - Intergenic
1202824755 11_KI270721v1_random:84589-84611 GACCCCCAGCACCCTGGGGCTGG - Intergenic
1091858578 12:3758640-3758662 GACTCACAGTTCCATGTGGCTGG + Intronic
1092497765 12:9013555-9013577 GACTCACAGTTCCATGTGGCCGG + Intergenic
1093793094 12:23278090-23278112 GACTCACAGTTCCATGTGGCTGG - Intergenic
1094132202 12:27086208-27086230 GACTCACAGTTCCATGTGGCTGG + Intergenic
1094181672 12:27598233-27598255 GACTCACAGTTCCATGTGGCTGG + Intronic
1094230653 12:28099238-28099260 GACTCACAGTTCCATGTGGCTGG + Intergenic
1094556070 12:31501357-31501379 GACTCACAGTTCCATAGGGCTGG - Intronic
1095122473 12:38436298-38436320 GACTCACAGCTCCATGTGGCTGG + Intergenic
1095921897 12:47540224-47540246 GTCTCACAGCCCCCTTGGGCAGG - Intergenic
1096182327 12:49557696-49557718 GACTCAGAGCCCCCTGCCTCAGG + Exonic
1097231820 12:57517042-57517064 CAGTCAGAGCTCCCTGGCTCAGG - Exonic
1097403736 12:59162429-59162451 GACTCATAGCTCCATGTGGCTGG - Intergenic
1097735956 12:63180618-63180640 GACTCACAGTTCCATGTGGCTGG - Intergenic
1098069087 12:66652417-66652439 GACTCACAGTTCCGTGTGGCTGG - Intronic
1099421653 12:82469346-82469368 GACTCACAGTTCCTTAGGGCTGG + Intronic
1099865134 12:88270317-88270339 GACTCACAGTTCCATGTGGCTGG - Intergenic
1100047126 12:90396108-90396130 GACTCACAGTTCCACGTGTCTGG - Intergenic
1100280329 12:93112436-93112458 GACTCACAGTTCCATGTGGCTGG + Intergenic
1100327596 12:93553942-93553964 GACTCACAGCTCCACGTGCCTGG + Intergenic
1100339438 12:93664309-93664331 GACTCACAGTTCCATGTGGCTGG + Intergenic
1100449624 12:94693105-94693127 GACTCACAGTTCCATGTGGCTGG - Intergenic
1100549552 12:95634666-95634688 GACTCACAGTTCCATGTGGCTGG + Intergenic
1100714841 12:97294758-97294780 GACTCACAGCTCCACGTGGCTGG - Intergenic
1100870787 12:98907947-98907969 GACTCACAGTTCCATGTGGCTGG - Intronic
1101281461 12:103261398-103261420 AACTTTCACCTCCCTGGGTCAGG - Intronic
1101337308 12:103807900-103807922 GACTCACAGTTCCATGTGTCTGG - Intronic
1101500378 12:105298701-105298723 GACTCACAGTTCCATGTGGCTGG - Intronic
1101642356 12:106596373-106596395 GACTCACAGTTCCATGTGGCTGG - Intronic
1102596964 12:114000335-114000357 GACTCACAGTTCCACGTGTCTGG + Intergenic
1103025977 12:117574430-117574452 GACTCACAGTTCCATGTGGCTGG + Intronic
1103040871 12:117694433-117694455 GACTCACAGTTCCATGTGGCTGG - Intronic
1103069541 12:117929471-117929493 GACTCACAGTTCCATGTGGCTGG - Intronic
1103218345 12:119221570-119221592 GACTCACAGTTCCATGTGGCTGG + Intergenic
1103260335 12:119582689-119582711 GACTCACAGTTCCATGTGGCTGG - Intergenic
1103276394 12:119715195-119715217 GACTCACAGTTCCATGTGGCTGG - Intronic
1103604084 12:122074151-122074173 GACTCACAGTTCCATGTGGCTGG + Intergenic
1103910943 12:124351892-124351914 GACTCAGAGCTCACTGGTCCAGG - Intronic
1103979882 12:124729989-124730011 GACTCACAGTTCCATGAGGCTGG + Intergenic
1104113475 12:125726039-125726061 GACTCACAGTTCCATGTGGCTGG + Intergenic
1104114506 12:125736388-125736410 GACTCACAGTTCCATGTGACTGG + Intergenic
1104223303 12:126807100-126807122 GACTCACAGTTCCATGCGGCTGG + Intergenic
1104228769 12:126863223-126863245 GATTCACAGTTCCATGTGTCTGG + Intergenic
1104289286 12:127454243-127454265 AGCTCCCAGCTCCCTGGGGCTGG - Intergenic
1104353554 12:128065879-128065901 GACTCACAGTTCCATGTGGCTGG - Intergenic
1104386004 12:128352202-128352224 GACTCACAGTTCCACGGGGCTGG + Intronic
1104452942 12:128886157-128886179 GACTCACAGTTCCATGTGGCTGG - Intronic
1104458887 12:128937860-128937882 GACTCACAGCTCCAAAGGGCTGG - Intronic
1104584824 12:130039556-130039578 GACTCACAGTTCCCCAGGGCTGG + Intergenic
1104882329 12:132081197-132081219 GATTGAAAGCTCCCAGGGTCTGG + Intergenic
1105034878 12:132911651-132911673 GACTCACAGTTCCATGTGGCTGG + Intronic
1105650391 13:22371285-22371307 GGCTCACAGCTCCATGTGGCTGG + Intergenic
1106361854 13:29038664-29038686 AACTCCCATCTCCCTGGGACAGG - Intronic
1106382401 13:29252877-29252899 GACTCACAGTTCCATGTGGCTGG - Intronic
1106619056 13:31356337-31356359 GACTCACAGTTCCAAGGGGCTGG - Intergenic
1107101490 13:36598165-36598187 GACTCACAGTTCCATGCGGCTGG + Intergenic
1107342449 13:39422835-39422857 AACTCACAGTTCCATGGGACTGG + Intronic
1107423666 13:40272594-40272616 GACTCACAGCTCGGTGGGGGAGG - Intergenic
1107543539 13:41415938-41415960 GACTCACAGTTCCATGTGGCTGG + Intergenic
1107619508 13:42211729-42211751 GACTCACAGCTCCACATGTCTGG + Intronic
1108167777 13:47710717-47710739 GACTCACAGTTCCATGTGGCTGG - Intergenic
1108252446 13:48580834-48580856 GACTCACAGTTCCATGTGGCTGG + Intergenic
1108937830 13:55906895-55906917 GACTTACAGTTCCATGTGTCTGG - Intergenic
1109034789 13:57242289-57242311 GACTCACAGTTCCATGTGGCTGG - Intergenic
1109216876 13:59599128-59599150 GACTCATAGCTCCATGTGGCTGG + Intergenic
1109313059 13:60717922-60717944 TGCTCACAGCTCCCTGTGGCTGG - Intergenic
1109324770 13:60853802-60853824 GACTCACAGTTCCATGTGGCTGG + Intergenic
1109390069 13:61681782-61681804 GACTCACAGTTCCATGTGGCTGG - Intergenic
1109435266 13:62291221-62291243 GACTTACAGCTCCATGTGGCTGG - Intergenic
1109655893 13:65389126-65389148 GACTCATAGTTCCATGTGTCTGG - Intergenic
1110057050 13:70986460-70986482 GACTCACAGTTCCATGTGGCTGG + Intergenic
1110124999 13:71931678-71931700 GACTCACAGTTCCCCAGGGCTGG - Intergenic
1110328271 13:74242317-74242339 GACTCACAGTTCCATGGGCTGGG + Intergenic
1110341225 13:74392937-74392959 GACTCACAGCTCCGCGTGGCTGG + Intergenic
1110420787 13:75305212-75305234 GACTCACAGTTCCACGTGTCTGG - Intronic
1110962813 13:81651471-81651493 GACTCACAGTTCCATGTGGCTGG + Intergenic
1111074404 13:83214755-83214777 GACTCACAGTTCCATGTGGCTGG + Intergenic
1111220488 13:85198589-85198611 GACTCACAGTTCCATGTGGCTGG - Intergenic
1111459591 13:88521223-88521245 GACTCACAGTTCCATGTGGCTGG - Intergenic
1111475695 13:88743844-88743866 GACTCACAGTTCCATGTGACTGG - Intergenic
1111685966 13:91501016-91501038 GACTCACAGTTCCATGTGGCTGG - Intronic
1111780417 13:92716535-92716557 GACTGCCAGCTCCCTGGGTAAGG + Intronic
1111949065 13:94695505-94695527 GACTCACAGTTCCGTGTGGCTGG - Intergenic
1111990181 13:95108603-95108625 GACTCACAGTTCCATGTGGCTGG - Intronic
1112052410 13:95656074-95656096 GACTCACAGTTCCATGTGGCTGG + Intergenic
1112105686 13:96236937-96236959 GACTCACAGTTCCATGTGGCTGG + Intronic
1112268970 13:97950950-97950972 GACTCACAGTTCCATGTGGCTGG - Intergenic
1112388802 13:98964119-98964141 GACTGCCAGCTCCCTGGGGCAGG - Intronic
1112574404 13:100622644-100622666 GACTCACAGTTCCATGTGGCTGG - Intronic
1112660165 13:101498848-101498870 GACTCACAGTTCCATGTGGCTGG + Intronic
1112847269 13:103659367-103659389 GACTCACAGTTCCATGTGGCTGG + Intergenic
1113441897 13:110335519-110335541 GACTCACAGTTCCATGTGGCTGG - Intronic
1113465208 13:110507847-110507869 GACACACAGCCTCCTGGGCCTGG + Intronic
1113521206 13:110942525-110942547 GACTCACAGCTCCATGTGGCTGG - Intergenic
1115143253 14:30198070-30198092 GACTCACAGTTCCATGTGGCTGG - Intergenic
1115157626 14:30358611-30358633 ATCTCACAGTTCCGTGGGTCAGG - Intergenic
1116414610 14:44665532-44665554 GACTCACAGCTCCGCGAGGCTGG + Intergenic
1116815154 14:49576888-49576910 GACTCACAGTTCCATGTGGCTGG - Exonic
1116854070 14:49936581-49936603 GACTCACAGTTCCATGTGGCTGG - Intergenic
1117288865 14:54313042-54313064 GACTCAGAGCTCCATGTGGCTGG - Intergenic
1117546598 14:56798420-56798442 GGCCCACAGCGCCCTGGGACCGG + Intergenic
1118001542 14:61527791-61527813 GACTCAGAGAACCCTGGGTATGG - Intronic
1118402614 14:65393838-65393860 GACTCACAGTTCCATGTGGCTGG + Intergenic
1118402987 14:65396373-65396395 GACTCACAGGTCCATGTGGCTGG + Intergenic
1119880823 14:78098171-78098193 GACTCACAGTTCCATGTGGCTGG + Intergenic
1120442445 14:84557959-84557981 GACTCACAGTTCCATGTGGCTGG + Intergenic
1120503348 14:85324026-85324048 GACTCACAGTTCCATGTGGCTGG + Intergenic
1120574921 14:86169881-86169903 GACTCACAGTTCCATGTGGCTGG - Intergenic
1120761149 14:88286620-88286642 GACTCACAGTTCCATGTGGCTGG + Intronic
1120951746 14:90047891-90047913 GACTCACAGTTCCATGTGGCTGG - Intergenic
1121486869 14:94323078-94323100 GACTCACAGACTCCGGGGTCTGG + Intronic
1121574278 14:94970517-94970539 GACTCACAGTTCCATGTGTCTGG + Intergenic
1121950986 14:98171116-98171138 GGCACACAGCCCCCTGTGTCTGG - Intergenic
1122054333 14:99082491-99082513 GACTCACAGTTCCATGTGGCTGG + Intergenic
1122384598 14:101335307-101335329 GAAACACAGCTCCCTGAGTCAGG - Intergenic
1122440776 14:101730472-101730494 GACTCACAGTTCCACGGGCCTGG - Exonic
1122566759 14:102663899-102663921 GACTCACAGGTGCCTTGGACTGG - Intronic
1122623636 14:103073482-103073504 GACACCCAGCTCACTGGGTCGGG + Intergenic
1123475160 15:20585935-20585957 GACTCACAGTTCCATGAGGCTGG + Intergenic
1123497435 15:20842338-20842360 GATTCGCAGTTCCCTGTGTCTGG - Intronic
1123554670 15:21415980-21416002 GATTCGCAGTTCCCTGTGTCTGG - Intronic
1123590915 15:21853294-21853316 GATTCGCAGTTCCCTGTGTCGGG - Intergenic
1123642851 15:22414429-22414451 GACTCACAGTTCCATGAGGCTGG - Intergenic
1124046063 15:26150803-26150825 GACTCACAGTTCCATGTGGCTGG - Intergenic
1124124797 15:26929544-26929566 GCCCCACAGCTCTCTGGGACTGG + Intronic
1125510098 15:40288203-40288225 ACCTCACAGCTCCCTGGGGACGG - Exonic
1125518740 15:40336882-40336904 GACTGACAGCTTCCTGAGGCTGG - Intronic
1125524422 15:40366013-40366035 CAGTCTCAGCTCCCTGGGCCAGG - Intronic
1126366981 15:47904303-47904325 GACTCACAGTTCCATGTGGCTGG + Intergenic
1126383668 15:48072889-48072911 GACTCACAGTTCCATGTGGCTGG + Intergenic
1126825764 15:52546314-52546336 GGCTCACAGCCTCCTGGGTGTGG - Intergenic
1126933224 15:53677694-53677716 GACTCACAGTTCCACGTGTCTGG - Intronic
1127397248 15:58552562-58552584 CACTCCAGGCTCCCTGGGTCGGG + Intronic
1128264593 15:66254978-66255000 GACACACAGCTCCCAGTCTCAGG - Intergenic
1128541200 15:68534802-68534824 GACTCACAGTTCCATGTGGCTGG + Intergenic
1128718477 15:69927905-69927927 GACTCACAGTTCCATGTGGCTGG + Intergenic
1129219411 15:74122822-74122844 GACTCAAAGCTCCTGGGGTTGGG - Intronic
1129909557 15:79214820-79214842 GGGTCCCAGTTCCCTGGGTCTGG + Intergenic
1130075375 15:80684343-80684365 GACTCACAGTTCCATGTGGCTGG - Intronic
1130995534 15:88901769-88901791 GATCCACAGCTCCCAGGGGCAGG + Intronic
1131560665 15:93436761-93436783 GACTCACAGTTCCATGTGGCTGG + Intergenic
1131573273 15:93560843-93560865 GACTCACAGTTCCATGTGGCTGG - Intergenic
1202963013 15_KI270727v1_random:143174-143196 GATTCGCAGTTCCCTGTGTCTGG - Intergenic
1132461393 16:56895-56917 GACTCACAAGTCCCCGGGGCAGG - Intronic
1132618446 16:853374-853396 GCCTCACAGCGTCCTGGGTGGGG + Intergenic
1132650983 16:1021340-1021362 AACTCCCAGCTCCCGGGCTCAGG - Intergenic
1132989686 16:2786420-2786442 ATCTCACTGCTCCCTGGGCCGGG - Intronic
1133006049 16:2882543-2882565 GCCCCACAGCTCCCTGTGCCCGG + Intergenic
1133412620 16:5580793-5580815 GCCCTACAGCTTCCTGGGTCTGG - Intergenic
1133470643 16:6072052-6072074 GACTCACAGCTCCACAGGGCTGG + Intronic
1133532268 16:6666128-6666150 GACTCACAGTTCCATGTGGCTGG - Intronic
1133533313 16:6675623-6675645 GACTCACAGTTCCATGTGACTGG + Intronic
1134191027 16:12121355-12121377 GACTCTCGGCTCCCAGGCTCTGG - Intronic
1134246830 16:12546338-12546360 GACTCACAGTTCCATGTGGCTGG + Intronic
1134387832 16:13790683-13790705 GACTCACAGTTCCATGAGGCTGG + Intergenic
1134820366 16:17241916-17241938 GACTCACAGTTCCATGTGGCGGG + Intronic
1135435197 16:22422154-22422176 GACTCACAGTTCCATGTGGCTGG + Intronic
1135495334 16:22946803-22946825 GACTCACAGCTCCACGTGGCTGG + Intergenic
1135828619 16:25753421-25753443 GCCTCACAGCTCCCTGGTGCTGG + Intronic
1136287085 16:29250732-29250754 GACTCACAGTTCCATGTGTCTGG - Intergenic
1137399767 16:48143788-48143810 GACTCACAGTTCCATGTGACTGG - Intronic
1137490040 16:48924749-48924771 GACTCAGGACTTCCTGGGTCTGG - Intergenic
1137988811 16:53131535-53131557 GGCCCACAGCCCCCGGGGTCGGG + Intronic
1138519704 16:57563921-57563943 GAGCCGCAGCTCCCTGGGGCGGG - Exonic
1138584697 16:57962328-57962350 GACTGAGAGGTCCCTGGGTGGGG - Intronic
1138806412 16:60094661-60094683 GACTCACAGTTCCCCAGGTCTGG - Intergenic
1139162461 16:64527705-64527727 GACTCACAGTTCCATGTGGCTGG - Intergenic
1139922598 16:70469333-70469355 GCCTCTCAGCTCCCTGGGGTGGG + Intronic
1140010186 16:71123902-71123924 GACTCACAGTTCCATGTGGCTGG - Intronic
1140706135 16:77632098-77632120 GACTCACAGTTCCATGTGGCTGG - Intergenic
1140741073 16:77942147-77942169 GACTCACAGTTCCATGTGGCTGG + Intronic
1141067875 16:80928516-80928538 GACTCACAGTTCCATGTGGCTGG + Intergenic
1141312796 16:82931634-82931656 GACTCACAGTTCCATGTGGCTGG + Intronic
1141529991 16:84639552-84639574 GACTCACACTTCCCTGTGGCTGG - Intergenic
1141950964 16:87339060-87339082 GACTCACAGTTCCATGTGGCTGG - Intronic
1142092689 16:88223364-88223386 GACTCACAGTTCCATGTGTCTGG - Intergenic
1142283284 16:89160474-89160496 AACTCACAGGTCCCAGGGTGAGG - Intergenic
1142363275 16:89637158-89637180 CCCTCACAGCCCCCAGGGTCGGG - Intronic
1142483523 17:232710-232732 GACTCAGATCTCCCTGGTGCAGG - Intronic
1142697321 17:1640610-1640632 GACTCACAGCTGCCTGTGTCTGG + Exonic
1142715746 17:1745929-1745951 GCCTCCCAGCTCTCTTGGTCTGG - Intronic
1142994032 17:3750582-3750604 GACTCGGGGCTCCCTGGGGCTGG - Intronic
1143303113 17:5925490-5925512 GACTCACATCTCCCAGTATCAGG - Intronic
1143779460 17:9221754-9221776 GACTGTCTGCTCCATGGGTCTGG - Intronic
1143865022 17:9917276-9917298 GACCCACAGCTCCCTGTCTTTGG + Exonic
1144202691 17:12955656-12955678 GGCTCAGATCTCACTGGGTCAGG - Intronic
1144639037 17:16927518-16927540 GTCCCACAGCAGCCTGGGTCTGG - Intergenic
1144847485 17:18227468-18227490 GCCTCACAACTCCCTGGCTCAGG + Intronic
1145727382 17:27143507-27143529 GACTCACAGGTCCATGTGGCTGG - Intergenic
1145823470 17:27858501-27858523 GACTCACAGTTCCTTGTGGCTGG - Intronic
1146098246 17:29953589-29953611 GACTCACAGTTCCATGTGGCTGG - Intronic
1146913607 17:36664095-36664117 GGCTGGAAGCTCCCTGGGTCAGG + Intergenic
1148127630 17:45245115-45245137 GACACACAGATCCTTGGGTGTGG + Intronic
1148331132 17:46814653-46814675 GAATTACAGCTCGCTGGGGCTGG - Intronic
1149052560 17:52324667-52324689 GACTCACAGTTCCATGTGGCTGG + Intergenic
1149128155 17:53260563-53260585 GACTCACAGTTCCCTATGGCTGG - Intergenic
1149159118 17:53668707-53668729 GACTCACAGTTCTGTGTGTCTGG - Intergenic
1149371095 17:55994041-55994063 GACTCACAGTTCCATGTGGCTGG + Intergenic
1149637937 17:58185257-58185279 GACTGAGAGCTTCCTTGGTCAGG + Intergenic
1149662785 17:58344182-58344204 GGTTCACAGCTCCCTGGGAGTGG - Intergenic
1150470378 17:65432112-65432134 GACTCACAGTTCCATGTGGCTGG - Intergenic
1150532240 17:65995964-65995986 GACTCACAGTTCCATGTGGCTGG - Intronic
1150578895 17:66454552-66454574 GACTCACAGTTCCATGTGTCTGG + Intronic
1150580191 17:66466357-66466379 AACGCAGGGCTCCCTGGGTCTGG - Intronic
1150597834 17:66622693-66622715 GACTCACAGTTCCATGTGGCTGG + Intronic
1150671017 17:67197310-67197332 GACTCACAGTTCCATGTGGCTGG - Intronic
1150828844 17:68500447-68500469 GACTCACAGTTCCATGTGGCTGG - Intergenic
1150882429 17:69045650-69045672 GACTCACAGTTCCCTATGACTGG + Intronic
1151083937 17:71359855-71359877 GACTCACAGTTCCATGTGGCTGG + Intergenic
1151118242 17:71763340-71763362 GACTCACAGTTCCATGTGGCTGG + Intergenic
1151152240 17:72098137-72098159 GACTCACAGTTCCATGTGACTGG + Intergenic
1151212241 17:72553238-72553260 GACTCACAGTTCCACGCGTCTGG - Intergenic
1151218761 17:72595844-72595866 GACTCACAGTTCCATGTGGCTGG + Intergenic
1151341343 17:73472957-73472979 GACTCACAGTTCCATGTGGCTGG - Intronic
1151400710 17:73854122-73854144 GACTCACAGTTCCATGTGGCTGG - Intergenic
1152063902 17:78099408-78099430 GACTTACAGTTCCATGTGTCTGG + Intronic
1152152962 17:78614381-78614403 GACTCACAGTTCCATGTGGCTGG - Intergenic
1152419766 17:80186129-80186151 CATTCACAGCTCCCAGGGTAGGG - Intronic
1152915803 17:83034814-83034836 GACTCACAGTTCCATGTGTCCGG - Intronic
1153047629 18:871165-871187 GACTCACAGTTCCATGTGGCTGG - Intergenic
1153252460 18:3136185-3136207 GACTCACAGTTCCATGTGGCTGG - Intronic
1153323814 18:3798032-3798054 GACTCACAGTTCCATGTGGCTGG - Intronic
1154082568 18:11272866-11272888 GACTCACAGTTCCATGTGGCTGG - Intergenic
1154455457 18:14518756-14518778 GATTCGCAGTTCCCTGTGTCTGG - Intronic
1155192124 18:23439245-23439267 GACTCACAGTTCCACGGGGCTGG - Intergenic
1155357708 18:24969386-24969408 GACTCACAGTTCCATGTGGCTGG - Intergenic
1155394104 18:25368061-25368083 GACTCCCAGATCCCTGGCTTGGG + Intergenic
1155621241 18:27783091-27783113 GACTCACAGTTCCATGTGGCTGG - Intergenic
1156006917 18:32453064-32453086 GACTCACAGCTCCACGTGGCTGG + Intronic
1156908990 18:42388590-42388612 GACTCACAGTTCCATGTGGCTGG + Intergenic
1157046753 18:44109483-44109505 GACTCACAGTTCCATGTGGCTGG + Intergenic
1157110628 18:44816866-44816888 GACACACAGTATCCTGGGTCAGG - Intronic
1157215837 18:45782821-45782843 GACACACAGTTCCCTGGCACCGG - Intergenic
1157226894 18:45874480-45874502 GACTCACAGTTCCATGTGGCTGG + Intronic
1157408970 18:47447704-47447726 GACTCACAGTTCCATGTGGCTGG - Intergenic
1157426059 18:47585148-47585170 CACCCACAGCACCCTGGGTCTGG + Intergenic
1157626792 18:49057458-49057480 GACTCCCAGCTCCCTTGCCCTGG - Intronic
1157856046 18:51106696-51106718 GGCTCACTGTTCCATGGGTCAGG + Intergenic
1158589264 18:58765997-58766019 GACACACAGCACCCTGTGCCTGG + Intergenic
1159131282 18:64282384-64282406 GACTCACAGTTCCATGTGGCTGG - Intergenic
1159149128 18:64497601-64497623 GACTCACAGTTCCATGTGGCTGG + Intergenic
1159282773 18:66309475-66309497 GACTCACAGTTCCATGTGGCTGG + Intergenic
1159585654 18:70281357-70281379 GACTCACAGTTCCATAGGGCTGG - Intergenic
1159751203 18:72304275-72304297 GACTCACAGTTCCACGTGTCTGG + Intergenic
1160363734 18:78306666-78306688 CACTCACAGCTTCCTGGGATTGG + Intergenic
1164086871 19:21911016-21911038 GACTCACATCACCTTGGTTCTGG - Intergenic
1164892871 19:31839914-31839936 GACTCACAGTTCCATGGGGCTGG + Intergenic
1164902063 19:31936586-31936608 GACTCACAGTTCCATGTGGCTGG - Intergenic
1165143175 19:33714853-33714875 GACTCACAGTTCCATGTGGCTGG - Intronic
1165371586 19:35410687-35410709 GACTCACAGTTCCACGGGGCTGG + Intergenic
1165421469 19:35724083-35724105 GACTGACAGAGCCCTGGGTCTGG - Intronic
1165558058 19:36653517-36653539 GACTCACAGTTCCATGTGGCTGG + Intronic
1166746180 19:45142906-45142928 CACTCACTGCTCCCGCGGTCTGG - Intronic
1166914132 19:46183060-46183082 GACTCACAGTTCCATGTGGCTGG + Intergenic
1166971664 19:46572822-46572844 GAATCTCAGCTCTCTGGCTCAGG + Intronic
1167199057 19:48051385-48051407 GACTCACAGTTCCATGTGGCTGG + Intronic
1167802763 19:51755813-51755835 GACTCACAGTTCCATGTGGCTGG - Intronic
1168132250 19:54328986-54329008 GACTCACAGTTCCATGTGGCTGG - Intergenic
1168134556 19:54341779-54341801 GACTCACAGTTCCATATGTCTGG + Intergenic
1168311812 19:55464492-55464514 GGCACACAGCTCCCGGGGGCCGG + Intergenic
1168702275 19:58447992-58448014 GACTCACAGTTCCATGTGGCTGG - Intergenic
925447919 2:3943380-3943402 TATTCTAAGCTCCCTGGGTCAGG + Intergenic
925724593 2:6860611-6860633 GACTTACAGTTCCATGGGGCTGG - Intronic
925867142 2:8238276-8238298 GACTGAAAGATCCCTGGGTGGGG + Intergenic
926080048 2:9977908-9977930 GACTCACAGTTCCATGTGGCTGG + Intronic
926380205 2:12279367-12279389 GACTCACAGTTCCATGTGGCTGG - Intergenic
926938817 2:18114229-18114251 GACTCACAGTTCCATGTGGCTGG - Intronic
927007430 2:18865238-18865260 GACTTACAGCTCCATGTGGCTGG - Intergenic
927063481 2:19446185-19446207 GACTCACAGCTCCATGTGGCTGG - Intergenic
928190767 2:29165067-29165089 AACTTACAGCTCGCAGGGTCTGG - Intronic
928415763 2:31090300-31090322 CACTCAGAGCTCCCTGGGACTGG + Intronic
928484629 2:31717797-31717819 CACTCACTGCGTCCTGGGTCGGG - Intergenic
929218893 2:39443123-39443145 GACTCACAGTTCCCTATGGCTGG - Intergenic
929996197 2:46827728-46827750 GTTTCACAGCCACCTGGGTCAGG + Intronic
930227949 2:48813294-48813316 GACTCACAGTTCCATGTGGCTGG + Intergenic
930321300 2:49857731-49857753 GGCTTTCAGCTCTCTGGGTCTGG - Intergenic
930558336 2:52928857-52928879 GACTTACAGCTCCATGTGGCTGG + Intergenic
930925382 2:56811460-56811482 GACTCACAGTTCCATGTGGCTGG - Intergenic
930997191 2:57734562-57734584 GACTCACAGTTCCATGGGCTGGG + Intergenic
931033354 2:58210234-58210256 GACTCACAGTTCCATGTGGCTGG + Intronic
931154265 2:59609205-59609227 GACTCACAGTTCCCTATGGCTGG - Intergenic
931265736 2:60658473-60658495 GACTCACAGCTCCACGTGGCTGG - Intergenic
933792622 2:85895166-85895188 GACTCACAGTTCCATGTGGCGGG - Intergenic
935240263 2:101171641-101171663 GACTCACAGTTCCATGTGGCTGG - Intronic
935516003 2:104039684-104039706 GAATTACATCTCCCTGTGTCCGG - Intergenic
937345021 2:121120101-121120123 GACTCACAGTTCCATGTGGCTGG + Intergenic
937962500 2:127471377-127471399 GACTGTGAGCTCCCTGGGGCAGG - Intronic
938165254 2:129020391-129020413 GACTCACAGTTCCATGTGGCTGG - Intergenic
938336817 2:130508591-130508613 GCCTCACAGCACCCTGGTTGTGG - Intronic
938768689 2:134481535-134481557 GACTCACAGTTCCATGTGGCTGG - Intronic
938982044 2:136536307-136536329 GACTCACAGTTCCCTATGGCAGG + Intergenic
939382963 2:141459766-141459788 GACTCACAGTTCCATGTGGCGGG - Intronic
939757856 2:146136640-146136662 GACTCACAGCTCCATGTGGCTGG + Intergenic
940780203 2:157925206-157925228 TACTCCCACCTCCCTGGTTCAGG - Intronic
941073741 2:160984225-160984247 GACTCACAGTTCCTTGTGGCTGG - Intergenic
941128610 2:161618141-161618163 GACTATCAGATCCCTGGGGCAGG + Intronic
942118012 2:172748356-172748378 GACTCATAGTTCCATGTGTCTGG + Intronic
942351398 2:175057069-175057091 CACTCACAGCTAGCTGGGTGTGG - Intergenic
943246090 2:185452293-185452315 GACTCACAGTTCCATGTGGCTGG + Intergenic
943488682 2:188521462-188521484 GACTCACAGTTCCACGGGGCTGG + Intronic
943907402 2:193517238-193517260 GACTCACAGTTCCATGTGGCTGG + Intergenic
945618577 2:212105976-212105998 GACTCACAGTTCCATGTGGCTGG - Intronic
946021964 2:216646611-216646633 GACTCACAGTTCCATGTGGCTGG + Intronic
946060873 2:216940426-216940448 GACTCACAGTTCTGTGGGGCTGG - Intergenic
946113680 2:217443485-217443507 GACTCACAGTTCCCCGTGGCTGG + Intronic
946159910 2:217829803-217829825 GACTTCCTGCTCTCTGGGTCTGG - Intronic
946436534 2:219660051-219660073 GACTCACAGTTCCGTGTGGCTGG + Intergenic
946555203 2:220848909-220848931 GACTCACAGTTCCATGTGGCTGG + Intergenic
946765006 2:223032471-223032493 GACTCACAGCTCCATATGACTGG - Intergenic
946807064 2:223481446-223481468 GACTCACAGTTCCATGTGGCTGG - Intergenic
946980289 2:225205784-225205806 GACTCACAGTTCCATGTGGCTGG - Intergenic
947003483 2:225485289-225485311 GACTCACAGTTCCATGTGGCTGG - Intronic
947273199 2:228362546-228362568 GACTCACAGTTCCATGTGGCTGG + Intergenic
947338429 2:229111139-229111161 GACTCACAGTTCCATGTGGCTGG - Intronic
947597726 2:231424406-231424428 GGCTCACTGCTCCCAGGTTCAGG - Intergenic
948657448 2:239485437-239485459 GACTCACAGTTCCATGTGGCTGG + Intergenic
948726261 2:239935840-239935862 GACTCACAGTTCCATGTGGCTGG - Intronic
948783253 2:240337690-240337712 GACTCACAGTTCCATGTGGCTGG + Intergenic
948870489 2:240795517-240795539 AACTGGCAGCTCTCTGGGTCTGG + Intronic
948947012 2:241225771-241225793 GGCTCACAGCGCCCTGGGGCTGG + Intergenic
1170538394 20:17364434-17364456 GACTCACAGTTCCATGTGGCTGG + Intronic
1170559236 20:17541812-17541834 CACTCACAGCTCTGTGGCTCTGG - Intronic
1170665441 20:18382435-18382457 GATTTACAGATCCCTGAGTCTGG + Intergenic
1170800121 20:19583752-19583774 GACTCTTAGCTCCATGGGACAGG + Intronic
1170874487 20:20237369-20237391 GGCTCAGAGCTCCCTGGTCCTGG - Intronic
1170876296 20:20253449-20253471 GACTCACAGAGCTCAGGGTCAGG - Intronic
1171118562 20:22548522-22548544 GACTTACAGTTCCATGTGTCTGG + Intergenic
1172111305 20:32546822-32546844 GACTTTCAACTCCTTGGGTCAGG + Intronic
1173038921 20:39441878-39441900 GACTCACAGGTCCATGTGGCTGG + Intergenic
1173529466 20:43757884-43757906 GACTCACAGTTCCATGTGGCTGG + Intergenic
1173917513 20:46719424-46719446 AACTCACAGTTCCATGTGTCTGG + Intronic
1173942945 20:46927482-46927504 GACTCACAGTTCCATGTGACTGG + Intronic
1174293319 20:49524646-49524668 GACTCACAGTTCCATGTGGCTGG + Intronic
1174635638 20:51997297-51997319 GACTCACAGTTCCATGTGGCTGG + Intergenic
1174896442 20:54454309-54454331 GGCTCACAGCTCCATGTGGCTGG - Intergenic
1175190887 20:57211493-57211515 TACCCACAGCTTCCTGGGTCAGG - Intronic
1175661490 20:60816826-60816848 GGCTCCCTGCTCCCTGGGCCTGG - Intergenic
1175661905 20:60820703-60820725 GACTCACAGTTCCATGTGGCTGG - Intergenic
1175926521 20:62474167-62474189 GCCTCACAGCCCCCTGGGGCCGG + Intronic
1176362511 21:6009848-6009870 GACTCACAGTTCACTGTGGCTGG + Intergenic
1176988499 21:15465341-15465363 GACTCACAGTTCCCTGTGGCTGG - Intergenic
1177026179 21:15924620-15924642 GACTCACAGTTCCATGTGGCTGG + Intergenic
1177480857 21:21686242-21686264 GACTCACAGTTCCATGTGGCTGG + Intergenic
1177507179 21:22034337-22034359 GACTCACAGTTCCATGTGGCTGG + Intergenic
1177659162 21:24060512-24060534 GACTCACAGCTCCCCACGGCTGG + Intergenic
1177742310 21:25168811-25168833 GACTTACAGCTCCATGTGGCTGG - Intergenic
1177786177 21:25674053-25674075 GACTCACAGTTCCATGTGGCTGG - Intronic
1178111442 21:29373969-29373991 GACTCACAGTTCCATGAGGCTGG + Intronic
1178201015 21:30405373-30405395 GACTCACAGTTCCATGTGGCTGG - Intronic
1178346012 21:31828600-31828622 GACTCACAGTTCCATGTGACTGG - Intergenic
1179043513 21:37825726-37825748 GACTCACAGTTCCATGTGGCTGG + Intronic
1179146278 21:38770763-38770785 AAGTCACAGCCCCATGGGTCAGG - Intergenic
1179166818 21:38941731-38941753 GACTCACAGTTCCATGAGGCTGG - Intergenic
1179258488 21:39738178-39738200 GACTCACAGTTCCAGGGGGCTGG + Intergenic
1179259711 21:39747145-39747167 AACTCACAGCTCCATGTGGCTGG + Intronic
1179291275 21:40020270-40020292 GACTCACAGTTCCATGTGGCTGG - Intronic
1179478553 21:41663404-41663426 GACTCACAGTTCCATGTGGCTGG - Intergenic
1179528093 21:41996974-41996996 GACTCACAGGTCCATGTGACTGG - Intronic
1179560999 21:42216173-42216195 GACTCACAGTTCCATGTGGCTGG - Intronic
1179641808 21:42752635-42752657 GCTTCACGGCTCCCTGGGACAGG - Intronic
1179761007 21:43528697-43528719 GACTCACAGTTCACTGTGGCTGG - Intergenic
1180160202 21:45995795-45995817 GACTCACAGTTGCCTGGCTGAGG + Intronic
1181738955 22:24904672-24904694 GCCTTACAGCTCCCTTTGTCAGG - Intronic
1182055948 22:27354781-27354803 GACTCACAGTTCCACGTGTCTGG + Intergenic
1182082966 22:27542356-27542378 GACTCACCCCAGCCTGGGTCAGG + Intergenic
1182536398 22:31006910-31006932 GACTCACAGTTCCATGTGGCTGG + Intergenic
1182763182 22:32739340-32739362 GACTCACAGTTCCATGTGGCTGG - Intronic
1183177222 22:36232980-36233002 GACCCCCAGACCCCTGGGTCGGG + Intronic
1183180607 22:36257557-36257579 GACCCCCAGACCCCTGGGTCGGG - Intronic
1183483577 22:38077730-38077752 GACTCACAGTTCCCAGGGTCAGG - Intergenic
1183614671 22:38936599-38936621 GACTCACTGCTGCAGGGGTCGGG + Intergenic
1184940880 22:47763991-47764013 GACTTGCCGCTCCCTGGGTTGGG + Intergenic
949274249 3:2259525-2259547 GACTCACAGTTCCACGTGTCTGG + Intronic
949412970 3:3785830-3785852 GACTCACAGTTCCATGTGGCTGG - Intronic
949503074 3:4700787-4700809 GACTCACAGTTCCATGTGGCTGG + Intronic
949607831 3:5673984-5674006 GACTCACAGTTCCGTGTGACTGG + Intergenic
949662021 3:6290950-6290972 GACTCACAGTTCCATGTGGCTGG + Intergenic
949759970 3:7459491-7459513 GACTCACAGTTCCATGAGGCTGG + Intronic
949994963 3:9609298-9609320 GACTCACAGTTCCATGTGGCTGG + Intergenic
950128038 3:10522729-10522751 GCCTCACAGCAGCCTGGGGCAGG + Intronic
950371044 3:12530970-12530992 GACTCACAGTTCCATGTGGCTGG + Intronic
950635081 3:14308544-14308566 GTTGCAGAGCTCCCTGGGTCAGG - Intergenic
950832109 3:15885241-15885263 GACTCACAGTTCCATGTGGCTGG + Intergenic
951286551 3:20820779-20820801 GACTGACACCTCACAGGGTCGGG - Intergenic
951306558 3:21070409-21070431 GACTCACAGTTCCATGTGGCTGG + Intergenic
951693102 3:25417614-25417636 GACTCACAGTTCCATGAGGCTGG - Intronic
952457414 3:33486675-33486697 GACTCACAGTTCCATGTGGCTGG + Intergenic
952535934 3:34309214-34309236 GACTCACAGTTCCATGTGGCTGG + Intergenic
952569764 3:34700803-34700825 GACTCACAGTTCCATGTGGCTGG + Intergenic
952606034 3:35147390-35147412 GACTCACAGTTCCATGTGGCTGG + Intergenic
952831539 3:37569118-37569140 GACTCACAGTTCCATGTGGCTGG + Intronic
952954318 3:38547762-38547784 GAATGGCAGCTCCCTGGGGCTGG + Intergenic
953176005 3:40552573-40552595 TATTCACAGGTCCCTGGGTTGGG + Intronic
954785180 3:53087403-53087425 CACTCACAGCTCCCACCGTCCGG + Intronic
955163958 3:56492206-56492228 GACTCACAGTTCCATGTGGCTGG - Intergenic
955247380 3:57238996-57239018 GACTCACAGTTCCATGTGGCTGG + Intronic
955407178 3:58632921-58632943 GACTCACAGCTCCCAAGTCCTGG - Intergenic
955409128 3:58644496-58644518 GACTCACAGTTCCATGTGGCAGG - Intronic
956115716 3:65916405-65916427 GACTCACAGTTCCATGTGGCTGG + Intronic
956368573 3:68533221-68533243 GACTCACAGTTCCATGTGGCTGG + Intronic
956383027 3:68686076-68686098 AACTCCCATCTCCCTGGGACAGG - Intergenic
956583172 3:70836307-70836329 GACTCACAGTTCCATGTGGCTGG - Intergenic
957462049 3:80534067-80534089 GACTCACAGTTCCCTATGGCTGG - Intergenic
957767704 3:84647857-84647879 GACTCACAGTTCCATGTGGCTGG - Intergenic
957873250 3:86113711-86113733 GACTCACAGTTCCATGTGGCTGG - Intergenic
957949407 3:87106249-87106271 GACTCACAGTTCCATGTGGCTGG - Intergenic
957950099 3:87113651-87113673 GACTCACAGTTCCATGTGGCTGG + Intergenic
958611739 3:96435744-96435766 GACTTACAGTTCCATGTGTCTGG + Intergenic
958660705 3:97062788-97062810 GACTCACAGTTCCATGTGGCTGG - Intronic
958806324 3:98815233-98815255 GTCTCACAGCTCCGTAGATCTGG + Intronic
958823086 3:98998596-98998618 GACTCACAGTTCCATGTGGCTGG - Intergenic
959268844 3:104178567-104178589 GACTCACAGTTCCTTGTGGCTGG + Intergenic
960172097 3:114473948-114473970 GACTCACAGTTCCATGTGGCTGG + Intronic
960376054 3:116902944-116902966 TGCTCACAGCCCCCAGGGTCTGG - Intronic
960636428 3:119789350-119789372 GACTCACAGTTCCATGTGGCTGG + Intronic
961937980 3:130605771-130605793 GACTCACAGTTCCATGTGGCTGG + Intronic
963280121 3:143376139-143376161 TACTCACAGCTTACTGGGTTTGG + Intronic
963914950 3:150850515-150850537 GACTCACAGTTCCGCGGGGCTGG - Intergenic
964588223 3:158330913-158330935 GACTCACAGCTCCATGTGGCTGG + Intronic
964631961 3:158820613-158820635 GACTCACAGTTCCATAGGGCTGG + Intronic
965028600 3:163334706-163334728 GACTCACAGCTCCATGTAGCTGG + Intergenic
966270255 3:178096397-178096419 GACTCACAGCTCCATGTGGCTGG - Intergenic
967412355 3:189179961-189179983 GACTTACAGTTCCATGTGTCTGG + Intronic
967457103 3:189701128-189701150 GACTCACAGCTCCATGTGGCTGG - Intronic
968387391 4:154185-154207 GACTCACAGTTCCATGTGGCTGG - Intronic
968546851 4:1203273-1203295 GACTCCCAGCTGCCCGGGGCTGG - Intronic
968654041 4:1771045-1771067 GCCTCTCAGGTCCCAGGGTCAGG - Intergenic
968980519 4:3846636-3846658 GACTCACAGTTCCATGTGGCTGG - Intergenic
969125560 4:4945404-4945426 GACTCACAGTTCCATGTGGCTGG + Intergenic
969190159 4:5512085-5512107 GACTCACAGCTCCATATGGCTGG + Intergenic
969198749 4:5584873-5584895 TACTCACTGCTCTCTGGGTTTGG - Intronic
969366251 4:6696106-6696128 GACACACAGCTCTCTGGCCCAGG + Intronic
969463050 4:7338925-7338947 GACCAACAGCTCCCTGGTGCGGG - Intronic
969505411 4:7583720-7583742 GACTCACAGTTCCATGTGGCTGG - Intronic
969533498 4:7741944-7741966 GAACCTCATCTCCCTGGGTCGGG + Exonic
969697581 4:8743733-8743755 GACTCACAGTTCCATGTGGCTGG - Intergenic
969969494 4:11031279-11031301 GACTCACAGTTCCACTGGTCGGG + Intergenic
970091277 4:12410859-12410881 GACTCACAGTTCCATGTGGCTGG - Intergenic
970107153 4:12597204-12597226 GACTCACAGTTCCATGTGGCTGG - Intergenic
970135377 4:12916235-12916257 GACTCACAGTTCCATGTGGCTGG - Intergenic
970919273 4:21374262-21374284 GACTCACAGTTCCATGTGGCTGG + Intronic
971042625 4:22771154-22771176 GACTCACAGTTCCATGTGGCTGG - Intergenic
971134667 4:23855185-23855207 GACTCACAGCTCCATATGGCTGG - Intronic
971155366 4:24075782-24075804 GACTCACAGTTCCATGTGGCTGG - Intergenic
971430029 4:26556143-26556165 AACTCCCATCTCCCTGGGACTGG - Intergenic
971696185 4:29907001-29907023 GACTCACAGTTCAGTGGGGCAGG + Intergenic
971843737 4:31891836-31891858 GACTCACAGTTCCATGTGGCTGG - Intergenic
971948586 4:33314449-33314471 GACTCACAGTTCCATGTGGCTGG - Intergenic
971976262 4:33692144-33692166 GACTCACAGTTCCATGTGTCTGG + Intergenic
972113363 4:35594710-35594732 GACTCACAGTTCCATGTGGCTGG + Intergenic
972142392 4:35976895-35976917 GACTCACAGGTCCACAGGTCTGG - Intronic
972167481 4:36305305-36305327 GACTCACAGTTCCATGTGGCTGG + Intronic
972175695 4:36402711-36402733 GACTCACAGTTCCACGTGTCTGG - Intergenic
972646135 4:40969067-40969089 GACTCACAGTTCCATGTGGCTGG - Intronic
972677882 4:41277753-41277775 GACTCACAGTTCCATGTGGCTGG + Intergenic
973319056 4:48791300-48791322 GACTCACAGTTCCATGTGGCTGG - Intergenic
973598196 4:52513830-52513852 GACTCACAGTTCCATGTGGCTGG - Intergenic
973747180 4:53975240-53975262 GACTCACAGTTCCCCAGGGCTGG - Intronic
974062422 4:57047345-57047367 GACTCACAGCTCCATGAGGCTGG - Intronic
974087390 4:57276112-57276134 GACTCACAGTTCCATGTGGCTGG + Intergenic
974158606 4:58106617-58106639 GACTCACAGTTCCACGTGTCTGG - Intergenic
974184031 4:58422720-58422742 GACTAACAGTTCCCTGTGGCTGG + Intergenic
974857952 4:67483133-67483155 GACTCACAGTTCTGTGGGGCTGG - Intronic
974897495 4:67957086-67957108 GACTCACAGTTCCATGTGGCTGG - Intronic
975279099 4:72539865-72539887 GACTCACAGTTCCATGTGGCTGG - Intronic
975834509 4:78408034-78408056 GACTCACAGTTCCATGTGGCTGG + Intronic
975917836 4:79346326-79346348 GACTCACAGTTCCACGTGTCTGG - Intergenic
975952165 4:79787422-79787444 GACACAAATCTCTCTGGGTCTGG + Intergenic
976050891 4:81010255-81010277 GACTCACAGTTCCATAGGGCTGG - Intergenic
976319875 4:83702005-83702027 GACTCACAGTTCCCCGTGGCTGG + Intergenic
976441614 4:85082250-85082272 GACTCACAGTTCCATGTGGCTGG - Intergenic
977039278 4:91994842-91994864 GACTCACAGCTCCACGTGGCTGG + Intergenic
977673076 4:99718086-99718108 GACTCACAGTTCCATGTGGCTGG + Intergenic
977870879 4:102089193-102089215 GACTCACAGTTCCATGTGGCTGG - Intergenic
979093748 4:116518992-116519014 GACTCACAGTTCCATGAGGCTGG + Intergenic
979177026 4:117678344-117678366 GACTCACAGTTCCATGTGTCTGG - Intergenic
979182745 4:117752279-117752301 CACTCACAGCTCCATGTGTCTGG - Intergenic
979183004 4:117754210-117754232 GACTCACAGTTCCATGTGTCTGG - Intergenic
979923372 4:126528247-126528269 GACTCACAGTTCCATGTGGCTGG + Intergenic
981696497 4:147564226-147564248 GAGTCACAGCTCCATGGAACTGG - Intergenic
981829853 4:148986837-148986859 GACTCACAGTTCCATAGGGCTGG - Intergenic
982002735 4:151036037-151036059 GACTCACAGGCCCCTGGATGCGG - Intergenic
982332527 4:154196982-154197004 GACTCACAGTTCCATGTGGCTGG - Intergenic
982797261 4:159661339-159661361 GACTCACAGGTCCATGTGTCTGG + Intergenic
983164450 4:164458561-164458583 GACTCACAGTTCCATGTGGCTGG - Intergenic
983164718 4:164460769-164460791 GACTCACAGTTCCATGTGGCTGG - Intergenic
983525731 4:168758829-168758851 GACTCACAGATCCATGGGCTGGG + Intronic
983931697 4:173460243-173460265 GACTCACTGCTGCCTGGGGTGGG - Intergenic
984090051 4:175361807-175361829 GACTCACAGTTCCCCATGTCTGG - Intergenic
984565795 4:181328646-181328668 GACTCACAGCTCCACAGGGCTGG - Intergenic
985576801 5:677390-677412 CAGTCACAGCTCCCTGACTCCGG + Intronic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
986008283 5:3686431-3686453 GACTCACAGTTCCATGTGGCAGG + Intergenic
986240079 5:5952771-5952793 GACTCACAGCTCCACGTGGCTGG - Intergenic
986314779 5:6579363-6579385 GACTCACAGTTCCATGTGGCTGG + Intergenic
986504559 5:8435617-8435639 GACTCACAGATCCATGTGGCTGG + Intergenic
986764141 5:10908396-10908418 GACTCACAGTTCCGTGTGGCTGG - Intergenic
986800348 5:11253572-11253594 GACTCACAGTTCCATGTGGCTGG - Intronic
986895093 5:12356093-12356115 GACTCACAGTTCCATGTGACTGG + Intergenic
987074991 5:14372939-14372961 GACTCACAGTTCCATAGGACAGG + Intronic
987096408 5:14554553-14554575 GACTCACAGTTCCATGTGGCTGG - Intergenic
987180943 5:15367906-15367928 GACTCACAGTTCCATGTGGCTGG - Intergenic
987244071 5:16030398-16030420 GACTCACAGTTCCATGTGGCTGG + Intergenic
987252418 5:16112944-16112966 GACTCACAGTTCCATGTGGCTGG - Intronic
987422588 5:17737851-17737873 GACTCGCAGTTCCATGTGTCTGG - Intergenic
987693871 5:21302729-21302751 GACTCACAGTTCCCTATGACTGG - Intergenic
987707183 5:21472089-21472111 GACTCACAGTTCCATGTGGCTGG + Intergenic
987773466 5:22335712-22335734 GACTCACAGTTCCATGTGGCTGG - Intronic
987821070 5:22967447-22967469 GACTCACAGTTCCATGTGGCTGG - Intergenic
987822382 5:22982056-22982078 GACTCACAGTTCCATATGTCTGG - Intergenic
988070614 5:26284259-26284281 GACTCACAGTTCCATGTGCCTGG + Intergenic
988146337 5:27313572-27313594 GACTCACAGTTCCACGTGTCTGG + Intergenic
988172830 5:27681954-27681976 GACTCACAGTTCCATGTGTCTGG + Intergenic
988292574 5:29308407-29308429 GACTCACAGTTCCGTGTGGCTGG + Intergenic
989407922 5:41082442-41082464 GACTCACAGTTCCATGTGGCTGG - Intergenic
989445925 5:41528032-41528054 GACTCACAGTTCCCTATGGCTGG - Intergenic
990947803 5:61267345-61267367 GACTCACAGCTCCACGTGGCTGG - Intergenic
991038698 5:62154252-62154274 GACTCACAGTTCCATGTGGCTGG + Intergenic
991039059 5:62157812-62157834 GACTCACAGTTCCATGTGGCTGG - Intergenic
991066044 5:62426017-62426039 GACTCAGAGTCCCCTGGGTGAGG + Intronic
991194486 5:63916697-63916719 GACTCACAGTTCCATGTGGCTGG - Intergenic
991202545 5:64010822-64010844 GACTCACAGTTCCATGTGGCTGG - Intergenic
991318642 5:65342259-65342281 GACTCACAGTTCCATGTGGCTGG + Intronic
991417752 5:66409334-66409356 GACTCACAGTTCCATGTGGCTGG + Intergenic
991544766 5:67769789-67769811 GACTCACAGCTCCATATGGCTGG + Intergenic
991643197 5:68774840-68774862 GACTCACAGCTCCACGTGGCTGG - Intergenic
991746385 5:69746812-69746834 GACTCACAGTTCCCTATGACTGG + Intergenic
991751320 5:69808429-69808451 GACTCACAGTTCCCTATGACTGG - Intergenic
991797987 5:70326757-70326779 GACTCACAGTTCCCTATGACTGG + Intergenic
991825763 5:70622126-70622148 GACTCACAGTTCCCTATGACTGG + Intergenic
991830608 5:70683323-70683345 GACTCACAGTTCCCTATGACTGG - Intergenic
991890328 5:71326077-71326099 GACTCACAGTTCCCTATGACTGG + Intergenic
992424959 5:76647628-76647650 GACTCACAGTTCCATGTGGCTGG - Intronic
992874246 5:81036967-81036989 GACTCACAGTTCCATGTGTCTGG + Intronic
993314286 5:86379832-86379854 GACTCACAGCTCCATGTGGCTGG - Intergenic
993331326 5:86604254-86604276 GACTCACAGTTCCGTAGGGCTGG + Intergenic
993580361 5:89653293-89653315 GACTCACAGTTCCATGTGGCTGG + Intergenic
994215256 5:97130466-97130488 GAGTCACTGCTTCCTGTGTCCGG - Intronic
994244419 5:97463309-97463331 GACTCACAGTTCCATGTGACTGG - Intergenic
994464753 5:100112213-100112235 GACTCGCAGTTCCATGGGGCTGG + Intergenic
994870620 5:105345591-105345613 GACTCACAGTTCCACGTGTCTGG + Intergenic
995062296 5:107823823-107823845 GACTCACAGCTCCATATGGCTGG - Intergenic
995078317 5:108014805-108014827 GACTCACAGTTCCATGTGACTGG + Intronic
995212216 5:109552618-109552640 GACTCACAGTTCCATGTGGCTGG - Intergenic
995513742 5:112934145-112934167 GACTCACAGTTCTGTGGGGCTGG + Intergenic
995701251 5:114938225-114938247 GACTCACAGTTCCATATGTCTGG - Intergenic
995760976 5:115561625-115561647 GACTCACAGTTCCATGTGACTGG + Intergenic
995774734 5:115712900-115712922 GACTCACAGTTCCATGTGGCTGG + Intergenic
995909565 5:117169264-117169286 GACTCACAGTTCTATGTGTCTGG - Intergenic
995944047 5:117620709-117620731 GACTCACAGTTCCATGTGGCTGG - Intergenic
996211367 5:120815375-120815397 GACTCACAGTTCCATGTGGCTGG + Intergenic
996268330 5:121570926-121570948 GACTCACAGTTCCATGTGGCTGG + Intergenic
996396372 5:123017832-123017854 GACTCACAGTTCCATGAGGCTGG - Intronic
996809887 5:127504977-127504999 GACTCACAGTTCCGTGTGCCTGG - Intergenic
998715279 5:144876625-144876647 AACTCACAGCTCCACGTGTCTGG + Intergenic
998896960 5:146810240-146810262 GACTCACAGTTCCATGTGGCTGG + Intronic
999100302 5:149018423-149018445 GACTCACAGTTCCATGTGGCTGG + Intronic
999302122 5:150497715-150497737 GACTCACAGCTCCCAGCTGCTGG - Intronic
1003690371 6:8347441-8347463 GACTCACAGTTCCCTATGGCTGG - Intergenic
1004006569 6:11642303-11642325 GACTCACAGTTCCATGTGGCTGG - Intergenic
1004189253 6:13449782-13449804 GACTCACAGTTCCATGTGGCTGG - Intronic
1005557039 6:26997210-26997232 GACTCACAGTTCCCTATGACTGG + Intergenic
1005983969 6:30859000-30859022 GACTCACAGTTCCATGTGGCAGG + Intergenic
1006218095 6:32463029-32463051 GACTCACAGTTCCATGTGGCTGG - Intergenic
1006824280 6:36922935-36922957 GATTCACAGTTCCCTGGGTGAGG + Intronic
1007092817 6:39194596-39194618 GACTCACACCTCTCTTGGTAAGG + Exonic
1008134306 6:47756267-47756289 GACTCACAGTTCCACGTGTCTGG - Intergenic
1008242698 6:49131037-49131059 GACTCACAGTTCCATGTGGCTGG - Intergenic
1008377293 6:50806590-50806612 GACTCACAGTTCCACGTGTCTGG - Intergenic
1008785146 6:55158823-55158845 AACTCCCATCTCCCTGGGACAGG + Intronic
1008889065 6:56464368-56464390 ACCTCACAGATCCTTGGGTCTGG - Intronic
1008966987 6:57322629-57322651 GACTCACAGTTCCCCAGGGCTGG - Intronic
1009021039 6:57948409-57948431 GACTCACAGTTCCATGTGGCTGG - Intergenic
1009289348 6:61865334-61865356 GACTCACAGTTCCATGTGGCTGG + Intronic
1009474772 6:64076686-64076708 GACTCACAGTTCCACGGGGCTGG - Intronic
1009605210 6:65858263-65858285 GACTCACAGTTCCATGTGGCTGG + Intergenic
1009732059 6:67621456-67621478 GACTCACAGTTCCATGTGGCTGG - Intergenic
1009982238 6:70740825-70740847 GACTCACAGTTCCATGTGGCTGG + Intronic
1010374340 6:75149062-75149084 GACTCACAGTTCCATGTGGCTGG - Intronic
1010872453 6:81059418-81059440 GACTCACAGTTCCACGTGTCTGG - Intergenic
1010909403 6:81535624-81535646 GACTCACAGTTCCATGTGGCTGG + Intronic
1011222468 6:85069984-85070006 GACTCACAGTTCCATGTGGCTGG + Intergenic
1011372325 6:86650502-86650524 GACTCACAGTTCCATGTGGCTGG - Intergenic
1011416882 6:87131089-87131111 GCCTCACATCTCCCTGTGTAAGG - Intergenic
1011905849 6:92366460-92366482 GACTTACAGCTCCATGTGGCTGG + Intergenic
1012700636 6:102452338-102452360 GACTCACAGTTCCATGTGGCTGG + Intergenic
1012825111 6:104138268-104138290 GACTCACAGCTCCATATGGCTGG + Intergenic
1012835068 6:104254484-104254506 GACTCACAGTTCCATGTGACTGG + Intergenic
1013461241 6:110377295-110377317 AACTCACAGCTCCATGTGGCTGG - Intergenic
1013477884 6:110526149-110526171 GACTCACAGTTCCATGTGGCTGG - Intergenic
1013897436 6:115106855-115106877 GACTCACAGTTCCATGTGGCTGG + Intergenic
1014014942 6:116519179-116519201 TATACACAGCTCCCTGTGTCAGG - Exonic
1014327713 6:120019313-120019335 GACTCACAGTTCCATGTGGCTGG + Intergenic
1014714441 6:124848195-124848217 GACTCACAGTTCCATGTGGCTGG - Intergenic
1014896781 6:126910899-126910921 GACTCACAGTTCCATGGCTGGGG - Intergenic
1015219175 6:130784513-130784535 GACTCACAGTTCCTTGTGGCTGG - Intergenic
1015831648 6:137376478-137376500 GACTCACAGTTCCATGTGGCTGG - Intergenic
1016209101 6:141506367-141506389 GACTCACAGTTCCATGTGGCAGG + Intergenic
1016414462 6:143818599-143818621 GACTCACAGTTCCATGTGGCTGG + Intronic
1016439623 6:144069583-144069605 GACTCACAGCTCCACGTGGCTGG + Intergenic
1016520842 6:144944833-144944855 GACTCACAGTTCCATGTGGCTGG - Intergenic
1016620918 6:146108512-146108534 GACTTACAGTTCCCTGTGGCTGG - Intronic
1017053837 6:150419785-150419807 GACTCACAGTTCCATGTGGCTGG - Intergenic
1017225278 6:152014155-152014177 GACTCACAGTTCCTTGTGACTGG - Intronic
1017782220 6:157724375-157724397 GACTCAGGTCTCCCTGGGCCTGG - Intronic
1018346343 6:162903438-162903460 GACTCACAGTTCCATGTGGCTGG + Intronic
1019133569 6:169894580-169894602 GACCCCCAGCTCCCGGGGACAGG + Intergenic
1019820328 7:3238265-3238287 GACTCACAGTTCCATGTGGCTGG + Intergenic
1020637578 7:10715066-10715088 GACTCACATTTCCCTGTGGCTGG + Intergenic
1020928792 7:14367500-14367522 GACTCACAGTTCCATGTGGCTGG - Intronic
1020932600 7:14416700-14416722 GACTCACAGTTCCACGGGGCTGG - Intronic
1021134586 7:16949491-16949513 GACTCACAGTTCCATGTGGCTGG - Intergenic
1021269927 7:18573840-18573862 GTGTCACAGCCCCCTGGCTCAGG + Intronic
1021856344 7:24860570-24860592 GACTCACAGTTCCATGTGGCTGG - Intronic
1022081020 7:27021203-27021225 GACTCACAGTTCCATGTGGCTGG - Intergenic
1022644798 7:32220071-32220093 GACTCACAGTTCCATGTGGCTGG - Intronic
1023162291 7:37309144-37309166 GACTCACAGTTCCATGTGGCTGG + Intronic
1023243842 7:38178813-38178835 GACTCACAACCGCCTGTGTCTGG - Intronic
1023293899 7:38695069-38695091 GACTCACAGTTCCACGTGTCTGG + Intergenic
1023356677 7:39374435-39374457 TACTGACAGCTTTCTGGGTCTGG + Intronic
1023386500 7:39662932-39662954 GACTCACAGTTTCCTGTGGCTGG + Intronic
1023505559 7:40896680-40896702 AACTCACAGTTCCATGGGGCTGG - Intergenic
1023885348 7:44349930-44349952 GCCTCACAGATCCCTCTGTCTGG - Intergenic
1024021540 7:45375117-45375139 AACTCACAGCTCCATGTGACTGG + Intergenic
1024156645 7:46632389-46632411 GACTCACAGTTCCATGTGGCTGG - Intergenic
1024426272 7:49229954-49229976 GACTAACAGTTCCCTGAGTCTGG - Intergenic
1024771833 7:52732257-52732279 GACTCACAGTTCCATGTGGCTGG - Intergenic
1024779011 7:52823985-52824007 GACTCACAGTTCCTTGAGGCTGG - Intergenic
1025101296 7:56137239-56137261 CTTTCACAACTCCCTGGGTCAGG + Intergenic
1025291999 7:57736364-57736386 GACTCACAGTTCCATGTGGCTGG - Intergenic
1025784744 7:64634107-64634129 GACTCACAGCACCTTGGTTCTGG - Intergenic
1026084745 7:67253902-67253924 GACTCACAGTTCCATGTGGCTGG - Intergenic
1026180345 7:68033984-68034006 GACTCACAGTTCCATGTGGCTGG + Intergenic
1026302706 7:69111773-69111795 GACTCACAGTTCCCTATGGCTGG + Intergenic
1026320981 7:69267430-69267452 GACTCACAGTTCCATGTGGCTGG + Intergenic
1026330792 7:69350976-69350998 GACTCACAGTTCCATGGGGCTGG + Intergenic
1026537133 7:71248085-71248107 GACTCACAGCTCCGCATGTCTGG + Intronic
1026537627 7:71253228-71253250 GACTCACAGTTCCCCGTGGCTGG + Intronic
1026692427 7:72561018-72561040 GACTCACAGTTCCATGTGGCTGG + Intronic
1026949222 7:74336406-74336428 GACTCACAGTTCCATGTGGCTGG + Intronic
1026980888 7:74526079-74526101 GGCTCACACCTGCCTGGGGCGGG - Intronic
1027551866 7:79608212-79608234 GACTCTCAGATCACTGGCTCTGG + Intergenic
1027741281 7:82009247-82009269 GACTCACAGTTCCATGTGGCTGG - Intronic
1027992917 7:85385823-85385845 GACTTACAGTTCCATGTGTCTGG - Intergenic
1028066684 7:86392797-86392819 GACTCACAGTTCCATGTGGCTGG + Intergenic
1028189052 7:87824433-87824455 GACTCACAGTTCCATGTGACTGG - Intronic
1029846704 7:103419152-103419174 GACTCACAGTTCCATGTGGCTGG - Intronic
1030195724 7:106851708-106851730 GACTCACAGTTCCATGTGGCTGG + Intergenic
1030415355 7:109237269-109237291 GACTCACAGTTCCACAGGTCTGG - Intergenic
1030415641 7:109239252-109239274 GACTCACAGTTCCATGGGGCTGG - Intergenic
1030452673 7:109732083-109732105 GACTTACAGTTCCCTGTGGCTGG + Intergenic
1030608442 7:111663384-111663406 GACTCACAGTTCCATGTGGCTGG + Intergenic
1030723259 7:112894520-112894542 GACTCACAGCTCCATGTTGCTGG + Intronic
1030783690 7:113633803-113633825 GACTCACAGCTCCACATGTCTGG + Intergenic
1031106113 7:117545075-117545097 GACTCACAGTTCCATGTGACTGG + Intronic
1031222367 7:118985321-118985343 GACTCACAGTTCCATGCGGCTGG - Intergenic
1031315853 7:120256951-120256973 GAATAGCAGGTCCCTGGGTCTGG - Intergenic
1031558347 7:123206436-123206458 GACTGACACCTCCTTGGTTCTGG + Intergenic
1031559308 7:123218469-123218491 GACTCACAGTTCCATGTGGCTGG - Intergenic
1032275879 7:130454949-130454971 GACTTACAGTTCCATGTGTCTGG + Intergenic
1032659708 7:133969966-133969988 AACTCCCATCTCCCTGGGACAGG - Intronic
1033893419 7:146043099-146043121 GACTGACAGCTCACACGGTCGGG - Intergenic
1033910853 7:146261163-146261185 GACTCACAGTTCCATGTGGCTGG - Intronic
1034074298 7:148216991-148217013 GACTCACAGCTCCATATGGCTGG - Intronic
1035117605 7:156537600-156537622 GACTCACAGCTCCACGTGGCTGG - Intergenic
1035297348 7:157874593-157874615 CACAGACAGCTCCCGGGGTCCGG + Intronic
1035410309 7:158634903-158634925 GACAAAAAGCTCCCTGGGCCAGG + Intronic
1035451961 7:158983005-158983027 GACTCACAGTTCCATGTGGCTGG + Intergenic
1035548074 8:498971-498993 GACTCACAGTTCCATGTGGCTGG - Intronic
1037011349 8:13846478-13846500 GACTCACAGTTCCATGTGACTGG - Intergenic
1037244966 8:16823019-16823041 GACTCACAGTTCCATGTGGCTGG + Intergenic
1037400098 8:18486811-18486833 GACTCACAGTTCCATGTGGCTGG - Intergenic
1037733400 8:21548182-21548204 GACTCACAGTTCCACGGGGCGGG + Intergenic
1038316863 8:26491726-26491748 GACTCACAGTTCCATGTGGCTGG + Intronic
1038500816 8:28042139-28042161 GACTCACAGTTCCATGTGCCTGG - Intronic
1038549802 8:28457458-28457480 GACTCACAGTTCCATGTGGCTGG + Intronic
1039118656 8:34121276-34121298 GACTCACAGTTCCATGTGGCTGG + Intergenic
1039350286 8:36756715-36756737 GACTCACAGTTCCATGTGGCTGG - Intergenic
1040009189 8:42647223-42647245 GACTCACAGTTCCATGTGGCTGG + Intergenic
1040994298 8:53386715-53386737 TACTCACAGCTCCCTGGCCAGGG + Intergenic
1041339234 8:56823908-56823930 GACTCACAGTTCCATGTGGCTGG - Intergenic
1041631817 8:60097231-60097253 GACTCACAGTTCCATGTGGCTGG + Intergenic
1041894617 8:62908721-62908743 GACTCACAGCTCCATGGCTGAGG - Intronic
1042149868 8:65770306-65770328 GACTCACAGTTCCATGTGGCTGG + Intronic
1042438047 8:68791170-68791192 GACTCACAGTTCCCCATGTCTGG + Intronic
1042489919 8:69385397-69385419 GACTCACAGTTCCATGGGGCTGG - Intergenic
1043517745 8:81011466-81011488 GACTCACAGTTCCATGTGGCTGG - Intronic
1043760102 8:84057621-84057643 GACTCACAGTTCCATGTGGCTGG - Intergenic
1044055831 8:87568862-87568884 GACTCACAGTTCCCTAGGCCTGG - Intronic
1044070610 8:87755645-87755667 GACTCACAGTTCCATGTGGCTGG + Intergenic
1044541509 8:93413590-93413612 GACTCACAGTTCCATGTGGCTGG + Intergenic
1044744079 8:95355345-95355367 GACTCACAGTTCCATGTGGCTGG - Intergenic
1044760554 8:95513529-95513551 GACTCACAGTTCCATGTGGCTGG + Intergenic
1044935724 8:97292080-97292102 GACTCACAGTTCCATGTGGCTGG + Intergenic
1045207582 8:100057694-100057716 GACTCACAGATCCATGTGACTGG - Intronic
1045325289 8:101113118-101113140 CACTCACTGCCCCCTGAGTCAGG - Intergenic
1045548541 8:103150033-103150055 GACTCACAGTTCCATGTGGCTGG + Intronic
1045838414 8:106550752-106550774 GACTCACAGTTCCATGTGGCAGG - Intronic
1045871412 8:106931861-106931883 GACTCACAGTTCCATGTGGCTGG + Intergenic
1046145099 8:110148206-110148228 GACTCACAGTTCCATGTGGCTGG + Intergenic
1046401880 8:113715149-113715171 GACTCACAGTTCCATGTGGCTGG + Intergenic
1046689191 8:117263582-117263604 GACTTACAGTTCCATGTGTCTGG - Intergenic
1046788889 8:118299217-118299239 GACTCTGAGCTCCCAGGCTCTGG - Intronic
1047186440 8:122637348-122637370 GACCCAGAGCTCTCTGGGGCTGG - Intergenic
1047304690 8:123643238-123643260 GACTCACAGTTCCATGTGGCTGG + Intergenic
1047318582 8:123757006-123757028 GACTCACAGTTCCATGTGGCTGG + Intergenic
1047504517 8:125468630-125468652 TTTTAACAGCTCCCTGGGTCGGG + Intergenic
1047889899 8:129296285-129296307 GACTCACAGTTCACAGGGTTGGG + Intergenic
1047924380 8:129668702-129668724 GACTCACAGTTCCATGTGGCTGG - Intergenic
1047969495 8:130072492-130072514 GACTCACAGTTCCATGTGGCAGG - Intronic
1048122060 8:131592618-131592640 GACTTACAGTTCCATGGGGCTGG - Intergenic
1048265599 8:132982859-132982881 GACTCTCTGCTCTCTGGGACGGG + Intronic
1048266143 8:132988977-132988999 GACTCACAGCTCCATGTGGCTGG + Intronic
1048375403 8:133818537-133818559 GACTCACAGTTCCGTGTGGCTGG - Intergenic
1048387593 8:133927043-133927065 GACTCACAGTTCCGTGTGGCTGG - Intergenic
1048597573 8:135882455-135882477 GACTCACAGTTCCATGTGGCTGG + Intergenic
1048864439 8:138749173-138749195 GACTCACAGTTCCATGGGGCTGG - Intronic
1049828420 8:144685146-144685168 CACTCACACCTCCCTCGGGCAGG + Intergenic
1049828427 8:144685173-144685195 CACTCACACCCCCCTGGGGCCGG + Intergenic
1050214252 9:3304745-3304767 GACTCACAGTTCCATGTGTCTGG - Intronic
1050968332 9:11837132-11837154 GACTCACAGTTCCATGTGGCTGG + Intergenic
1051333575 9:16046788-16046810 GACTCACAGCTCCACGTGGCTGG - Intronic
1051532891 9:18125138-18125160 GACTCACAGTTCCATGTGGCTGG + Intergenic
1051863354 9:21651475-21651497 AACTCCCATCTCCCTGGGACAGG - Intergenic
1052217916 9:25989395-25989417 GACTCACAGCTCCACGTGGCTGG + Intergenic
1052427641 9:28325699-28325721 GACTCACAGTTCCATGTGGCTGG - Intronic
1053574393 9:39344184-39344206 GACTCACAGTTCCATGAGGCTGG - Intergenic
1053619988 9:39805095-39805117 GACTCACAGTTCCATGTGGCTGG - Intergenic
1053626707 9:39878847-39878869 GACTCACAGTTCCATGTGGCTGG + Intergenic
1053838960 9:42172432-42172454 GACTCACAGTTCCATGAGGCTGG - Intergenic
1053878165 9:42564397-42564419 GACTCACAGTTCCATGTGGCTGG - Intergenic
1053879353 9:42576340-42576362 GACTCACAGTTCCATGAGGCTGG + Intergenic
1053893305 9:42718018-42718040 GACTCACAGTTCCATGAGGCTGG - Intergenic
1053894494 9:42729969-42729991 GACTCACAGTTCCATGTGGCTGG + Intergenic
1054095959 9:60902874-60902896 GACTCACAGTTCCATGAGGCTGG - Intergenic
1054117420 9:61178813-61178835 GACTCACAGCTCCATGAGGCTGG - Intergenic
1054217180 9:62371856-62371878 GACTCACAGTTCCATGTGGCTGG - Intergenic
1054232336 9:62525357-62525379 GACTCACAGTTCCATGAGGCTGG - Intergenic
1054264168 9:62902349-62902371 GACTCACAGTTCCATGTGGCTGG + Intergenic
1054590335 9:67003753-67003775 GACTCACAGCTCCATGAGGCTGG + Intergenic
1054717460 9:68570629-68570651 GACTCACAGTTCCATGTGGCTGG + Intergenic
1055168761 9:73228597-73228619 GACTCACAGTTCCATGTGGCTGG - Intergenic
1055264278 9:74476916-74476938 GACTTACAGCTCCATGTGACTGG - Intergenic
1055361750 9:75498515-75498537 GACTCACAGTTCCCTGTGAGTGG + Intergenic
1055553314 9:77450980-77451002 GACTCACAGTTCCATGTGGCTGG - Intronic
1055554629 9:77462228-77462250 GAGTCACAGCTGCCCGAGTCTGG - Intronic
1055627936 9:78193876-78193898 GACTCACAGCTCTATGCGGCTGG + Intergenic
1055713438 9:79089981-79090003 GACTCACAGTTCCATGTGGCTGG + Intergenic
1056046248 9:82720160-82720182 GACTCACAGTTCCATGTGCCTGG + Intergenic
1056367058 9:85916051-85916073 GACTCACAGTTCCATGTGGCTGG - Intergenic
1056765589 9:89442826-89442848 GACTCACATCTGCCCGGGTCTGG - Intronic
1057142492 9:92735777-92735799 GGCACACAGCACACTGGGTCTGG + Intronic
1057202154 9:93146936-93146958 GACTCACAGTTCCATGTGGCTGG - Intergenic
1057544646 9:96008581-96008603 GCCTCACTGCTCCCTGGTGCAGG - Intronic
1057643936 9:96855036-96855058 GGCTCACAGGTCAATGGGTCGGG - Intronic
1059082446 9:111265023-111265045 GACTCACAGTTCCATGTGGCTGG + Intergenic
1059460239 9:114424934-114424956 TCCTCACAGCTCCCTGAGTGAGG - Intronic
1059516716 9:114902727-114902749 GAATCTCAGTTCCCAGGGTCTGG + Intronic
1059968197 9:119637108-119637130 GACTCACAGTTCCATGTGGCTGG - Intergenic
1060254077 9:122011221-122011243 GACTCATAGTTCCATGTGTCTGG - Intronic
1060268343 9:122125236-122125258 GAGTCCCAGTTCTCTGGGTCTGG + Intergenic
1060711500 9:125869972-125869994 GACTCACAGTTCCACGTGTCTGG + Intronic
1060889248 9:127177721-127177743 CACTCACTGGTCCCTGGGGCAGG + Intronic
1061734434 9:132643718-132643740 GGAACACAGCTCCCTGGGTTCGG - Intronic
1062733792 9:138123318-138123340 GACTGCCTGCTCCCTGTGTCTGG - Exonic
1203528647 Un_GL000213v1:114944-114966 GATTCGCAGTTCCCTGTGTCTGG - Intergenic
1185604694 X:1361364-1361386 GACTCACAGTTCCATGTGGCTGG + Intronic
1185737762 X:2506012-2506034 GACTCACAGCTCCATGTGACTGG - Intergenic
1185828443 X:3275455-3275477 GACTCACAGTTCCATGTGGCTGG - Intronic
1185846454 X:3442001-3442023 GACTCAAAGCTCCATGTGGCTGG + Intergenic
1185977156 X:4734150-4734172 GACTCACAGTTCCATGTGTCTGG + Intergenic
1186019450 X:5237675-5237697 GACTCACAGTTCCATGTGGCTGG + Intergenic
1186069909 X:5808429-5808451 GACTCACAGCTCCCCATGGCTGG + Intergenic
1186146421 X:6628983-6629005 GACTCACAGCTCCACGTGGCTGG + Intergenic
1186285988 X:8044852-8044874 GACTCACAGTTCCATGTGGCTGG + Intergenic
1186468213 X:9801056-9801078 GACTCACAGTTCCATGTGGCTGG + Intronic
1186473539 X:9839349-9839371 CACCCACATCTCCCTGGGTCTGG + Intronic
1186855451 X:13621704-13621726 CACTCACAGCTCTCTGTGTGAGG - Intronic
1186861016 X:13672599-13672621 GATTCACAGTTACCTGGGGCTGG + Intronic
1187680751 X:21765558-21765580 GACTCACAGTTCCATGTGGCTGG + Intergenic
1187714744 X:22091796-22091818 GACTCACAGTTCCATGTGGCTGG + Intronic
1188171401 X:26932218-26932240 GACTCACAGCTCCATGTGGCTGG + Intergenic
1188533022 X:31163395-31163417 GACTCACAGTTCCGTGTGGCTGG - Intronic
1188761778 X:34041356-34041378 GACTCACAGCTCCACAGGACTGG - Intergenic
1188941099 X:36238350-36238372 GACACACAGCTCCATGTGGCTGG - Intronic
1189366115 X:40390022-40390044 TTCTCACAATTCCCTGGGTCAGG - Intergenic
1189382346 X:40511000-40511022 AACTCACAGTTCCATGGGGCTGG - Intergenic
1189403368 X:40693511-40693533 GACTCACAGTTCCATGTGACTGG - Intronic
1189679217 X:43497586-43497608 GACTCACAGTTCCATATGTCTGG - Intergenic
1190167709 X:48086792-48086814 GACTCACAGCTCCATGTGGCTGG - Intergenic
1190497607 X:51041656-51041678 GACTCACAGTTCCCTGTGTCTGG + Intergenic
1190691686 X:52918017-52918039 GACTCCAAGCTCCATGGCTCAGG + Intergenic
1190694297 X:52937775-52937797 GACTCCAAGCTCCATGGCTCAGG - Intronic
1192008665 X:67243549-67243571 GACTCACAGTTCCATGTGGCTGG - Intergenic
1192360427 X:70435374-70435396 GACTCACAGCTCCTGGCATCCGG + Intergenic
1193274677 X:79571209-79571231 TACTCACCACTTCCTGGGTCAGG + Intergenic
1193765368 X:85522106-85522128 GACTCACAGCTCCTCGTGGCTGG - Intergenic
1194257080 X:91647149-91647171 GACTCACAGTTCCATGTGGCTGG - Intergenic
1194523114 X:94942824-94942846 GACGCTAAGCTCCCTGGGTGGGG + Intergenic
1194559585 X:95403918-95403940 AACTCCCATCTCCCTGGGACAGG + Intergenic
1194850819 X:98866337-98866359 GACTCACAGTTCCGTGTGGCTGG + Intergenic
1195063367 X:101217722-101217744 GACTCTGAGGTCCCTGGTTCTGG + Intergenic
1195403199 X:104484010-104484032 GACTCACAGTTCCATGTGGCAGG - Intergenic
1195770090 X:108341577-108341599 GACTCATAGTTCCATGGGGCTGG - Intronic
1196161008 X:112482222-112482244 GACTCACAGTTCCGTAGGACTGG - Intergenic
1196169942 X:112575830-112575852 GACTTACAGCTCCATGTGGCTGG - Intergenic
1196635019 X:117992335-117992357 GACTCTCTGCTCCCAGGCTCTGG + Intronic
1197341190 X:125267519-125267541 GACTCACAGCTCCACGTGGCTGG - Intergenic
1198793529 X:140371509-140371531 GACTTACAGCTCCATGTGGCTGG - Intergenic
1198810836 X:140534695-140534717 CTCTCACTGCACCCTGGGTCTGG - Intergenic
1199282276 X:146016044-146016066 GACTCACAGTTCCATGTGGCTGG + Intergenic
1199476618 X:148253669-148253691 GACTCACAGTTCCACGTGTCTGG - Intergenic
1199869931 X:151889129-151889151 GACTCACAGTTCCATGTGGCTGG - Intergenic
1199929617 X:152505529-152505551 GACTCACAGTTCCATGTGGCTGG + Intergenic
1200342258 X:155409801-155409823 GACTCACAGTTCCATGTGGCTGG - Intergenic
1200575790 Y:4886415-4886437 GACTCACAGTTCCATGTGGCTGG - Intergenic
1201015719 Y:9599466-9599488 GACTCACAGTTCTATGGGGCTGG - Intergenic