ID: 1084981217

View in Genome Browser
Species Human (GRCh38)
Location 11:72829801-72829823
Sequence CAGCAGGAAGAAAGGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1653
Summary {0: 1, 1: 2, 2: 22, 3: 244, 4: 1384}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084981212_1084981217 16 Left 1084981212 11:72829762-72829784 CCTGCAGAGACAGGTGCTGCTCA 0: 1
1: 0
2: 1
3: 18
4: 254
Right 1084981217 11:72829801-72829823 CAGCAGGAAGAAAGGCCCTGAGG 0: 1
1: 2
2: 22
3: 244
4: 1384
1084981210_1084981217 27 Left 1084981210 11:72829751-72829773 CCGAGTCTCTGCCTGCAGAGACA 0: 1
1: 0
2: 2
3: 46
4: 434
Right 1084981217 11:72829801-72829823 CAGCAGGAAGAAAGGCCCTGAGG 0: 1
1: 2
2: 22
3: 244
4: 1384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084981217 Original CRISPR CAGCAGGAAGAAAGGCCCTG AGG Intronic
900294773 1:1943388-1943410 CAGCAGGAGGACAGGCGCCGCGG + Intronic
900631932 1:3641155-3641177 CAGCAGGAAGAAAGGACCAGAGG + Intronic
900867775 1:5280700-5280722 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
900939156 1:5786740-5786762 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
900984002 1:6062741-6062763 CAGCAGGAATAGAAGCCCAGAGG + Intronic
901252939 1:7795569-7795591 CAGCAGGCGCAGAGGCCCTGGGG + Intronic
901432369 1:9224867-9224889 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
901531822 1:9858495-9858517 CGGCAGGTGCAAAGGCCCTGGGG - Intronic
901661374 1:10799875-10799897 CAGCAGGTGCAGAGGCCCTGAGG - Intergenic
901741543 1:11345240-11345262 CAGCAAGAACAAAGGCCTAGAGG + Intergenic
901781057 1:11594845-11594867 CAGCATGTGCAAAGGCCCTGGGG - Intergenic
901823378 1:11844749-11844771 CAGCAGAAATAAAGGCACAGTGG + Intergenic
901857781 1:12055336-12055358 CAGCGAGCACAAAGGCCCTGGGG + Intergenic
902041669 1:13496983-13497005 TAGCAGGTGCAAAGGCCCTGAGG + Intronic
902129271 1:14244701-14244723 CAGCAAGTACAAAGGCCCTGAGG + Intergenic
902130060 1:14252491-14252513 CAACATGAGGAAAGGTCCTGGGG - Intergenic
902195592 1:14795793-14795815 CAGCATGTGCAAAGGCCCTGAGG - Intronic
902255740 1:15187512-15187534 GAGCAGGCAGACAGCCCCTGGGG - Intronic
902362550 1:15950109-15950131 AATCAGGAGGTAAGGCCCTGGGG + Intronic
902391641 1:16110595-16110617 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
902592375 1:17484281-17484303 CAGCAGGTGCAAAGGCTCTGGGG + Intergenic
902606145 1:17570430-17570452 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
902619419 1:17642302-17642324 TAGCAAGTACAAAGGCCCTGAGG + Intronic
902667012 1:17946613-17946635 CAGCAAGTGCAAAGGCCCTGGGG + Intergenic
902707943 1:18219322-18219344 CAGCAAGGGCAAAGGCCCTGAGG + Intronic
902785839 1:18732034-18732056 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
902810563 1:18885662-18885684 CTGCAGCGGGAAAGGCCCTGGGG + Intronic
902927282 1:19704483-19704505 CAGCAGAGAGAAAGGCCCCAGGG - Intronic
902933006 1:19744670-19744692 CAGCAGGTGCAAAGGCCCAGCGG - Intronic
903008663 1:20315214-20315236 CAGCAGGGACAAAGGCCCTGGGG + Intronic
903018539 1:20377675-20377697 CAGCACGTACAAAGGCCCTGAGG + Intergenic
903024145 1:20415203-20415225 AAGCAGGTACAAAGGCCCTGGGG + Intergenic
903178495 1:21594021-21594043 CTGCGGGAAGGAAGGCCTTGGGG - Intergenic
903185708 1:21627752-21627774 CAGCAGGAGAAATGGCCCGGAGG + Intronic
903188696 1:21644200-21644222 CAGCAGGTGCAAAGGCTCTGAGG - Intronic
903386148 1:22928225-22928247 CAGCAGGAGCAAAGGCCCTGAGG + Intergenic
903548911 1:24143990-24144012 GAGAAGGTAGAAGGGCCCTGGGG + Intergenic
903655139 1:24944313-24944335 CAGCACAGACAAAGGCCCTGTGG - Intronic
903678389 1:25081035-25081057 CAGCCTGTACAAAGGCCCTGTGG - Intergenic
903685535 1:25128994-25129016 CAGCATAAAGAAAGGAACTGTGG + Intergenic
903765150 1:25729230-25729252 CAGCATGTGCAAAGGCCCTGAGG - Intronic
903772534 1:25772887-25772909 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
903856915 1:26343194-26343216 CAGCAGGATGCAGGGGCCTGGGG - Intronic
903926007 1:26831242-26831264 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
903942481 1:26941431-26941453 GAGAGGGAAGAAAGGCCATGAGG - Intronic
903946963 1:26970084-26970106 CAGCTGGTGCAAAGGCCCTGAGG + Intergenic
904358044 1:29954182-29954204 CTTCAGGAAGAGAGGCCATGGGG + Intergenic
904359347 1:29961840-29961862 CAGCATGTGCAAAGGCCCTGGGG - Intergenic
904402794 1:30267689-30267711 CAGCAGAAGCAAAGGTCCTGAGG + Intergenic
904584433 1:31572102-31572124 CAGCATGAGCAAAAGCCCTGAGG - Intergenic
904698567 1:32344717-32344739 CAGCATGTTCAAAGGCCCTGAGG - Intergenic
904754951 1:32763453-32763475 CAGCAAGTGGAAAGGCCTTGAGG - Intronic
904799929 1:33085456-33085478 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
904910327 1:33929806-33929828 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
904911454 1:33937376-33937398 CAGCATGTGCAAAGGCCCTGAGG + Intronic
904925798 1:34047264-34047286 GAGCAGGTGCAAAGGCCCTGAGG - Intronic
904936031 1:34130366-34130388 CAGCAGGAAGAAATGTCTGGAGG + Intronic
905226822 1:36484323-36484345 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
905341558 1:37281909-37281931 CAGCAAGTGCAAAGGCCCTGGGG - Intergenic
905451746 1:38061474-38061496 CAGCAAGTGCAAAGGCCCTGCGG + Intergenic
905518940 1:38582659-38582681 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
905541506 1:38763937-38763959 CAGCAGGTACAAAGGCCTGGTGG - Intergenic
905899010 1:41568343-41568365 CAGCAAGTGCAAAGGCCCTGGGG + Intronic
905914483 1:41675301-41675323 CAGCATGTACAAAGGCCCTGAGG - Intronic
905973374 1:42157321-42157343 CAGCCTGAATAAAGGCACTGAGG - Intergenic
906087983 1:43152332-43152354 CAGCAAGAGCAAAGGTCCTGAGG - Intronic
906178613 1:43798520-43798542 CAGCAAGCACAAAGACCCTGAGG - Intronic
906322804 1:44827347-44827369 CTGCAGGGAGAAACGCCCTGGGG - Intronic
906527444 1:46503149-46503171 CAGCAAGGACAAAGGCCCTGAGG - Intergenic
906582922 1:46951302-46951324 CAGCAAGCACAAAGGCTCTGGGG - Intergenic
906647488 1:47485969-47485991 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
906666377 1:47625001-47625023 CAGCATGTCCAAAGGCCCTGGGG - Intergenic
906708595 1:47912883-47912905 CAGTGGGAAGAAAGGACCTGTGG + Intronic
906807581 1:48794188-48794210 GAGCAGGGAGAAAGTTCCTGTGG - Intronic
906951338 1:50336407-50336429 CAGAAGCAAGAAAGGCCTTCTGG + Intergenic
907047290 1:51307029-51307051 CAGCACGTCCAAAGGCCCTGAGG + Intronic
907074413 1:51565367-51565389 CAGCAGGAGCAAAGGCACAGTGG - Intergenic
907119885 1:51999126-51999148 CAGCATGAACAAAGGCCCAAAGG + Intergenic
907356159 1:53875727-53875749 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
907372630 1:54013315-54013337 CTGCAGGAACACAGACCCTGAGG - Intronic
907400539 1:54222338-54222360 CAGCAGGAACAAAGGCCCTGGGG + Intronic
907585377 1:55612158-55612180 CAGCAAGTAAAAAGGCCCTGAGG - Intergenic
907704001 1:56817269-56817291 CAGCAGATATAAACGCCCTGAGG - Intronic
907715474 1:56922237-56922259 CAGCAGGTGCAAAGGTCCTGAGG - Intergenic
907831336 1:58066991-58067013 CAGCATGAGCAAAGGCTCTGAGG - Intronic
907872615 1:58456559-58456581 CAGAAGGAAGAAAGGATCAGCGG + Intronic
907978703 1:59459703-59459725 CAGCAGGGAGAAAGGACCTTAGG + Intronic
907990748 1:59579989-59580011 GAGCAAGTACAAAGGCCCTGTGG - Intronic
908472949 1:64462157-64462179 CAGCAAGTGGAAAGGCCATGAGG - Intergenic
908735371 1:67270896-67270918 CAGCAGGAGCAAAGACCCTGGGG - Intergenic
908827943 1:68151679-68151701 CAGCAGGTGTGAAGGCCCTGGGG + Intronic
909367604 1:74846008-74846030 CAGCAGGAGTGCAGGCCCTGAGG - Intergenic
909489435 1:76209816-76209838 CAGCAGGAAGGGTGGCCCGGGGG - Intronic
910162348 1:84287419-84287441 CAGCAGGCAGTCAGGCCCAGTGG - Intergenic
910518720 1:88093179-88093201 TAGCTGGAATAAAGGCCCTAAGG + Intergenic
910682875 1:89885270-89885292 CACCATGAACAAAGGCACTGAGG - Intronic
910894428 1:92053261-92053283 CAGCAGGTACCAAAGCCCTGTGG + Intronic
911151845 1:94603842-94603864 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
911230356 1:95354454-95354476 AAGCAAGAGCAAAGGCCCTGAGG - Intergenic
911342077 1:96651609-96651631 TAGCAGTAAGCAAGGCTCTGTGG - Intergenic
911549513 1:99262832-99262854 CAGCAGCCAGAAAGGTCCTTTGG - Intergenic
912185231 1:107267391-107267413 AATCATGAAGAAAGGCTCTGAGG + Intronic
912858633 1:113193419-113193441 CAGCATGAGAGAAGGCCCTGAGG - Intergenic
913223264 1:116676470-116676492 GAGCAAGTACAAAGGCCCTGGGG + Intergenic
913225331 1:116693852-116693874 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
913273114 1:117113318-117113340 CTGCTGGCAGAAAGGCCCAGAGG + Intronic
913339830 1:117747513-117747535 AAGCAGTGAGAAAAGCCCTGTGG - Intergenic
915231981 1:154452399-154452421 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
915458683 1:156056508-156056530 CAGCAAGTACCAAGGCCCTGAGG + Intronic
915532496 1:156510813-156510835 CAGCAAGGAGACAGGCACTGTGG - Intergenic
915580859 1:156812464-156812486 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
915945162 1:160144450-160144472 CATCAAGAATAAAGGCCCTGTGG - Intergenic
916163578 1:161943620-161943642 GAGCAGGTATAGAGGCCCTGAGG - Intronic
916362310 1:163984445-163984467 CAGCCAGTACAAAGGCCCTGAGG + Intergenic
916469518 1:165109331-165109353 TAGCAGCAAGCAAGGCTCTGTGG + Intergenic
916472282 1:165136143-165136165 CAGAGGGAAGACAGGCCTTGAGG + Intergenic
916479587 1:165202792-165202814 CAGCAGGCAGAACTGCCCTCTGG + Exonic
916504416 1:165415228-165415250 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
916698441 1:167264898-167264920 CAGCAAGTGTAAAGGCCCTGAGG - Intronic
917030283 1:170682921-170682943 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
917073095 1:171174565-171174587 AAGAAGGAAGACAAGCCCTGTGG + Intergenic
917131370 1:171745287-171745309 AAGCAAGAAGAAAGGACCTGGGG + Intergenic
917422191 1:174875456-174875478 CAGCAGGGAGTAAGGCATTGTGG + Intronic
917496886 1:175548597-175548619 CAGCAGAAAGAGGGGCCCTGAGG - Intronic
917537104 1:175882361-175882383 CAGCAAGTGCAAAGGCCCTGTGG + Intergenic
917704300 1:177616111-177616133 CAGCAGTAAGAGGGGCACTGTGG - Intergenic
917798644 1:178550981-178551003 GAGCAAGTACAAAGGCCCTGGGG + Intergenic
918081966 1:181214692-181214714 CAGCAGGTGCCAAGGCCCTGAGG - Intergenic
918084562 1:181234825-181234847 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
918576926 1:186072726-186072748 CAGCAAGGGCAAAGGCCCTGAGG + Intronic
918616583 1:186551075-186551097 CAGCAGTGAGCAAGGCTCTGTGG + Intergenic
919127499 1:193413527-193413549 TAGCAGAAGCAAAGGCCCTGTGG + Intergenic
919417976 1:197335113-197335135 CAGCAGATGCAAAGGCCCTGAGG + Intronic
919543311 1:198878765-198878787 CAGCATGCGCAAAGGCCCTGAGG - Intergenic
919613329 1:199774027-199774049 CAGCAGGAGCAAAGGCTCTGAGG + Intergenic
919675354 1:200376826-200376848 CAGCATGAGCAAAGGCCCTGAGG - Intergenic
919821235 1:201473502-201473524 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
920108668 1:203572112-203572134 CAGCAGCAAGGAAGGCGCAGAGG - Intergenic
920377679 1:205518012-205518034 CAGCAGGGGCAAAGGTCCTGAGG - Intronic
920526842 1:206673495-206673517 GAGAGGGAAGAAAGGCCTTGGGG - Intronic
920970363 1:210738149-210738171 TAGCAGGTGCAAAGGCCCTGAGG - Intronic
921110577 1:212032851-212032873 CAGCAAGTACAAAGGCCCTGAGG - Intronic
921477983 1:215633187-215633209 CAGCAGCAGTAATGGCCCTGTGG + Intronic
921818512 1:219590618-219590640 GAGCAGGTGTAAAGGCCCTGAGG + Intergenic
921828764 1:219703419-219703441 CAGCATGGACAAAGGCCTTGTGG - Intronic
922419676 1:225451120-225451142 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
922570237 1:226630329-226630351 GAGCAGGTGCAAAGGCCCTGTGG + Intergenic
922997382 1:229975234-229975256 CAGTAGGTGCAAAGGCCCTGTGG + Intergenic
923393064 1:233532936-233532958 CCACAGGAAGACAAGCCCTGGGG - Intergenic
923761806 1:236853037-236853059 CATCTGGAATAAAGACCCTGAGG + Exonic
923961212 1:239085335-239085357 AAGCAGCAGGAAAAGCCCTGTGG - Intergenic
924189360 1:241533933-241533955 CAGCAGGAAGAGAAACCCTCAGG + Intronic
924607894 1:245550948-245550970 AAGCAGGACAAAGGGCCCTGGGG + Intronic
924769256 1:247064566-247064588 GAAAAGGCAGAAAGGCCCTGTGG - Intronic
1062861544 10:814290-814312 CAGCAGAAAGGAAGTCGCTGGGG + Intronic
1064691833 10:17926562-17926584 CAGCATGGGCAAAGGCCCTGGGG - Intergenic
1065227256 10:23556767-23556789 CAGCAGGTAGACAGTCCATGTGG - Intergenic
1065663751 10:28036259-28036281 CAGCAAGTACAAACGCCCTGAGG - Intergenic
1065711973 10:28527085-28527107 CAGCAAGAGCAAAGGTCCTGAGG - Intergenic
1065932046 10:30488664-30488686 CACCAGGAAGAGAAGCTCTGGGG - Intergenic
1065970682 10:30803841-30803863 CAGCAGGAGGGCAGCCCCTGAGG + Intergenic
1066034469 10:31467835-31467857 CAGCAGAAAGCAAGGCTATGAGG - Intronic
1066047449 10:31605520-31605542 CAGCGGGAACAAAGGAGCTGAGG - Intergenic
1066132849 10:32410778-32410800 CAGCATGTGCAAAGGCCCTGGGG + Intergenic
1067051274 10:43022784-43022806 CAGCAAGAGCACAGGCCCTGAGG + Intergenic
1067536580 10:47114872-47114894 CAGGAGGCAGGGAGGCCCTGGGG + Intergenic
1067561977 10:47310493-47310515 CCGCAGGAAGAAGGGCCAGGAGG + Exonic
1067712589 10:48661863-48661885 AAGCAGGTACAAAAGCCCTGGGG - Intergenic
1068169076 10:53370458-53370480 CAGCAGTGAGCAAGGCTCTGTGG - Intergenic
1068453961 10:57231472-57231494 CAGCTGGAAAAATGGCCCAGGGG - Intergenic
1068517404 10:58041478-58041500 CAGCACTAAGATAGGCACTGGGG - Intergenic
1068602760 10:58973035-58973057 CAACTAGAAGCAAGGCCCTGGGG - Intergenic
1068643282 10:59435760-59435782 CAGGAGGCTGAAAAGCCCTGGGG - Intergenic
1068671025 10:59723803-59723825 AAGCAGATACAAAGGCCCTGGGG - Intronic
1069030538 10:63591186-63591208 CAGCAGGCTGAATGGCCTTGAGG + Intronic
1069221396 10:65888410-65888432 CAGCTGGAAAAAAAGCCCAGTGG - Intergenic
1069307900 10:66994962-66994984 TAGCAGGAAGATAGACCTTGTGG - Intronic
1069623445 10:69852048-69852070 CAGCAAGTGCAAAGGCCCTGGGG - Intronic
1069862127 10:71478353-71478375 CTGCAGGTGCAAAGGCCCTGAGG - Intronic
1069873580 10:71547954-71547976 GAGCCGGAAGAGAGGCCCCGTGG + Intronic
1069914737 10:71780484-71780506 CAGCAAGTGGAAAGGCACTGAGG + Intronic
1070314018 10:75294276-75294298 CAGCTGAAAGAAAGGGGCTGAGG + Intergenic
1070345754 10:75540277-75540299 CAGCAAGTGAAAAGGCCCTGGGG + Intronic
1070496583 10:77029759-77029781 CAGCAAGCACAGAGGCCCTGAGG + Intronic
1070555059 10:77521159-77521181 CAGCATGTGCAAAGGCCCTGAGG + Intronic
1070645305 10:78198039-78198061 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
1070728863 10:78811109-78811131 CGGCAGGGAGAAAGGCACAGGGG + Intergenic
1070771205 10:79083332-79083354 CAGCATGTGCAAAGGCCCTGTGG + Intronic
1070774750 10:79103173-79103195 CAGCAGGTGCAAAGGCCCAGGGG + Intronic
1070826564 10:79393743-79393765 CAGCAGGTGCAAATGCCCTGAGG - Intronic
1071049026 10:81423264-81423286 CAGCAAGTACAAAGGTCCTGAGG + Intergenic
1071818095 10:89252948-89252970 TAGCAGGTACAAAGGCCCTGTGG + Intronic
1071974924 10:90945858-90945880 CTGGAGGATGAAAGGCCTTGTGG + Intergenic
1072470803 10:95711314-95711336 CAGAAGGAAGGAAGGCACAGAGG + Intergenic
1072547173 10:96448731-96448753 CAGCAAGTGCAAAGGCCCTGGGG + Intronic
1072552978 10:96493423-96493445 CAGCATGTGCAAAGGCCCTGGGG + Intronic
1072622676 10:97090365-97090387 CAGCAGGCACAAAGGCCGTGAGG + Intronic
1072658259 10:97345795-97345817 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
1072728090 10:97827091-97827113 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
1072752729 10:97994837-97994859 CAGAAGGAATGAAGGTCCTGTGG + Intronic
1072919200 10:99561346-99561368 CAGCAGGAAGAGAAGCAGTGGGG - Intergenic
1073309099 10:102526821-102526843 CAGCTAGTATAAAGGCCCTGAGG + Intronic
1073464745 10:103687905-103687927 CAGCAAGTGCAAAGGCCCTGGGG - Intronic
1073558526 10:104477468-104477490 CAGCAGGGAAATAAGCCCTGTGG - Intergenic
1073700790 10:105924971-105924993 AAGCAGCAAGAAGAGCCCTGTGG + Intergenic
1074014369 10:109518793-109518815 CAGCAGGAAGAATGCCCATTTGG - Intergenic
1074096757 10:110319997-110320019 CAGCAAGTGGAAAGACCCTGAGG + Intergenic
1074248629 10:111720309-111720331 AAGCAGGAAGAAAATCACTGAGG + Intergenic
1074256081 10:111803873-111803895 CAGCAGAAGCAAAGGCCCAGTGG + Intergenic
1074553753 10:114469432-114469454 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1074686499 10:115966758-115966780 CAACCGGTACAAAGGCCCTGGGG + Intergenic
1074727649 10:116329373-116329395 CAGCAAGTGCAAAGGCCCTGGGG - Intronic
1074779443 10:116790509-116790531 CAGCAAGTGCAAAGGCCCTGGGG - Intergenic
1074828723 10:117233144-117233166 CAGAGAGCAGAAAGGCCCTGAGG + Intergenic
1075199421 10:120389773-120389795 GGGAAGGAAGAAAGGCCCTCTGG + Intergenic
1075199834 10:120393558-120393580 CAGCAAGTTCAAAGGCCCTGAGG + Intergenic
1075420486 10:122296930-122296952 CAGCATGTGCAAAGGCCCTGGGG - Intronic
1075451708 10:122556492-122556514 CAGCAAGTGCAAAGGCCCTGGGG + Intergenic
1075738444 10:124678687-124678709 CAGCAGGAGCAAGTGCCCTGGGG - Intronic
1075980249 10:126732319-126732341 AAGCAGGAAGACAGGCTCTTTGG + Intergenic
1076153684 10:128186148-128186170 AGCCAGGAAGAAAGGACCTGGGG - Intergenic
1076469683 10:130709856-130709878 CAGGAGGCAGACAGGCCTTGGGG + Intergenic
1076729171 10:132429724-132429746 CAGGAGGAAGGAAGGAGCTGGGG - Intergenic
1077347788 11:2072172-2072194 CAGCAAGTGCAAAGGCCCTGGGG - Intergenic
1077830250 11:5860412-5860434 CAGGAAGAAGCATGGCCCTGAGG - Intronic
1077862750 11:6198038-6198060 TGGGAGGGAGAAAGGCCCTGAGG + Intergenic
1078068456 11:8093271-8093293 CAGCAGGAGCAAGGGCCCTGTGG + Intronic
1078131383 11:8616936-8616958 AAGCAGGAGGAGAGGCCCAGAGG + Exonic
1078151382 11:8762318-8762340 CAGCAGGTGTGAAGGCCCTGGGG - Intronic
1078162945 11:8857634-8857656 CAGCATGAGCAAAGGCCCAGAGG - Intronic
1078458804 11:11497076-11497098 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1078793205 11:14566006-14566028 CAGCTGGAACAAAGGCCCCATGG + Intronic
1079082090 11:17420728-17420750 CAGCAGGAACCAGGGCCCTGAGG - Intronic
1079203270 11:18393359-18393381 CAGCAAGAATACAGGCCCAGAGG + Intergenic
1079349051 11:19677347-19677369 CTGCGGGAAGAAAGGCAGTGAGG + Intronic
1079355410 11:19726432-19726454 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1079365412 11:19804905-19804927 CTGCAGGAGTAAAGGCCCAGAGG + Intronic
1079450465 11:20596891-20596913 AGGCAGGAAGCCAGGCCCTGGGG - Intergenic
1080585977 11:33682990-33683012 AAGCAGCAGGAAAAGCCCTGTGG - Intergenic
1080694789 11:34593932-34593954 GAGCAGGTGCAAAGGCCCTGAGG - Intergenic
1080745553 11:35105491-35105513 CAGCAGCCAGAGAGGACCTGAGG - Intergenic
1080764742 11:35285171-35285193 CAGAAAGAAGAAATGACCTGTGG + Intronic
1081540214 11:44029315-44029337 CAGCAAGGGCAAAGGCCCTGAGG - Intergenic
1081607133 11:44534393-44534415 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
1081634813 11:44714076-44714098 CAGCAGGTGCAAAGGCCCTGGGG + Intergenic
1081686213 11:45044887-45044909 CAGCAGGTACAAAGGCCGTGAGG - Intergenic
1081705382 11:45179953-45179975 CAGGTGGGAGCAAGGCCCTGTGG - Intronic
1081706373 11:45184148-45184170 CAGCAAGAGCAAAGGCCCTGTGG + Intronic
1081796043 11:45820650-45820672 CAGCAGGTGCAAAGGCCCTGGGG + Intergenic
1082063252 11:47878416-47878438 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
1083176482 11:60952932-60952954 CAGCAAAGACAAAGGCCCTGAGG - Intergenic
1083356312 11:62068910-62068932 CAGTAGGAGCAAAGGCCCCGAGG + Intergenic
1083558418 11:63651643-63651665 CTGCTGGAAGACAGACCCTGAGG - Intronic
1083642845 11:64154657-64154679 CAGCAGGTACAAAGGGCCTGGGG - Intronic
1083663011 11:64260518-64260540 CAGCATGTACAAAGGTCCTGGGG + Intronic
1084213271 11:67633628-67633650 CAGTAGGTGCAAAGGCCCTGAGG - Intronic
1084268319 11:68016282-68016304 CAGCACGTGCAAAGGCCCTGAGG + Intronic
1084309857 11:68310791-68310813 CAGCAAGCACAAAGGCCCTGAGG + Intergenic
1084368615 11:68721286-68721308 CAGCAGGTGCAAAGGCCCTGTGG - Intronic
1084458884 11:69285310-69285332 CAGCACATACAAAGGCCCTGGGG - Intergenic
1084509705 11:69595579-69595601 CAGCAGGAGAAACGGCGCTGAGG - Intergenic
1084571030 11:69959930-69959952 CAGCAGGCACAAAGGCCCTGTGG - Intergenic
1084581524 11:70026920-70026942 CAGCAAGTGCAAAGGCCCTGGGG - Intergenic
1084671400 11:70608660-70608682 AAGCAGGGAGAGAGGCCCTGAGG - Intronic
1084784689 11:71435390-71435412 CAGCAGGCGGTAAGGCACTGCGG + Exonic
1084955417 11:72688733-72688755 CTGCAGGGAGACAGGCCTTGGGG - Intronic
1084981217 11:72829801-72829823 CAGCAGGAAGAAAGGCCCTGAGG + Intronic
1085231511 11:74975216-74975238 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1085282986 11:75342795-75342817 CAGCAGGAACAAAGGCCCTGAGG + Intronic
1085337122 11:75704825-75704847 CAGCATGAGCAAAGGCCCTCAGG + Intergenic
1085449082 11:76621311-76621333 CTGCATGTACAAAGGCCCTGTGG + Intergenic
1085456519 11:76668549-76668571 CTGCAGGAGCAAAGGCCCTGTGG - Intronic
1085865732 11:80289854-80289876 CAGCATGTACAAAGGCACTGTGG - Intergenic
1086869077 11:92015302-92015324 TAGCAGTAAGCAAGGCTCTGTGG + Intergenic
1087017163 11:93565079-93565101 CAGCGAGTACAAAGGCCCTGGGG + Intergenic
1087074368 11:94115467-94115489 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
1087304274 11:96470763-96470785 CAGCAGAAAACAAGGGCCTGAGG - Intronic
1087646345 11:100812682-100812704 CAGCAAGTACAAAGGTCCTGAGG + Intronic
1088152439 11:106760863-106760885 CAGAAGGAAGACAGGAACTGAGG + Intronic
1088546926 11:110968618-110968640 CACCAGGAAGAAAAATCCTGTGG - Intergenic
1089049968 11:115537502-115537524 CAGCACGGACAAGGGCCCTGAGG + Intergenic
1089227090 11:116933941-116933963 TAGAAAGAACAAAGGCCCTGTGG - Intronic
1089342696 11:117770132-117770154 CAGCAGAAAGAGTGGTCCTGCGG + Intronic
1089390761 11:118100026-118100048 CAGCAAGAAGTAGGGCACTGGGG + Intronic
1089617893 11:119705538-119705560 CAGCAGGTGCAAAGGCCCCGTGG + Intronic
1089686187 11:120148176-120148198 GAGCAGGAAGCAATGCCTTGGGG + Intronic
1089753738 11:120670541-120670563 CAGCAGGTGTGAAGGCCCTGGGG - Intronic
1090103781 11:123829985-123830007 TAGCAGTAAGCAAGGCCCCGTGG + Intergenic
1090185719 11:124738067-124738089 CAGCAGGAAGAAGGGCCCAGAGG + Intergenic
1090401478 11:126452382-126452404 CAGCAGGGTGAAAGGAACTGCGG - Intronic
1090968658 11:131620598-131620620 CAGCAGGTGCCAAGGCCCTGAGG - Intronic
1091005405 11:131948607-131948629 CAGCAAGTACAAAAGCCCTGTGG - Intronic
1091137809 11:133207920-133207942 CAGCATGAATGAAGACCCTGCGG - Intronic
1091246519 11:134100333-134100355 CCTCAGCAAGAAAGGCTCTGTGG - Intronic
1091317926 11:134628666-134628688 CAGCAGGAAGACAGCCACAGCGG + Intergenic
1091585703 12:1815305-1815327 CAGCTGGTACAAATGCCCTGGGG - Intronic
1091648827 12:2294445-2294467 AGGCAGTCAGAAAGGCCCTGAGG + Intronic
1091812244 12:3409358-3409380 CAGCAGCAACTCAGGCCCTGGGG + Intronic
1091907830 12:4203141-4203163 TAGCATGCACAAAGGCCCTGAGG - Intergenic
1091968464 12:4765276-4765298 CAGCAGGAAGAATGATCTTGGGG - Intronic
1091978298 12:4844522-4844544 CAGCATGTGCAAAGGCCCTGAGG + Intronic
1092214523 12:6671876-6671898 CAGCAACAAGCAAGGCTCTGAGG - Intronic
1092219283 12:6701582-6701604 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
1092231959 12:6780926-6780948 CAGAAGGAAGAAAGGGCATATGG + Intergenic
1092517148 12:9226472-9226494 TAGCAGTAAGCAAGGCTCTGTGG + Intergenic
1092562975 12:9636133-9636155 CAGCAGGAGCAAAGGGCCTAAGG - Intergenic
1092762226 12:11820582-11820604 CAGCAAGTCCAAAGGCCCTGAGG + Intronic
1092958654 12:13574611-13574633 CATCAGGAAGTGAGGCCCTCTGG - Intronic
1093144871 12:15553483-15553505 CAGCTGGTGTAAAGGCCCTGGGG + Intronic
1093300798 12:17452115-17452137 CAGCAGGAGGAAACTCCATGCGG + Intergenic
1093959894 12:25260676-25260698 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
1094450506 12:30578605-30578627 CAGCAAGTGCAAAGGCCCTGGGG + Intergenic
1095098318 12:38159489-38159511 AAGCAGCAAGAAAGCCCCGGGGG + Intergenic
1095329445 12:40940223-40940245 CAGCATGTACAAAGGCCCTATGG + Intronic
1095630271 12:44368064-44368086 GAGCAAGTACAAAGGCCCTGAGG - Intronic
1095738281 12:45581802-45581824 CAGCAGGTATGAAGGGCCTGAGG - Intergenic
1095821293 12:46481452-46481474 CAGCAAGGGCAAAGGCCCTGAGG + Intergenic
1095926379 12:47583714-47583736 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
1096446665 12:51699233-51699255 CAGCAGGTATGAAGGCCCTATGG + Intronic
1096555858 12:52403314-52403336 CAGCAGGAACAAAAGCCCGGAGG + Intronic
1096616266 12:52834979-52835001 CAGGAGGTAGAAAAGGCCTGGGG + Intergenic
1096753333 12:53777607-53777629 CAGCAAGTACAAAGGCCCTGAGG + Intergenic
1097352262 12:58561934-58561956 CAGCAAGCACAAAGGCCCTGGGG + Intronic
1097492007 12:60282553-60282575 CAGGAGGCAGACAGGCTCTGGGG - Intergenic
1097572401 12:61350758-61350780 TAACATGAAGAAAAGCCCTGAGG - Intergenic
1097699650 12:62807053-62807075 CAGCAGGTGCAAGGGCCCTGCGG + Intronic
1097979340 12:65720912-65720934 CATCCGGAAGAAAGGTCCTGTGG + Intergenic
1098160220 12:67642439-67642461 CAGCAGATGCAAAGGCCCTGAGG - Intergenic
1098232577 12:68387580-68387602 CAGCAAGTACAGAGGCCCTGAGG - Intergenic
1098249972 12:68559440-68559462 CAGCAAGGACAAAGGCCCTGAGG + Intergenic
1098307940 12:69119989-69120011 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
1098538022 12:71617828-71617850 GAGCAGAAAGAAGGGCCCTTTGG + Intronic
1098570231 12:71980169-71980191 CAGCAAAAACAAAGACCCTGAGG + Intronic
1098620257 12:72588366-72588388 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1099217795 12:79874886-79874908 CTGCAAGAACAAAGGCTCTGAGG - Intronic
1100227311 12:92572240-92572262 GAGCATGTACAAAGGCCCTGAGG - Intergenic
1100328558 12:93565050-93565072 CAACAGGTACAAAGGCCCTGAGG + Intergenic
1100573349 12:95863819-95863841 CAGCAAGTACAAAGGCCCTGTGG + Intronic
1100882840 12:99037690-99037712 CATCAGGACTAAAGACCCTGAGG + Intronic
1100888078 12:99094643-99094665 CAGCAGGTGCAAAGGCACTGAGG + Intronic
1101212090 12:102544698-102544720 CAAAAGGAAGAGATGCCCTGTGG + Intergenic
1101287154 12:103326571-103326593 AAGCAGGAAGAACGCCACTGTGG - Intronic
1101290293 12:103361354-103361376 AAGCAGCAGGAAAAGCCCTGTGG + Intronic
1101334729 12:103786356-103786378 CAGCAAGTGCAAAGGCCCTGGGG + Intronic
1101360376 12:104020777-104020799 CAGCAAGTGCAAAGGCCCTGGGG + Intronic
1101431187 12:104628712-104628734 CAGCAGGTGCAAAGGCCCGGTGG - Intronic
1101575304 12:105991695-105991717 CAGCATGAACAAAGGCCAGGGGG + Intergenic
1101672868 12:106893036-106893058 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
1101733199 12:107443502-107443524 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1101744324 12:107526990-107527012 CAGCAGGTGCAAAGGCCTTGTGG - Intronic
1101878473 12:108610562-108610584 CAGCAAGGGCAAAGGCCCTGAGG + Intergenic
1102017506 12:109657412-109657434 CAGCAAGGACAAAGGCCCTGGGG + Intergenic
1102022465 12:109693366-109693388 TAGCAGGTGCAAAGGCCCTGTGG + Intergenic
1102209310 12:111113091-111113113 CAGCATGAACAAAGACCCTGAGG + Intronic
1102220117 12:111188567-111188589 CAGCAGGTGCAAAGGTCCTGAGG + Intronic
1102229629 12:111253403-111253425 CGGCAGGTGCAAAGGCCCTGGGG - Intronic
1102400830 12:112628263-112628285 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1102403076 12:112647756-112647778 CTGCAGGTGCAAAGGCCCTGAGG + Intronic
1102426159 12:112845966-112845988 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1102458540 12:113086322-113086344 CAGCATGTGCAAAGGCCCTGAGG + Intronic
1102459070 12:113089140-113089162 CAGCAAGTGCAAAGGCCCTGGGG + Intronic
1102466133 12:113131779-113131801 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1102477455 12:113197876-113197898 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1102527683 12:113523688-113523710 CAGCAAGGGCAAAGGCCCTGAGG - Intergenic
1102528308 12:113527752-113527774 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
1102531123 12:113547311-113547333 AAGAAGGAAGAAAGGCCCCAGGG + Intergenic
1102544344 12:113643783-113643805 CAGCAAGTGCAAAGGCCCTGGGG - Intergenic
1102587196 12:113931698-113931720 CAGCAGGTGCAAAGGCCCTGTGG - Intronic
1102628991 12:114260390-114260412 CAGCATGTACAAAGGTCCTGAGG - Intergenic
1102636789 12:114331571-114331593 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
1102796629 12:115694738-115694760 GAGCAGGTACAAAGGTCCTGAGG + Intergenic
1102857234 12:116304846-116304868 CAGCAAGTGCAAAGGCCCTGGGG - Intergenic
1102865369 12:116369935-116369957 CAGCCTGTGGAAAGGCCCTGGGG + Intergenic
1102885761 12:116520460-116520482 CAGCAAGTGCAAAGGCCCTGGGG - Intergenic
1102905802 12:116674415-116674437 CAGCATATACAAAGGCCCTGTGG - Intergenic
1102914044 12:116739639-116739661 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1103019010 12:117518767-117518789 CTGCAGGTGCAAAGGCCCTGGGG - Intronic
1103038400 12:117674956-117674978 CAGCATGTGCAAAGGCCCTGAGG - Intronic
1103189479 12:118988943-118988965 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1103197396 12:119056642-119056664 CAGCATGTGCAAAGGCCCTGAGG - Intronic
1103361036 12:120353781-120353803 CAGCATGTGCAAAGGCCCTGAGG - Intronic
1103743180 12:123105095-123105117 GCTCAGGGAGAAAGGCCCTGAGG - Intronic
1103830524 12:123775587-123775609 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1103860702 12:124010891-124010913 CAGCATGTACAAAGGCCCTGAGG + Intronic
1103880041 12:124158998-124159020 CAGCAGGTGCGAAGGCCCTGGGG - Intronic
1103919123 12:124390346-124390368 CAGCTGGTGCAAAGGCCCTGGGG - Intronic
1103930243 12:124446289-124446311 CTGCAGGGAGGAAGGACCTGGGG - Intronic
1103937282 12:124483340-124483362 CAGCAAGTGCAAAGGCCCTGGGG - Intronic
1103937557 12:124484614-124484636 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
1103941267 12:124502545-124502567 CAGCAGGTGCAAAGGCCCAGAGG + Intronic
1103963274 12:124622519-124622541 CTGCAGGTGCAAAGGCCCTGAGG - Intergenic
1103972876 12:124682953-124682975 CAGCAGGTGCAAATGCCCTGGGG - Intergenic
1104019297 12:124980921-124980943 CAGCAGGTGCAAAGTCCCTGAGG - Intronic
1104051331 12:125195813-125195835 CAGCAGGTGTAAAGGCCCTGAGG + Intronic
1104085805 12:125473177-125473199 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1104123516 12:125821465-125821487 GAGCAGGTGCAAAGGCCCTGAGG - Intergenic
1104195575 12:126534241-126534263 CTGCAGCAAGAAAGACCATGGGG + Intergenic
1104427198 12:128687559-128687581 CAGCACGTGCAAAGGCCCTGTGG + Intronic
1104547623 12:129726411-129726433 CAGCAAGAGCAAAGGTCCTGAGG + Intronic
1104569023 12:129909077-129909099 CAGCAGGTGCAAAGGCCATGAGG + Intergenic
1104657178 12:130581980-130582002 CAGCAGGTGCAAAGGTCCTGAGG - Intronic
1104743654 12:131196395-131196417 CAGCAGGAGCAAAGGCGCTGGGG - Intergenic
1104758797 12:131284769-131284791 CAGCAGGATGGAAGGGCATGTGG + Intergenic
1104777509 12:131399867-131399889 CAGCAAGTGCAAAGGCCCTGGGG + Intergenic
1104939595 12:132388726-132388748 GAGCAGGTGCAAAGGCCCTGGGG + Intergenic
1104970157 12:132527430-132527452 CAGGAGGACGACAGCCCCTGGGG + Intronic
1105719044 13:23095814-23095836 CAGCAAGTGCAAAGGCCCTGGGG + Intergenic
1105939282 13:25132767-25132789 CAACATAAAGAAAGGCCCTTTGG + Intergenic
1106556102 13:30809946-30809968 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
1106700337 13:32222186-32222208 CAGCAGATACAAGGGCCCTGAGG + Intronic
1106708139 13:32303116-32303138 CAGCAGGAATAAAGGCATTGAGG - Intergenic
1106717945 13:32410265-32410287 CAGAAGGATGACAGGCCCTGCGG - Intronic
1107880654 13:44829445-44829467 CAGTAGGAGGGAAGGCCCAGGGG - Intergenic
1108035342 13:46285164-46285186 CTGCAGGAAGCCAGGCCCTTGGG - Intergenic
1108228863 13:48317773-48317795 CAGCCGGCAGAAGGGCCATGAGG - Intronic
1108308573 13:49163398-49163420 TAGCAGTAAGCAAGGCTCTGTGG + Intronic
1108522326 13:51257716-51257738 CAGCAGGTTTAAAGGTCCTGAGG - Intronic
1109584840 13:64386368-64386390 CAGCAGCAAGAAAGACAGTGGGG + Intergenic
1110356590 13:74574573-74574595 CAGCATGAACAAAGGCACTGAGG - Intergenic
1110882330 13:80587450-80587472 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
1111217919 13:85168246-85168268 GAGCTGGTACAAAGGCCCTGAGG + Intergenic
1111727986 13:92037298-92037320 CAGCAAGTATAAAGGCCCTAAGG - Intronic
1112086886 13:96041323-96041345 AAGCAGCAGGAAAAGCCCTGTGG + Intronic
1112901769 13:104365563-104365585 CTCCTGGAAGAAAGGCTCTGGGG - Intergenic
1113164672 13:107426037-107426059 CAGCAGCGAGTAAGGTCCTGAGG - Intronic
1113373946 13:109746471-109746493 CAGCAGGTGCAAAGGCCCCGGGG - Intergenic
1113414374 13:110116902-110116924 CAGCAGGGAGAGAGGCTCAGAGG + Intergenic
1113830758 13:113293835-113293857 AAGCGGGAAGCTAGGCCCTGTGG + Intergenic
1113895994 13:113764832-113764854 CAGCAGGTACAAAGGCCCTGTGG + Intronic
1114180883 14:20366836-20366858 CCTCAGAAAGAAAGGGCCTGAGG + Exonic
1114342574 14:21760419-21760441 TAGCAGTAAGCAAGGCTCTGTGG - Intergenic
1114786241 14:25603158-25603180 CAGCAAGTAGAAAGTCCCTGAGG + Intergenic
1114875755 14:26715949-26715971 TAGCAACAACAAAGGCCCTGAGG - Intergenic
1115633720 14:35270485-35270507 CATCAGGCAGACAGGCCTTGTGG - Exonic
1115751614 14:36499059-36499081 CAGCATGCACAAAGGCCCAGGGG - Intronic
1115909114 14:38235967-38235989 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
1116069956 14:40031408-40031430 CAGCAAGATCAAAGGCCCTGGGG + Intergenic
1117500398 14:56345466-56345488 CAGGAGGAAGACAGGCCGAGGGG + Intergenic
1117622061 14:57597581-57597603 GAGCAGGAAGAAAGGGAGTGAGG + Intronic
1117699281 14:58396709-58396731 GAGCTACAAGAAAGGCCCTGCGG - Intronic
1117757543 14:58991334-58991356 AAGCTGTTAGAAAGGCCCTGTGG - Intergenic
1117919004 14:60708068-60708090 CAGCAGGTACAAAGGCCCTGAGG - Intergenic
1118168493 14:63361449-63361471 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
1118838785 14:69495710-69495732 CTGCAGGTGCAAAGGCCCTGAGG - Intronic
1119271285 14:73307492-73307514 CAGCAAGTACAAAGGCCCTGAGG + Intronic
1119787684 14:77325328-77325350 AAGCAGAAACAAGGGCCCTGTGG + Intronic
1119883889 14:78124055-78124077 CAGCAGGTGCAAAGGTCCTGAGG - Intergenic
1119895220 14:78214235-78214257 CATCATGGACAAAGGCCCTGTGG - Intergenic
1120079809 14:80203037-80203059 CAGCAGGAAGTCAGCCACTGAGG + Exonic
1120189062 14:81423516-81423538 CAGAAGGAAGCCAGGCACTGTGG + Intronic
1120298550 14:82676701-82676723 CTGCAGGAGGAGAGGCCATGTGG + Intergenic
1120827509 14:88969049-88969071 CAGCAGGAACAAGGGTCCTGAGG - Intergenic
1120879072 14:89400718-89400740 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1121014047 14:90537623-90537645 CAGCAGGTGCAAAGGCCCAGAGG - Exonic
1121274501 14:92658328-92658350 CCGCAGGAGCAAAGGCCCCGGGG + Intronic
1121296881 14:92834543-92834565 GAGCAGGCACAAAGGCCTTGAGG + Intronic
1121843734 14:97155504-97155526 CAGCATGTGCAAAGGCCCTGTGG - Intergenic
1121874863 14:97442001-97442023 CAGCAGGAAGGAAGAACCAGGGG - Intergenic
1121960081 14:98251488-98251510 CAGCAGGTGCAAAGGCCCTGTGG + Intergenic
1122201359 14:100124520-100124542 CAACAGTAAGAAAAGCCCTGAGG - Intronic
1122442761 14:101743936-101743958 CAGCTGGTGCAAAGGCCCTGGGG - Intergenic
1122910675 14:104826447-104826469 CAGCAGGACGCCAGGCTCTGGGG - Intergenic
1123114768 14:105889739-105889761 CAGCAGGTAGAAAAGGCCCGAGG + Intergenic
1123121485 14:105918939-105918961 GGGCAGGAAGGAAGGGCCTGTGG + Intronic
1124341148 15:28889712-28889734 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1124883181 15:33660624-33660646 GAGCTGCAACAAAGGCCCTGTGG - Intronic
1125292651 15:38166871-38166893 CAGTAGGTATAAAAGCCCTGAGG + Intergenic
1125380379 15:39080662-39080684 CAGCATGAGCCAAGGCCCTGTGG - Intergenic
1125531330 15:40415374-40415396 CAGAAAGGAGAAAGGCCCCGTGG - Intronic
1126441486 15:48694372-48694394 CAGCAAGTGTAAAGGCCCTGGGG - Intergenic
1126598579 15:50406123-50406145 CATGAAGAGGAAAGGCCCTGGGG + Intergenic
1126750773 15:51874889-51874911 CAGCAGGAAGAAAAGGAGTGCGG - Intronic
1127354977 15:58189399-58189421 CATCAGGTGCAAAGGCCCTGTGG - Intronic
1127500629 15:59550730-59550752 CAGCAAGAACAGAGGCACTGGGG - Intergenic
1127854159 15:62941175-62941197 CAGCAGGGAGTAAAGCCCTGAGG - Intergenic
1127992087 15:64127077-64127099 CAACAGGAGGAAAGGCAGTGAGG - Intronic
1128050572 15:64660737-64660759 AAGCAAGTACAAAGGCCCTGTGG - Intronic
1128127515 15:65203990-65204012 CAGCAAGCACGAAGGCCCTGAGG + Intronic
1128246259 15:66134707-66134729 CAGCGGGGAGAAGGGCGCTGAGG + Intronic
1128369863 15:67032770-67032792 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
1128557815 15:68643538-68643560 GAGCAGGGAGACTGGCCCTGTGG + Intronic
1128636954 15:69308763-69308785 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1128911435 15:71519165-71519187 CAGCAAGCGCAAAGGCCCTGGGG + Intronic
1128992211 15:72270594-72270616 CAGCAGGGACAAAGGCTCTATGG - Intronic
1129152404 15:73697203-73697225 CAGCAGGCAGTAAGGCTTTGAGG + Intronic
1129320809 15:74773650-74773672 AAGCAGGAAAAGAGGCCCTGGGG - Intergenic
1129605246 15:77021777-77021799 CAGCAGGAGCAAAGGCCCAGAGG - Intronic
1129666065 15:77579996-77580018 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
1129880545 15:79003707-79003729 GAGCAGGAAGAGCAGCCCTGAGG + Intronic
1129884369 15:79028299-79028321 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1130059286 15:80558058-80558080 CAGCATGTGCAAAGGCCCTGAGG - Intronic
1130064973 15:80595719-80595741 CAGAAGCAAGAAAGCCTCTGAGG - Exonic
1130312600 15:82768272-82768294 CTGCATGAACACAGGCCCTGGGG - Intronic
1130334375 15:82946477-82946499 CAGCAGGTGTAAAGGCCCTGAGG - Intronic
1130344500 15:83030163-83030185 CAGCAAGTAGAAAGCCGCTGGGG - Exonic
1130866444 15:87937044-87937066 AAGGAGGAGCAAAGGCCCTGGGG - Intronic
1131022247 15:89108760-89108782 AAGAAAGAACAAAGGCCCTGAGG + Intronic
1132536912 16:486719-486741 CATCAGGAAGAAGTGTCCTGAGG + Intronic
1132746716 16:1439269-1439291 CAGCCGGAAGAAAGCCACGGCGG + Intronic
1132863684 16:2083558-2083580 CAGCAGTAAGCAGAGCCCTGGGG + Intronic
1133367899 16:5225580-5225602 CAGGAGTCACAAAGGCCCTGGGG + Intergenic
1133682098 16:8129360-8129382 CATCAGGAATAAAGGCTCTCGGG - Intergenic
1133726322 16:8540938-8540960 CAGCAGGTGCAAAGTCCCTGTGG + Intergenic
1133729367 16:8566733-8566755 CAGCAGACGCAAAGGCCCTGAGG - Intergenic
1133835764 16:9366100-9366122 CAGCAGGTGCGAAGGCCCTGAGG + Intergenic
1133928959 16:10216678-10216700 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
1133975494 16:10597424-10597446 CAGCAGGTGCAAAGTCCCTGGGG + Intergenic
1133989164 16:10691518-10691540 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1134005660 16:10817671-10817693 CAGCAAGCGCAAAGGCCCTGGGG - Intronic
1134040885 16:11067444-11067466 CAGAAGAAGCAAAGGCCCTGGGG + Intronic
1134104467 16:11476071-11476093 CAGCAGGTGCAAAGGCCCTGGGG + Intronic
1134215435 16:12313429-12313451 GGGCAGGTATAAAGGCCCTGGGG - Intronic
1134295574 16:12942403-12942425 CAGTTGGAAGAAAGGCAATGTGG - Intronic
1134331194 16:13252495-13252517 CAGCATGAAGAAGGGTCCTGGGG - Intergenic
1134559142 16:15192724-15192746 CAGCAAGTGCAAAGGCCCTGGGG - Intergenic
1134657151 16:15955605-15955627 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1134678887 16:16110041-16110063 CAGCATGTGCAAAGGCCCTGAGG - Intronic
1134827847 16:17298757-17298779 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1134837486 16:17374158-17374180 AAGCATGAATAAAGGCTCTGTGG + Intronic
1134919678 16:18104337-18104359 CAGCAAGTGCAAAGGCCCTGGGG - Intergenic
1135161248 16:20098403-20098425 CAGCATGTGCAAAGGCCCTGGGG + Intergenic
1135315837 16:21443711-21443733 CAGCAGATGCAAAGGCCCTGTGG + Intronic
1135368763 16:21875972-21875994 CAGCAGATGCAAAGGCCCTGTGG + Intronic
1135409811 16:22225150-22225172 CAGCAGGTACAAAGGCTCGGAGG + Intronic
1135443054 16:22495170-22495192 CAGCAGATGCAAAGGCCCTGTGG - Intronic
1135464305 16:22672140-22672162 AAGCAGGAGGAAAGGGGCTGAGG - Intergenic
1135633376 16:24053739-24053761 CAGCTGGTGCAAAGGCCCTGTGG + Intronic
1135640402 16:24115031-24115053 CAGCATGTGCAAAGGCCCTGTGG + Intronic
1135641318 16:24122213-24122235 CAGCAGGTGCAAAGGCCCTGGGG + Intronic
1135641452 16:24123254-24123276 CAGCAGGTGCAAAGGCCCTGTGG + Intronic
1135823746 16:25707774-25707796 CAGCAAGTGCAAAGGCCCTGGGG - Intronic
1135888660 16:26337257-26337279 CAGCAGGCACCAAGGCCCTGGGG - Intergenic
1135913949 16:26586735-26586757 CAGCAGGGGCAAAGGCCCTGGGG + Intergenic
1135938612 16:26801849-26801871 CAGCATGTGCAAAGGCCCTGGGG - Intergenic
1136061064 16:27726803-27726825 CAGCAGGAGCAAAGGCCCTGCGG + Intronic
1136088402 16:27901894-27901916 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1136089963 16:27911624-27911646 CAGCAGGTGCACAGGCCCTGAGG - Intronic
1136312517 16:29422461-29422483 CAGCAGATGCAAAGGCCCTGAGG + Intergenic
1136325947 16:29524194-29524216 CAGCAGATGCAAAGGCCCTGTGG + Intergenic
1136412991 16:30087698-30087720 CAGCACGTGCAAAGGCCCTGAGG - Intronic
1136440636 16:30264178-30264200 CAGCAGATGCAAAGGCCCTGTGG + Intergenic
1136522007 16:30802888-30802910 AAGCAGGAAGAAAGGCTGCGCGG + Intergenic
1136614994 16:31393236-31393258 CAGCAGGAAGAGGGGCACAGTGG - Intergenic
1137550408 16:49433748-49433770 CAGTAAGCACAAAGGCCCTGGGG + Intergenic
1137612131 16:49825577-49825599 AAGCAGGAAGGAAGGCAGTGGGG + Intronic
1137625057 16:49902459-49902481 CAGCCAGTGGAAAGGCCCTGCGG + Intergenic
1138051178 16:53780263-53780285 CAGCTGGTACAAAGGCCCTAAGG - Intronic
1138107501 16:54296706-54296728 CAGCAAGTGCAAAGGCCCTGTGG + Intergenic
1138200638 16:55085727-55085749 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
1138319940 16:56103237-56103259 TAGCTGGAAGCGAGGCCCTGAGG + Intergenic
1138335345 16:56248719-56248741 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1138337663 16:56265956-56265978 CAGCAAGAGCAAAGGCCCCGGGG - Intronic
1138395800 16:56703779-56703801 CAGCAGGTGCAAAGGCCTTGAGG - Intronic
1138428267 16:56950969-56950991 CTGCAAGGACAAAGGCCCTGGGG + Intergenic
1138451665 16:57096926-57096948 CAGCATGTGTAAAGGCCCTGTGG - Intronic
1138549330 16:57739003-57739025 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1138932000 16:61670248-61670270 CAGCAGGAACAAACAGCCTGAGG + Intronic
1139449143 16:67016321-67016343 CAGCAGGAGCAAAGGCCTGGAGG + Intergenic
1139658356 16:68403045-68403067 CTGTAGGAACAAAGGCCCTGGGG - Intronic
1139709997 16:68768874-68768896 CAGCAGGCACCATGGCCCTGAGG - Intronic
1139887150 16:70216511-70216533 CAGCAGATGCAAAGGCCCTGAGG + Intergenic
1140202103 16:72903123-72903145 CAGCAGGAACAAATGCACAGCGG - Intronic
1140206304 16:72936577-72936599 CAGCAAGTGCAAAGGCCCTGTGG + Intronic
1140412947 16:74752476-74752498 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1140733181 16:77874532-77874554 CAGCATGTGCAAAGGCCCTGTGG - Intronic
1140760265 16:78103080-78103102 CAGCAGGAAGGCAGGCGCAGGGG - Intronic
1140821055 16:78663830-78663852 CAGCAAGTGCAAAGGCCCTGGGG + Intronic
1141138703 16:81483289-81483311 CAGCATGTGCAAAGGCCCTGGGG + Intronic
1141158570 16:81613496-81613518 CAGCAGGAAGAACCTCTCTGGGG + Intronic
1141279350 16:82616896-82616918 CAGCAGGTGCAAAGGTCCTGAGG + Intergenic
1141295362 16:82763115-82763137 CAGCACATACAAAGGCCCTGCGG - Intronic
1141320952 16:83008401-83008423 CAGCAGATGCAAAGGCCCTGAGG + Intronic
1141424282 16:83935339-83935361 CAGCCAGTACAAAGGCCCTGGGG + Intronic
1141440225 16:84025337-84025359 CAGCAGTAGCAAAGGCCCTGAGG - Intronic
1141602318 16:85134293-85134315 CAGCACGTGCAAAGGCCCTGAGG - Intergenic
1141630919 16:85287539-85287561 CAGCGGGTACAAAGGCCCTGAGG - Intergenic
1141637262 16:85320867-85320889 CAGCAGGTACCAAGGCCCTGGGG - Intergenic
1141649937 16:85387422-85387444 CAGCAGATGCAAAGGCCCTGGGG - Intergenic
1141661113 16:85442083-85442105 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
1141703476 16:85652790-85652812 CAGCAGGAATGATGGCCCAGGGG - Intronic
1141714640 16:85719754-85719776 CAGCACACACAAAGGCCCTGAGG + Intronic
1141714651 16:85719801-85719823 CAGCACACACAAAGGCCCTGAGG + Intronic
1141714662 16:85719848-85719870 CAGCACACACAAAGGCCCTGAGG + Intronic
1141838666 16:86559977-86559999 CAGCAGGCCCAAAGGCCATGCGG + Intergenic
1141884251 16:86880910-86880932 CAGCAAGTGCAAAGGCCCTGGGG + Intergenic
1141947228 16:87318919-87318941 CATCAGGAAGAAAGCTGCTGTGG - Intronic
1142233897 16:88912422-88912444 CAGTAGGAGCCAAGGCCCTGAGG - Intronic
1142488768 17:263966-263988 CAGCAGGAAACAAGGGCCTGAGG + Intronic
1142490850 17:278495-278517 CAGCAGGTGCAAAGGCCCCGAGG - Intronic
1142499714 17:325477-325499 CAGCATGTGCAAAGGCCCTGAGG - Intronic
1142742835 17:1940959-1940981 CTGCAGCAAGAGAGGCCTTGCGG + Intronic
1142744675 17:1949935-1949957 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1142850547 17:2702599-2702621 CAACAGGCGGACAGGCCCTGGGG + Intronic
1142877541 17:2861076-2861098 CAGCAGGTGCAAAGGGCCTGTGG - Intronic
1142903503 17:3027497-3027519 CAGCATGTGGAAAGGCCCAGAGG + Intronic
1143108628 17:4541625-4541647 CAGCCGGAAGTAAAGCCCAGAGG + Intronic
1143327159 17:6106883-6106905 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1143337926 17:6187418-6187440 CTGCAGGAGGAGAGGCCCTGTGG - Intergenic
1143563317 17:7707749-7707771 CAGCAGGAAGCCAGGCTCAGGGG - Intronic
1143706206 17:8699141-8699163 CAGGAGGGAGATAGGGCCTGGGG + Intergenic
1143866970 17:9931110-9931132 CTGCTGGAAGAAAAGCTCTGGGG + Intronic
1143900452 17:10170440-10170462 CAGCATGTGCAAAGGCCCTGAGG - Intronic
1144078339 17:11738770-11738792 CAGCACGAAGAACTGTCCTGTGG - Intronic
1144274954 17:13657392-13657414 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
1144578791 17:16446466-16446488 CAGAGGGCACAAAGGCCCTGAGG + Intronic
1144643543 17:16952897-16952919 CAGCAGGTGCAAAGACCCTGTGG - Intronic
1144657326 17:17045100-17045122 CAGCAGGAAGCAGGGGCTTGGGG - Intronic
1144743586 17:17598216-17598238 CAGGAGGTGCAAAGGCCCTGTGG - Intergenic
1144754004 17:17668581-17668603 CAGCAGGTGTAAAGGTCCTGAGG - Intergenic
1144825421 17:18103101-18103123 CAGCAGGAGGAGAGGACCTGAGG - Intronic
1144847648 17:18228344-18228366 CAGTAGGTGCAAAGGCCCTGAGG + Intronic
1144891738 17:18498203-18498225 CAGCAGATACAAAGGCCCGGGGG - Intergenic
1145140484 17:20446114-20446136 CAGCAGATACAAAGGCCCGGGGG + Intergenic
1145205208 17:20981182-20981204 CAGCAGGTGCAAAGACCCTGTGG + Intergenic
1145242246 17:21246853-21246875 CAGCACGTGCAAAGGCCCTGGGG + Intronic
1145255955 17:21322498-21322520 CAGCTGGAAGAAACTCCCTAGGG + Intergenic
1145262709 17:21364397-21364419 CAGCAAGTGCAAAGGCCCTGGGG + Intergenic
1145266400 17:21381537-21381559 CAGCATGTGCAAAGGCCCTGAGG - Intronic
1145795387 17:27652552-27652574 CAGCAGGTACAAAGGCCCCGGGG - Intergenic
1145809821 17:27757883-27757905 CAGCAGGTACAAAGGCCCCGGGG - Intronic
1145941719 17:28746237-28746259 CAGCAGGACTCAGGGCCCTGGGG - Intronic
1145942469 17:28749804-28749826 AAGAAGGGAGACAGGCCCTGGGG - Exonic
1146088034 17:29848437-29848459 CGTGAGGAATAAAGGCCCTGTGG + Intronic
1146512407 17:33461457-33461479 CACCAAGAAGCAGGGCCCTGGGG - Intronic
1146566305 17:33915997-33916019 AAGAAGGAAGAAACACCCTGTGG - Intronic
1146645504 17:34574487-34574509 CAACAGGTACAAAGGCCCTGAGG + Exonic
1146927339 17:36754174-36754196 CAGCCAGCACAAAGGCCCTGAGG + Intergenic
1147055539 17:37831782-37831804 CTGGAGGAAGAAAAGTCCTGAGG + Intergenic
1147320464 17:39642847-39642869 CAGCAGGTGCAAGGGCCCTGGGG + Intronic
1147345237 17:39787950-39787972 CAGCAAGAGCAAAGGCCCTGGGG - Intronic
1147444186 17:40464756-40464778 CAGCACGTGCAAAGGCCCTGAGG - Intergenic
1147586936 17:41658214-41658236 CAGCAGGAGGGTCGGCCCTGGGG + Intergenic
1147853461 17:43460076-43460098 CAGCAGGTACAAAGGCCCTGAGG - Intergenic
1148002547 17:44398281-44398303 CAGCAGTCAGCCAGGCCCTGTGG - Exonic
1148028274 17:44603145-44603167 CAGCAAGTGAAAAGGCCCTGAGG + Intergenic
1148192968 17:45692696-45692718 CAGGAGGAAGATGGACCCTGAGG + Intergenic
1148994450 17:51697379-51697401 GAGCTGGTACAAAGGCCCTGAGG - Intronic
1149280421 17:55098582-55098604 CAGCAAGTGGAAAGGCCCTGAGG + Intronic
1149479059 17:56986876-56986898 CAGCATGTACAAAGACCCTGAGG - Intronic
1149565909 17:57640262-57640284 CAGCAGGAGGCAAGGGCTTGCGG - Intronic
1150035729 17:61794899-61794921 CAGCTAGGAGAAAGGTCCTGAGG + Intronic
1150135066 17:62690926-62690948 CTGCAGGAAAGAAGGCACTGAGG - Intronic
1150140834 17:62727151-62727173 CAGGAGGACGAAGGGCTCTGTGG + Intronic
1150303439 17:64064804-64064826 CAGCCTGAACAAAGGCCCCGGGG + Intronic
1150597973 17:66623880-66623902 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1150898542 17:69241608-69241630 CTGCAAGTACAAAGGCCCTGAGG - Intronic
1151284554 17:73100571-73100593 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
1151339928 17:73464646-73464668 TAGCAGGTGCAAAGGCCCTGAGG - Intronic
1151440726 17:74127145-74127167 CAGCATGTGCAAAGGCCCTGTGG - Intergenic
1151510526 17:74556524-74556546 CAGCAGGTGTTAAGGCCCTGGGG + Intergenic
1151802382 17:76385724-76385746 CAGCTGGACGAAAGGGGCTGTGG + Intronic
1152229307 17:79106567-79106589 CGGCAGGAAGGCAGGGCCTGTGG + Intronic
1152365604 17:79854632-79854654 CAGCAGGTGCCAAGGCCCTGAGG + Intergenic
1152417016 17:80169251-80169273 CAGCAGGTGCAAAGGCCCTGGGG + Intergenic
1152463598 17:80454006-80454028 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
1152679201 17:81656937-81656959 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
1152702482 17:81825891-81825913 CAGCAGGCAGCATGTCCCTGTGG - Exonic
1152703705 17:81832531-81832553 CAGCTTGACCAAAGGCCCTGAGG - Intronic
1153191595 18:2546825-2546847 CAGCAGCACAAAAGGCACTGAGG + Intronic
1153740915 18:8126815-8126837 CAGCAGGTACAAAGGTCCGGTGG + Intronic
1154071593 18:11157377-11157399 CAGGAGTAAGAAAGGGCATGAGG + Intergenic
1155084793 18:22447337-22447359 TAGCATGGATAAAGGCCCTGAGG - Intergenic
1155185228 18:23381847-23381869 CATCAGGAAGCAAAACCCTGTGG + Intronic
1155384533 18:25262865-25262887 CAGGAGGTAGAAAGGGGCTGAGG + Intronic
1155696298 18:28690863-28690885 CATCAGGAAGGAAGGCTCTTTGG + Intergenic
1156192699 18:34738108-34738130 CAGCAGAAGCAAAGGCCCTGAGG + Intronic
1156359500 18:36371924-36371946 CAACAGGAACAAAGGCTTTGAGG - Intronic
1156488711 18:37483700-37483722 TACCAGGCAGAAAGGCCCAGGGG - Intronic
1156498506 18:37541736-37541758 CAGCAGGTGCAAAGGCCCGGAGG - Intronic
1157042922 18:44061239-44061261 CAGGAGGCAGACAGGCTCTGGGG - Intergenic
1157156804 18:45276068-45276090 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1157514275 18:48299738-48299760 CAGCATGTGCAAAGGCCCTGTGG + Intronic
1157801351 18:50623900-50623922 CAGCAAGTGCAAAGGCCCTGGGG - Intronic
1157969525 18:52250206-52250228 TTGCAAGAAGAAAGGCTCTGTGG + Intergenic
1158187304 18:54785066-54785088 GGGCAGGTACAAAGGCCCTGAGG - Intronic
1158220931 18:55149968-55149990 CAACAGGAAGAAAGGTTATGTGG + Intergenic
1158261379 18:55609748-55609770 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1158434757 18:57428056-57428078 TAGCACGGAGAGAGGCCCTGGGG + Intergenic
1158594873 18:58807263-58807285 CAGGAGGCAGAAAGGGCCAGGGG - Intergenic
1158633105 18:59133077-59133099 CAGCAGGAAAAAAGGCAGGGTGG + Intergenic
1158925457 18:62253213-62253235 CAACAAGAACAAAGGCCCTGAGG + Intronic
1160717911 19:584772-584794 CAACAGGCAGAAAGGTCCAGTGG + Intergenic
1160753808 19:747596-747618 CAGGAGGAAGGAGGGCCCAGTGG - Exonic
1161098739 19:2409707-2409729 CAGCATGTGCAAAGGCCCTGGGG + Intronic
1161154632 19:2726320-2726342 CAGCATGTGCAAAGGCCCTGGGG - Intronic
1161162297 19:2768166-2768188 CAGCAGAGAGAGGGGCCCTGTGG - Intronic
1161210591 19:3063238-3063260 CAACAGGTGCAAAGGCCCTGGGG + Intergenic
1161235599 19:3196564-3196586 CAGCCGGTGCAAAGGCCCTGGGG - Intronic
1161239320 19:3213276-3213298 CAGCCGGTGCAAAGGCCCTGGGG + Intergenic
1161256624 19:3313494-3313516 CTGCAGGAAGAACTTCCCTGGGG - Intergenic
1161457603 19:4377320-4377342 CAGCAGGGAGGAGGGCACTGAGG + Intronic
1161499371 19:4605090-4605112 CAGCAGGTGCAAAGGCTCTGGGG + Intergenic
1161515493 19:4693908-4693930 CAGCCCGTACAAAGGCCCTGGGG - Intronic
1161519355 19:4714927-4714949 CAGCATGTGCAAAGGCCCTGCGG - Intronic
1161635308 19:5384970-5384992 CAGCCAGAGCAAAGGCCCTGCGG - Intergenic
1161869122 19:6856948-6856970 GAGCAGGTGCAAAGGCCCTGAGG + Intronic
1161874137 19:6894518-6894540 CAGCATGTGCAAAGGCCCTGTGG + Intronic
1162064914 19:8119438-8119460 CAGCATGTGCAAAGGCCCTGGGG - Intronic
1162080378 19:8214445-8214467 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1162085636 19:8247338-8247360 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1162151214 19:8646903-8646925 CAGGAAGAACACAGGCCCTGAGG + Intergenic
1162152902 19:8658091-8658113 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
1162187051 19:8913959-8913981 CATCAGGAAAGAATGCCCTGAGG + Intronic
1162312609 19:9915902-9915924 CAGCAAGTGCAAAGGCCCTGGGG + Intronic
1162314935 19:9933074-9933096 CAGAAGGTGCAAAGGCCCTGGGG - Intronic
1162342451 19:10099670-10099692 CAGCAGGTACAAAGGACCTGAGG - Intronic
1162360710 19:10218535-10218557 CAGCAGGTGCAAAGGCCCTGGGG + Intronic
1162418156 19:10550643-10550665 CAGCAAGCGCAAAGGCCCTGAGG - Intronic
1162529340 19:11227000-11227022 TAGCAGGTGCAAAGGCCCTGAGG - Intronic
1162536197 19:11263953-11263975 CAGCACGTGCAAAGGCCCTGAGG - Intergenic
1162554784 19:11380052-11380074 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1162832507 19:13294982-13295004 CAGCATGTGCAAAGGCCCTGGGG - Intronic
1162854908 19:13460729-13460751 CAGCAGGTACAAAGGCCCCTGGG - Intronic
1162856502 19:13472578-13472600 CAGCATGTGCAAAGGCCCTGGGG - Intronic
1162857112 19:13477146-13477168 CAGCTGGTGCAAAGGCCCTGAGG - Intronic
1162869706 19:13576212-13576234 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1162971919 19:14185876-14185898 CAACAGGTGCAAAGGCCCTGGGG - Intronic
1163156699 19:15443528-15443550 TAGCAGGTGCAAAGGCCCTGAGG - Intronic
1163173717 19:15550454-15550476 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1163253100 19:16138436-16138458 CAGCACGGGCAAAGGCCCTGTGG - Intronic
1163345797 19:16741267-16741289 CAGCATGTGCAAAGGCCCTGTGG - Intronic
1163438896 19:17311656-17311678 CAGCAGGTGTAAAGGCCCTGGGG - Intronic
1163479189 19:17544593-17544615 CAGCATGTGCAAAGGCCCTGAGG + Intronic
1163484104 19:17576402-17576424 CAGCATGTGCAAAGGCCCTGAGG + Intronic
1163520167 19:17787468-17787490 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1163562115 19:18025625-18025647 CAACACGTAGAAAGGCCCTGAGG - Intergenic
1163576507 19:18113990-18114012 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1163627955 19:18401677-18401699 CAGCATGTGCAAAGGCCCTGTGG + Intergenic
1163703510 19:18798995-18799017 CAGCAGGGGCAAAGGCCCAGAGG + Intergenic
1164107917 19:22125268-22125290 CAGCAGCCAGAAAAGACCTGTGG + Intergenic
1164235410 19:23328410-23328432 CAGCTGGTACAAAAGCCCTGAGG + Intronic
1164658156 19:29939774-29939796 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1164677802 19:30113404-30113426 CAGCAGGGGCAATGGCCCTGCGG - Intergenic
1164700118 19:30279046-30279068 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1164892787 19:31839391-31839413 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
1165013562 19:32865156-32865178 CACCAATAAGAAAGGCCCTCGGG + Intronic
1165141618 19:33703277-33703299 CAGCATGAAGAAGGGCCCGGTGG + Intronic
1165223657 19:34338655-34338677 CAGCAAGAGCAAAGGTCCTGAGG + Intronic
1165309136 19:35020015-35020037 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1165334804 19:35162245-35162267 GAGGAGGAAGAGAGGCCCTGGGG - Intronic
1165391964 19:35543953-35543975 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1165392049 19:35544505-35544527 CTGCAGGAAGGGAGGACCTGAGG - Intronic
1165394346 19:35556202-35556224 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1165475922 19:36030802-36030824 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1165511562 19:36269272-36269294 CAGCAGGAAGAAACCCCAGGAGG + Intergenic
1165512113 19:36271795-36271817 CAGCAGGAAGAAACCCCAGGAGG + Intergenic
1165512661 19:36274294-36274316 CAGCAGGAAGAAACCCCAGGAGG + Intergenic
1165513212 19:36276837-36276859 CAGCAGGAAGAAACCCCAGGAGG + Intergenic
1165513767 19:36279390-36279412 CAGCAGGAAGAAACCCCAGGAGG + Intergenic
1165514316 19:36281924-36281946 CAGCAGGAAGAAACCCCAGGAGG + Intergenic
1165514870 19:36284463-36284485 CAGCAGGAAGAAACCCCAGGAGG + Intergenic
1165515422 19:36286994-36287016 CAGCAGGAAGAAACCCCAGGAGG + Intergenic
1165515972 19:36289532-36289554 CAGCAGGAAGAAACCCCAGGAGG + Intergenic
1165516523 19:36292067-36292089 CAGCAGGAAGAAACCCCAGGAGG + Intergenic
1165517075 19:36294595-36294617 CAGCAGGAAGAAACCCCAGGAGG + Intergenic
1165517627 19:36297118-36297140 CAGCAGGAAGAAACCCCAGGAGG + Intergenic
1165518180 19:36299653-36299675 CAGCAGGAAGAAACCCCAGGAGG + Intergenic
1165518731 19:36302188-36302210 CAGCAGGAAGAAACCCCAGGAGG + Intergenic
1165519279 19:36304718-36304740 CAGCAGGAAGAAACCCCAGGAGG + Intergenic
1165519828 19:36307233-36307255 CAGCAGGAAGAAACCCCAGGAGG + Intergenic
1165520381 19:36309764-36309786 CAGCAGGAAGAAACCCCAGGAGG + Intergenic
1165623692 19:37268819-37268841 CAGCAGGAAGAAACCCCAGGAGG - Intergenic
1165624236 19:37271358-37271380 CAGCAGGAAGAAACCCCAAGAGG - Intergenic
1165624782 19:37273886-37273908 CAGCAGGAAGAAACCCCAGGAGG - Intergenic
1165625320 19:37276424-37276446 CAGCAGGAAGAAACGCCAGGAGG - Intergenic
1165625853 19:37278948-37278970 CAGCAGGAAGAAACCCCAAGAGG - Intergenic
1165626395 19:37281476-37281498 CAGCAGGAAGAAACCCCAGGAGG - Intergenic
1165626937 19:37284001-37284023 CAGCAGGAAGAAACCCCAAGAGG - Intergenic
1165627479 19:37286525-37286547 CAGCAGGAAGAAACCCCAAGAGG - Intergenic
1165628013 19:37289049-37289071 CAGCAGGAAGAAACCCCAGGAGG - Intergenic
1165628556 19:37291575-37291597 CAGCAGGAAGAAACCCCAAGAGG - Intergenic
1165629095 19:37294100-37294122 CAGCAGGAAGAAACCCCAGGAGG - Intergenic
1165629639 19:37296626-37296648 CAGCAGGAAGAAACCCCAAGAGG - Intergenic
1165630181 19:37299153-37299175 CAGCAGGAAGAAACCCCAAGAGG - Intergenic
1165630720 19:37301691-37301713 CAGCAGGAAGAAACGCCAGGAGG - Intergenic
1165701573 19:37942463-37942485 CAGCAGGTGCAAAGGCGCTGAGG + Intronic
1165765195 19:38346212-38346234 CAGGAGAAACAGAGGCCCTGAGG + Intronic
1165895052 19:39136421-39136443 CAGCAAGAACAAAGGCCCCGGGG - Intronic
1165950585 19:39472218-39472240 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1166217006 19:41342327-41342349 AGGCAGGAAGGAAGCCCCTGGGG - Intronic
1166335368 19:42103063-42103085 CGGCATGTATAAAGGCCCTGAGG - Intronic
1166500389 19:43336704-43336726 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
1166509789 19:43397307-43397329 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
1166538361 19:43590281-43590303 CAGCACACAGTAAGGCCCTGTGG - Exonic
1166561704 19:43736943-43736965 CTGCAGGAAGAACAGCCATGAGG + Intronic
1166658424 19:44628965-44628987 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1166671343 19:44711190-44711212 CAGCCACAGGAAAGGCCCTGTGG + Intergenic
1166726787 19:45033331-45033353 CAGCAGGTGCAAAGGTCCTGAGG + Intronic
1166778123 19:45324525-45324547 CAGCAGGTGCAAAGGCGCTGAGG + Intergenic
1166784335 19:45358605-45358627 CAGCAAGTATAAAGGCCCTGGGG - Intronic
1166891568 19:45997175-45997197 CAGCGAGTACAAAGGCCCTGAGG - Intronic
1166929189 19:46291102-46291124 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
1167014968 19:46835196-46835218 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
1167036404 19:46997647-46997669 GAGCAGGGAGGAAGGTCCTGTGG - Intronic
1167041637 19:47026325-47026347 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1167139635 19:47640786-47640808 CAGCAGGTGCAAAGGTCCTGAGG + Intronic
1167154746 19:47731107-47731129 CAGCATGTGCAAAGGCCCTGGGG + Intronic
1167252673 19:48408904-48408926 CAGCAGGTGCAAAGGCTCTGGGG + Intronic
1167284027 19:48588821-48588843 AAGCAGGTGCAAAGGCCCTGAGG + Intronic
1167294562 19:48642052-48642074 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1167308082 19:48720247-48720269 CGGCAGGCAGAAAGGTCCAGAGG + Intergenic
1167324616 19:48816410-48816432 CAGCAAGTTCAAAGGCCCTGAGG - Intronic
1167347789 19:48957094-48957116 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1167504334 19:49863156-49863178 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1167619618 19:50553463-50553485 GAGCAGGTGCAAAGGCCCTGGGG - Intronic
1167640060 19:50676429-50676451 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1167794499 19:51700878-51700900 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
1168237763 19:55074349-55074371 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1168279335 19:55296016-55296038 TCCCAGGCAGAAAGGCCCTGTGG - Intronic
1168335718 19:55596506-55596528 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1168472310 19:56649664-56649686 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1168511180 19:56974696-56974718 CAGCAGGTGCCAAGGCCCTGGGG + Intergenic
925062426 2:903566-903588 CAGAAGGAAGAAGGACCCTTAGG - Intergenic
925127440 2:1469629-1469651 AAGCAGCCAGAAAAGCCCTGTGG - Intronic
925209185 2:2032551-2032573 CCGCAGGATGAGAGGCACTGGGG - Intronic
925613026 2:5719015-5719037 CAGCAGGTGCAAAGGTCCTGGGG + Intergenic
926207468 2:10844268-10844290 CAGCAGGAGCAAAGGCCTGGAGG + Intergenic
926294944 2:11562383-11562405 CAGGCAGAGGAAAGGCCCTGGGG + Intronic
926594912 2:14779548-14779570 TAGCAGGCACAAAGGCACTGGGG - Intergenic
926808573 2:16736049-16736071 CAGCATGCAGGAAGGCACTGGGG - Intergenic
927040077 2:19220472-19220494 CAGCATTAAGAAAGCCACTGAGG + Intergenic
927148461 2:20181915-20181937 CATCAGGAAGACAGGGCCAGGGG + Intergenic
927253394 2:21018508-21018530 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
928021499 2:27708552-27708574 CAGCAGGAACAAAGGCCCCGGGG - Intronic
928318269 2:30262889-30262911 CAGCAAGTGCAAAGGCCCTGGGG + Intronic
928407328 2:31024493-31024515 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
928444222 2:31318860-31318882 CAGAAAGAAGACAGGCGCTGGGG - Intergenic
929596830 2:43181315-43181337 CAGCATGTACAAAAGCCCTGAGG + Intergenic
929855244 2:45632110-45632132 GAGCAGGAAGAGGGCCCCTGCGG + Intergenic
929910949 2:46089170-46089192 GAGGAGGGAGGAAGGCCCTGGGG - Intronic
929919133 2:46160205-46160227 CAGCAGGAAGGATGGTGCTGGGG + Intronic
930092102 2:47538428-47538450 CAGCACGAGCAAAGGCCCTGAGG + Intronic
931196388 2:60055874-60055896 CAGCAGGTGTAAAGGCCCTGAGG + Intergenic
931196402 2:60055995-60056017 CAGAAGGAAGACAGAACCTGTGG + Intergenic
931240538 2:60448402-60448424 AAGCAAAAAGAAAGGCCATGTGG + Intergenic
931458816 2:62433008-62433030 CAGGAGGAAGAAAAGCCTCGTGG - Intergenic
931753122 2:65348128-65348150 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
931787621 2:65634496-65634518 CATCAGAAAGAAAGCCACTGTGG - Intergenic
932311237 2:70743775-70743797 TAGCAGGTACAAAGGTCCTGTGG + Intronic
932319620 2:70812191-70812213 CAGCAGGGAGGAAGGCCAAGGGG - Intronic
932674875 2:73770930-73770952 CAGCAGGTGCAAAGTCCCTGAGG - Intronic
933225703 2:79746684-79746706 CAGCATATATAAAGGCCCTGGGG - Intronic
933656178 2:84888739-84888761 CAGCAGAGACAAAGGCCTTGAGG + Intronic
934467110 2:94273103-94273125 CAGCGGGCAGAAAGGCGCGGCGG + Intergenic
935095726 2:99942617-99942639 GAGCAAGTAGAAAGGTCCTGAGG + Intronic
935121281 2:100185663-100185685 CAGCAAGTGCAAAGGCCCTGGGG + Intergenic
935656964 2:105431504-105431526 CAGCAGGTGCAAATGCCCTGGGG + Intronic
936073590 2:109387495-109387517 CAGCATGTGCAAAGGCCCTGTGG - Intronic
936617393 2:114061902-114061924 CAGCAAGTGCAAAGGCCCTGGGG - Intergenic
936637240 2:114272778-114272800 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
937053006 2:118907633-118907655 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
937072160 2:119072771-119072793 CAGCAGGTGCACAGGCCCTGAGG - Intergenic
937095830 2:119234602-119234624 CAGCATGAAGCAAGGCGCCGGGG - Intronic
937114099 2:119391898-119391920 CTGGAGGAAGGAAGGCCTTGGGG + Intergenic
937225401 2:120366043-120366065 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
937354216 2:121187907-121187929 CTGCAGTCATAAAGGCCCTGGGG - Intergenic
937407692 2:121645875-121645897 AAGCCGGCAGAAAAGCCCTGGGG + Intronic
937572396 2:123380498-123380520 AAGCAGCAAGAAAAGCCCTGTGG + Intergenic
937799042 2:126059852-126059874 CAGCAGCAAGAAGAGCCTTGAGG - Intergenic
937922872 2:127144330-127144352 CAGGAGCCAGGAAGGCCCTGGGG - Intergenic
938377572 2:130818909-130818931 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
938586206 2:132693106-132693128 CAGCAGGAAGAAATCCACTTTGG - Intronic
938680546 2:133685320-133685342 CAGAAGGAAGAAAAGCTTTGTGG - Intergenic
938991555 2:136635087-136635109 CAGCAGCCAGAAAGACCCTAAGG + Intergenic
939219267 2:139281236-139281258 CAGCAGCAGGAAGAGCCCTGTGG + Intergenic
939331341 2:140765623-140765645 CAGAAGAAAAAAAGACCCTGTGG - Intronic
940320290 2:152369749-152369771 CAGCAGTAAGAACAACCCTGAGG - Intronic
940711046 2:157164344-157164366 CACCAGCCAGAAAGGCACTGTGG + Intergenic
940796895 2:158089664-158089686 CAGCAGCGAGAAGAGCCCTGTGG - Intronic
941052126 2:160746886-160746908 CAGCAGGGAGAAAGGGCTTGGGG - Intergenic
941721953 2:168821762-168821784 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
941813304 2:169775535-169775557 CAGTAGGTACAAAGGCCCTGAGG + Intronic
942302305 2:174573649-174573671 CAGCAGGTGCAGAGGCCCTGAGG + Intronic
942752082 2:179299608-179299630 CAGGAAGAACAAAGGCTCTGAGG - Intergenic
944465034 2:199992490-199992512 TAGCAGGCACAAAGGCCCTGAGG + Intronic
944605626 2:201349272-201349294 CAGCAAGTCCAAAGGCCCTGGGG - Intronic
945008242 2:205432518-205432540 CAGCAGATATAAAGCCCCTGAGG - Intronic
945676009 2:212856453-212856475 CAGCAAGTACAAAGGCCCTGAGG - Intergenic
946146585 2:217735585-217735607 CAGCAGGAGCAAAGGCCCTGAGG - Intronic
946166536 2:217867723-217867745 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
946185047 2:217976019-217976041 GAGCAGGTGCAAAGGCCCTGAGG - Intronic
946787127 2:223259184-223259206 TAGCAGGGAGCAAGGCTCTGTGG + Intergenic
946951856 2:224884957-224884979 CAGCAAGTTCAAAGGCCCTGCGG - Intronic
947217315 2:227761019-227761041 CAGTAGGTGCAAAGGCCCTGAGG - Intergenic
947386228 2:229593328-229593350 CAGCAGGTGCAAAGGGCCTGAGG - Intronic
947421155 2:229942574-229942596 CATCAGGTGGGAAGGCCCTGGGG + Intronic
947804348 2:232954880-232954902 CAGCAGGTGCAAAGGGCCTGTGG + Intronic
948005584 2:234605156-234605178 CAGCCCGAACGAAGGCCCTGGGG - Intergenic
948021600 2:234737986-234738008 GAGCAAGCAGAGAGGCCCTGGGG - Intergenic
948176391 2:235946828-235946850 CAGCAGGTGAAAAGGCACTGGGG - Intronic
948424340 2:237877892-237877914 AAGCGGGAAGAAGGGCCCTTGGG - Intronic
948433273 2:237934341-237934363 CTGCAGGTGCAAAGGCCCTGGGG - Intergenic
948486309 2:238283501-238283523 CAGCACACACAAAGGCCCTGCGG + Intronic
948547206 2:238741426-238741448 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
948676468 2:239599965-239599987 CAGCAGCCCGGAAGGCCCTGTGG + Intergenic
948758580 2:240174692-240174714 CAGCATGCACAAAGGCCCTGAGG + Intergenic
1168755890 20:317418-317440 CAGCATGAATGAGGGCCCTGAGG + Intergenic
1168820844 20:772897-772919 CAGCAAGTGAAAAGGCCCTGGGG + Intergenic
1168840712 20:908354-908376 CAGCAAGTGCAAAGGCCCTGGGG - Intronic
1168867978 20:1105333-1105355 CAGCAAGTACAAAAGCCCTGAGG - Intergenic
1168956304 20:1836799-1836821 TAGCGGGAGCAAAGGCCCTGAGG - Intergenic
1168962934 20:1881285-1881307 CAGCAAGCACAAAGGCTCTGAGG - Intergenic
1168969974 20:1924368-1924390 CAGCTGGAAGAAGGGCAGTGCGG - Intronic
1169366562 20:4997369-4997391 CAGCAGATACAAAGGCCCTGAGG - Intronic
1169621527 20:7512433-7512455 AAGCAGGCACAAAGGCCCTGTGG + Intergenic
1169704153 20:8483965-8483987 CAACAGGTCCAAAGGCCCTGAGG - Intronic
1169717158 20:8632704-8632726 CAGCAGGTGCAAAAGCCCTGAGG + Intronic
1169782351 20:9323173-9323195 CAGCAAGTGTAAAGGCCCTGAGG - Intronic
1170079855 20:12462525-12462547 GAGCAGGTGTAAAGGCCCTGAGG + Intergenic
1170147815 20:13196421-13196443 CAGCTGGTACAAAGGCCCTGAGG - Intergenic
1170293484 20:14797495-14797517 CAGCAGGCACAAAGGCGCTGAGG - Intronic
1170456984 20:16542617-16542639 CAGCAGGTGTAAAGGCCCTGAGG + Intronic
1170580334 20:17694392-17694414 CAGCATGTGCAAAGGCCCTGAGG + Intronic
1170733251 20:18991864-18991886 CAGCAAGCACAAAGGTCCTGAGG - Intergenic
1170846849 20:19969378-19969400 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
1171100537 20:22379625-22379647 CTGGAGGATGAGAGGCCCTGGGG - Intergenic
1171219567 20:23382697-23382719 CAGCAGGATGAAAGGGACAGAGG + Intronic
1171504488 20:25622891-25622913 CAGCAGGAAGAATAGCCCAAAGG + Intronic
1171933892 20:31255400-31255422 CAGCAAGAGCAAAGCCCCTGAGG - Intergenic
1172027951 20:31962305-31962327 CAGCAGGAACAAAAGCCCCATGG + Intergenic
1172033075 20:31995309-31995331 AAGCAGGGAGAAAGGCCCGGTGG - Intronic
1172067687 20:32233374-32233396 CAGCACGCACAAAGGTCCTGAGG + Intronic
1172250997 20:33479110-33479132 TAGCAGGAACAAAGGCCCGGAGG - Intergenic
1172283010 20:33721177-33721199 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
1172288521 20:33758318-33758340 CAGCAGGTGCAAAGGCCCGGAGG + Intronic
1172292825 20:33788575-33788597 AAGCAGGTACAAAGGCCCTGAGG - Intronic
1172325406 20:34030813-34030835 TAGCAAGTACAAAGGCCCTGAGG - Intronic
1172503568 20:35444417-35444439 CAGCAGTTGCAAAGGCCCTGAGG + Intronic
1172582006 20:36055718-36055740 CAGCATGTGGAAAGGCCCTGAGG - Intergenic
1172604547 20:36205927-36205949 CAGCAGGAAGAAAGGCAGGCAGG + Intronic
1172626329 20:36349559-36349581 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1172739944 20:37158442-37158464 GAGCAGGATCAAGGGCCCTGTGG - Intronic
1172767333 20:37357870-37357892 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1172798589 20:37560427-37560449 CAGCAGTTGCAAAGGCCCTGAGG - Intergenic
1172807230 20:37621067-37621089 CAGCATGAACAAAGGTACTGAGG + Intergenic
1172807416 20:37622453-37622475 CAGCATGAGCAAAGGTCCTGAGG + Intergenic
1172809930 20:37640177-37640199 CAGCTGGCACAAAGGCCCTGGGG + Intergenic
1172890157 20:38258672-38258694 CAGCATGTGCAAAGGCCCTGGGG + Intronic
1172900623 20:38332024-38332046 CAGCAGGGGCAAAAGCCCTGTGG + Intronic
1172957159 20:38769144-38769166 CAGCATGTACAAAGGCCCTGAGG - Intronic
1173000608 20:39102679-39102701 CAGGAGGCAGCAAGGCCCTGAGG + Intergenic
1173178143 20:40780773-40780795 CAGCAAGTCCAAAGGCCCTGAGG + Intergenic
1173221242 20:41134705-41134727 CAGCATGTACAAAGGCCCTGAGG - Intergenic
1173441206 20:43077842-43077864 CAGCATGAGCAAAGGTCCTGAGG - Intronic
1173598467 20:44275548-44275570 CAGCAGAGACAAAGGCCCGGAGG + Intronic
1173846369 20:46191293-46191315 CAGCACGTGCAAAGGCCCTGGGG + Intronic
1173849070 20:46206546-46206568 CAGCAAGCAGAATGGCCCTGAGG - Intronic
1173850367 20:46214121-46214143 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1173856954 20:46256474-46256496 CAGCAGGTGCAAAGTCCCTGAGG + Intronic
1173857937 20:46262879-46262901 GAGCAGGAGCAAAGGCCCAGAGG - Intronic
1173902584 20:46601775-46601797 GAGCAGGTGCAAAGGCCCTGGGG + Intronic
1173919082 20:46730557-46730579 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1173919434 20:46732895-46732917 CAGCAAGAGCAAAGGCCCGGAGG + Intronic
1173943907 20:46934771-46934793 CAGCATGAGCAAAGGCCCAGAGG + Intronic
1173949395 20:46978469-46978491 CAGCATGTACAAAGGCCCTGTGG + Intronic
1173951097 20:46993898-46993920 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1173968135 20:47129457-47129479 CAGCATGTGCAAAGGCCCTGAGG + Intronic
1173980754 20:47222130-47222152 TAGAAGGAAGAAAGTCTCTGGGG - Intronic
1174043254 20:47714822-47714844 CAGCAAGGGCAAAGGCCCTGGGG - Intronic
1174087375 20:48018766-48018788 CAGCAGGTGCACAGGCCCTGGGG - Intergenic
1174090075 20:48039691-48039713 CAGCAAGTGCAAAGGCCCTGGGG + Intergenic
1174102833 20:48140160-48140182 TAGCAGGTGCAAAGGCCCTGAGG - Intergenic
1174126317 20:48309498-48309520 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
1174128913 20:48328204-48328226 CAGCAGGTGCACAGGCCCTGGGG + Intergenic
1174163200 20:48566171-48566193 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
1174163349 20:48567346-48567368 CAGCAAGTGCAAAGGCCCTGGGG - Intergenic
1174165983 20:48583918-48583940 AAGCAGGCGCAAAGGCCCTGGGG + Intergenic
1174170650 20:48616216-48616238 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
1174178349 20:48658884-48658906 CAGCACGTACAAAGGTCCTGAGG + Intronic
1174181669 20:48679006-48679028 CAGCAGGCACAAAGGCCCTAAGG + Intronic
1174188131 20:48721484-48721506 GAGCAGGTGCAAAGGCCCTGAGG + Intronic
1174193469 20:48756681-48756703 CAGCAAGTACAAAGGCCCCGGGG - Intronic
1174200667 20:48804480-48804502 CAGCATGTGCAAAGGCCCTGAGG + Intronic
1174201372 20:48808816-48808838 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1174202859 20:48819327-48819349 CAGCAGATGCAAAGGCCCTGAGG - Intronic
1174271211 20:49370254-49370276 CAGAAGGCAGAAAGGGCCTTTGG + Exonic
1174278358 20:49419989-49420011 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1174292713 20:49520164-49520186 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1174293011 20:49522189-49522211 CAGCAAGTGCAAAGGCCCTGGGG - Intronic
1174295702 20:49543595-49543617 CAGCAGGTGCAAAGGCCCAGAGG - Intronic
1174307212 20:49621713-49621735 CAACAAGAGCAAAGGCCCTGCGG - Intergenic
1174317624 20:49714582-49714604 CAGCAGGTGTAAAGGCCCTGAGG + Intergenic
1174375408 20:50123581-50123603 CAGCAAGTACACAGGCCCTGAGG - Intronic
1174385371 20:50185657-50185679 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
1174404397 20:50294194-50294216 CAGCACGTGCAAAGGCCCTGAGG + Intergenic
1174416958 20:50373811-50373833 CAGCAAGTACAAAGGTCCTGAGG + Intergenic
1174423080 20:50413175-50413197 CAGCCGGCACAAAGGCCCTGAGG + Intergenic
1174428285 20:50448848-50448870 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
1174478025 20:50811059-50811081 CAGCAGGTGCAAAGGCCCTGCGG + Intronic
1174503024 20:50999537-50999559 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
1174514824 20:51083643-51083665 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
1174545035 20:51318766-51318788 CCGCACAAACAAAGGCCCTGGGG + Intergenic
1174557622 20:51407067-51407089 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
1174577685 20:51548191-51548213 CAGTAAGTACAAAGGCCCTGGGG - Intronic
1174582394 20:51581185-51581207 CAGCAGGACCAAAGGCACAGAGG - Intergenic
1174749980 20:53102260-53102282 CTGCAGGAAAAAAGTGCCTGGGG + Intronic
1174756814 20:53167082-53167104 CAGCAGGTACAAAGGTCCTGGGG + Intronic
1174768900 20:53279907-53279929 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1174786824 20:53440867-53440889 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1174945838 20:54984269-54984291 CAGCAGAAGCAAAGGTCCTGGGG - Intergenic
1175045389 20:56100133-56100155 CAGCAAGCACCAAGGCCCTGGGG + Intergenic
1175200729 20:57275516-57275538 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
1175314592 20:58038604-58038626 CTGCAGGTGCAAAGGCCCTGGGG - Intergenic
1175417419 20:58811021-58811043 CAGCATGTGCAAAGGCCCTGGGG - Intergenic
1175540278 20:59743801-59743823 CAGGAAGAAGAGAGGCCCAGAGG - Intronic
1175619410 20:60430820-60430842 CAGCAAGTGCAAAGGCCCTGTGG - Intergenic
1175858105 20:62133570-62133592 CAGGAAGAAGAGAGGCCCAGAGG + Intronic
1176269465 20:64228294-64228316 CTGCAGGTTGCAAGGCCCTGGGG - Intronic
1176705755 21:10119313-10119335 CAGCAGGAAGAAACCCCAGGAGG - Intergenic
1177606250 21:23381309-23381331 CAGCAGGAAAACACTCCCTGTGG + Intergenic
1178889434 21:36508991-36509013 CAGCAGGAAGAAAGGGCCAGCGG - Intronic
1179120824 21:38544158-38544180 CAGCAAGTGCAAAGGCCCTGGGG + Intronic
1179156165 21:38852902-38852924 CAGCAAGTGCAAAGGCCCTGGGG - Intergenic
1179236144 21:39548142-39548164 CAGCAGGGACAAAGGCTCAGAGG - Intergenic
1179322051 21:40301426-40301448 CAGCAGCAAGAATGGTCTTGGGG - Intronic
1179482179 21:41685450-41685472 CAGCAGGGTGACAGGCGCTGGGG - Intergenic
1180184263 21:46131685-46131707 CAGCAGGTGGACAGGGCCTGGGG + Intronic
1180230956 21:46426570-46426592 TGGCAGGAGGAGAGGCCCTGGGG - Intronic
1180907700 22:19426406-19426428 CATCAGGAGAAAAGGCCCAGAGG - Intronic
1181102429 22:20550346-20550368 CATGAAGAAGAAAGGCCCAGGGG - Intronic
1181394990 22:22614879-22614901 CAGCAGGGAGAAAAACCCTCAGG - Intergenic
1181461394 22:23088254-23088276 CAGCAGGAGGAAACGCACTGGGG - Intronic
1181485412 22:23227876-23227898 CTGCAGGAAAAAGAGCCCTGGGG - Intronic
1181530318 22:23513618-23513640 CAGCAGAAGCAAAGGCCCAGTGG + Intergenic
1181744198 22:24944460-24944482 GAGCAGGTGCAAAGGCCCTGAGG + Intronic
1181786468 22:25230947-25230969 CAGCATGTGCAAAGGCCCTGTGG + Intronic
1181811711 22:25407088-25407110 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
1181818638 22:25458773-25458795 CAGCATGTGCAAAGGCCCTGTGG + Intergenic
1181821474 22:25479056-25479078 GAGAAGGAATTAAGGCCCTGTGG + Intergenic
1181971722 22:26695666-26695688 CAGCAGGAGCAAAGGCCCTGAGG + Intergenic
1181972068 22:26698374-26698396 CAGCATGTGCAAAGGCCCTGTGG - Intergenic
1181978236 22:26747717-26747739 CAGCAGGTGCAAAGGCTCTGAGG + Intergenic
1182012392 22:27011742-27011764 CAGCATGTTCAAAGGCCCTGAGG - Intergenic
1182022075 22:27089836-27089858 CAGCAGGTGCAAAGGGCCTGAGG + Intergenic
1182042672 22:27250585-27250607 CAGCCAGTACAAAGGCCCTGGGG + Intergenic
1182051573 22:27316382-27316404 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
1182053003 22:27327649-27327671 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
1182062573 22:27408275-27408297 CAGCATGTACAAAGGCCCTGTGG - Intergenic
1182112870 22:27735675-27735697 CAGCATGTACAAAGCCCCTGTGG - Intergenic
1182285801 22:29246150-29246172 CAACAGGTGCAAAGGCCCTGTGG + Intronic
1182334629 22:29575564-29575586 GAGCAGGAAGAGAGGGCTTGGGG - Intronic
1182698179 22:32210182-32210204 CTGCAGAAAGAAAGTCCCTGTGG + Intergenic
1182738476 22:32548207-32548229 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1182742267 22:32576711-32576733 AGGCAGGAAGCAAGGCCGTGAGG - Intronic
1182791074 22:32953560-32953582 CAGCAGGTGCAAAGACCCTGAGG + Intronic
1182804279 22:33057649-33057671 CAGCATGAAGAATGGCCTTTGGG - Intronic
1183098935 22:35571386-35571408 AAGCAGGTACCAAGGCCCTGTGG - Intergenic
1183251369 22:36732734-36732756 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
1183254799 22:36755514-36755536 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
1183317423 22:37144333-37144355 TAGCAGGTGCAAAGGCCCTGGGG - Intronic
1183334868 22:37240843-37240865 CAGCTTGAGCAAAGGCCCTGGGG + Intronic
1183344266 22:37298557-37298579 TAGCAAGTAAAAAGGCCCTGGGG + Intronic
1183384104 22:37505113-37505135 CAGCATGTGCAAAGGCCCTGAGG + Intronic
1183502092 22:38186678-38186700 GAGCAAGAACAAAGGCCCTGAGG + Intronic
1183565617 22:38612411-38612433 CAGCATGTGCAAAGGCCCTGAGG - Intronic
1183669546 22:39264451-39264473 CAGCAGGTGCAAAGGCCCTGTGG + Intergenic
1183687464 22:39369469-39369491 CAGCAGGGAGGAAGGCCGGGAGG - Intronic
1183691896 22:39394892-39394914 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
1184098738 22:42330394-42330416 CAGCGTGTACAAAGGCCCTGAGG - Intronic
1184099084 22:42332273-42332295 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1184104872 22:42361708-42361730 CAGCACGTGCAAAGGCCCTGGGG + Intergenic
1184234365 22:43175105-43175127 CAGCAGGGAGGAAAGCCCTCAGG + Intronic
1184381410 22:44147064-44147086 CAGCAGGAGCAAAGGCTCTGAGG + Intronic
1184406246 22:44302613-44302635 TAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406260 22:44302653-44302675 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406274 22:44302693-44302715 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406288 22:44302733-44302755 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406302 22:44302773-44302795 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406316 22:44302813-44302835 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406330 22:44302853-44302875 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406344 22:44302893-44302915 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406356 22:44302933-44302955 CAGCAGGGGCAAAGACCCTGGGG + Intronic
1184407513 22:44308455-44308477 CAGCATGAGTAAAGGCCCAGAGG - Intronic
1184449854 22:44576428-44576450 CAGCAGGTGCCAAGGCCCTGAGG + Intergenic
1184539095 22:45107878-45107900 CAGCAGGTGCAAAGGCCCTGGGG - Intergenic
1184742433 22:46436789-46436811 CAGCTGGTGCAAAGGCCCTGGGG - Intronic
1184855018 22:47142120-47142142 CAGTAGGAAGATGGGACCTGTGG + Intronic
1184901232 22:47447858-47447880 CAGCAGGTGCAAAGGCCCTGTGG + Intergenic
1185206168 22:49540393-49540415 CAGCAGGAAGGAAGGCACCCGGG - Intronic
1185281064 22:49970119-49970141 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
949478750 3:4473131-4473153 CAGCAAGTACAAAGACCCTGAGG - Intergenic
949529043 3:4935534-4935556 CAGCAGGAGCAAAGGCCCAGAGG - Intergenic
949532083 3:4966105-4966127 CAGCAGTGAGCAAGGCTCTGTGG - Intergenic
949757250 3:7426446-7426468 CAGCATATACAAAGGCCCTGTGG - Intronic
949783030 3:7711343-7711365 CAGCAAGTTCAAAGGCCCTGAGG + Intronic
949787953 3:7762249-7762271 CAGCAGAAGGAAAGGGCGTGGGG - Intergenic
949830376 3:8208132-8208154 CAGCATGCACATAGGCCCTGGGG - Intergenic
949879469 3:8650035-8650057 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
949955846 3:9268033-9268055 CAACAGGAAGCAAGGACCCGAGG + Intronic
949995891 3:9616927-9616949 ACGCAGGAGAAAAGGCCCTGAGG - Intergenic
950109936 3:10412496-10412518 CAGCAGGAGCAAAGGCCTGGGGG - Intronic
950196325 3:11011526-11011548 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
950221421 3:11199376-11199398 CAGCATGCGAAAAGGCCCTGAGG - Intronic
950377083 3:12580757-12580779 CAGCATAAAGAAAAGCCCTCTGG - Intronic
950428718 3:12938743-12938765 CAGCAGGTGAGAAGGCCCTGCGG - Intronic
950454872 3:13086674-13086696 CAGCAGATGCAAAGGCCCTGAGG - Intergenic
950469364 3:13174925-13174947 CAGCAGGAGCCAGGGCCCTGCGG - Intergenic
950478439 3:13228766-13228788 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
950525893 3:13523035-13523057 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
950566195 3:13771078-13771100 CAGCAGGGGCAAAGGCCCTGAGG - Intergenic
950576397 3:13834624-13834646 CAGCAGGTGCAAAGGCCCAGAGG - Intronic
950642778 3:14359262-14359284 CAGCAGATAGAAAGGCACAGTGG + Intergenic
950681174 3:14586092-14586114 CCACAGGAGCAAAGGCCCTGGGG - Intergenic
950682872 3:14597106-14597128 CAGCAAGTGCAAAGGCCCTGGGG + Intergenic
950723311 3:14899912-14899934 CAGCAAGTACAAAGGCCCTGGGG + Intronic
951188938 3:19746991-19747013 CAGCATGTACAAAGGTCCTGAGG + Intergenic
951463633 3:22977952-22977974 CAGCAGGAGCTAAGGCCCAGTGG - Intergenic
951747846 3:25999190-25999212 TAGCAGTAAGCAAGGCTCTGTGG + Intergenic
952206256 3:31183914-31183936 CTCCAGGAATAAAGGCCCAGTGG + Intergenic
952258152 3:31713310-31713332 GAGCAGGTGCAAAGGCCCTGAGG - Intronic
952834095 3:37589687-37589709 CAGCCGGTGCAAAGGCCCTGAGG + Intronic
953168695 3:40488099-40488121 CAGCAGGAAGAAAGGCACAGAGG - Exonic
953409579 3:42682883-42682905 CAGCTGGAGCAAAGGTCCTGAGG - Intergenic
953691147 3:45120767-45120789 CAGCATGTGCAAAGGCCCTGAGG - Intronic
953718433 3:45335336-45335358 GAGCAGGAGCAAAGGCCCTGAGG + Intergenic
953923449 3:46967717-46967739 CAGCTGTATGACAGGCCCTGGGG - Intronic
954158502 3:48702336-48702358 TAGCAAGTACAAAGGCCCTGAGG - Intronic
954317452 3:49808880-49808902 CAGAAGGAAGATAGGGCCTAGGG - Intronic
954413871 3:50383437-50383459 CAGCAGGATTGAAGGCACTGAGG - Intronic
954621434 3:51998259-51998281 CTGCAGGAATAAAGTCCCTGTGG + Intergenic
954632986 3:52056852-52056874 CTGCGGGAAGAGAGGCCCTGGGG + Intergenic
954635628 3:52069333-52069355 CAGCAGGTGCAAAGGCCCTGGGG + Intergenic
954799568 3:53179380-53179402 CAGCAGGAACAAAGGCCTGGAGG + Intronic
954852695 3:53617003-53617025 CATCTGGAAGCAAGGCCCAGAGG - Intronic
954881093 3:53836417-53836439 CAGCATGTGCAAAGGCCCTGGGG - Intronic
955052153 3:55423374-55423396 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
955226291 3:57063148-57063170 TAGCAGGTGCAAAGGCCCTGAGG + Intronic
955241931 3:57186004-57186026 CAACAAGTACAAAGGCCCTGAGG - Intergenic
955361661 3:58281361-58281383 TAGCAGGGAGCAAGGCTCTGTGG + Intronic
955940173 3:64139802-64139824 CAGCATGTGTAAAGGCCCTGTGG - Intronic
955953075 3:64261678-64261700 CAGCAAGCACAAAGGCCCAGAGG + Intronic
956403632 3:68905684-68905706 CAGCATGTTCAAAGGCCCTGAGG + Intronic
956687589 3:71844575-71844597 CAGCATGTACTAAGGCCCTGGGG - Intergenic
956750853 3:72342717-72342739 CAGCACACACAAAGGCCCTGAGG - Intergenic
956751235 3:72345595-72345617 CAGCATGCACAAAGGCCCTGAGG - Intergenic
956762422 3:72455763-72455785 GAACAGGCAGAAAGGCCCTGAGG - Intergenic
957125180 3:76150567-76150589 CAGCAACTATAAAGGCCCTGAGG - Intronic
958957827 3:100480336-100480358 TAGCAGTAAGCAAGGCTCTGTGG + Intergenic
959689156 3:109179886-109179908 AAGACGGAAGAAAGGACCTGAGG - Intergenic
959715829 3:109431623-109431645 CAGCAGCAGGAAAAGCCCTGTGG - Intergenic
960035057 3:113093982-113094004 CAGCAAGAGCAAAGGTCCTGAGG + Intergenic
960085222 3:113583342-113583364 TAGAAGGGAGAAAGTCCCTGGGG - Intronic
960155976 3:114297577-114297599 CATCAGGCAGAAGGCCCCTGTGG + Intronic
960300496 3:115997600-115997622 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
960592101 3:119376533-119376555 CAGCAGGTACAAAGGCTTTGGGG - Intronic
960592213 3:119377473-119377495 CAGCAGGTACAAAGGCTTTGGGG + Intronic
960610625 3:119551929-119551951 CAGCAGTCAGAAAGGGCCAGAGG + Intronic
960722314 3:120636771-120636793 CATCAGGAATGAAGGCCCTTAGG - Intronic
961002293 3:123382109-123382131 CAGCCAGATCAAAGGCCCTGGGG - Intronic
961114427 3:124316543-124316565 CAGCAGGGGCAAAGGCCGTGAGG - Intronic
961150004 3:124629565-124629587 CAGCAGGAACAAAAGCACAGAGG - Intronic
961156798 3:124686523-124686545 GAGCATGAACAAAAGCCCTGAGG + Intronic
961370369 3:126424908-126424930 CAGCAGGTGCAAAGGCACTGAGG + Intronic
961456489 3:127027204-127027226 CAGCAGTTGCAAAGGCCCTGAGG + Intronic
961517329 3:127446086-127446108 CAGCAGGATGCAAGGCCCTGAGG + Intergenic
961533055 3:127551598-127551620 CAGCAAGGGCAAAGGCCCTGGGG - Intergenic
961552067 3:127675095-127675117 CTGCAGGTGCAAAGGCCCTGGGG - Intronic
961675914 3:128566587-128566609 CAGAAGGAAGAAAGGACCAGGGG - Intergenic
961744754 3:129057402-129057424 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
961786262 3:129348884-129348906 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
961864599 3:129944587-129944609 CAGCAAGTACGAAGGCCCTGAGG + Intergenic
961905504 3:130258899-130258921 CAGCATGTACAAAGGCCCAGAGG - Intergenic
961934031 3:130564229-130564251 CAGCAGGAAGCAAGGCAGTCTGG - Intronic
961978175 3:131048457-131048479 CAGCAGCAGGAAGAGCCCTGTGG - Intronic
962099143 3:132323644-132323666 CATCAAGAGCAAAGGCCCTGAGG + Intronic
962418714 3:135208103-135208125 CAGCATATACAAAGGCCCTGTGG + Intronic
962448569 3:135492116-135492138 CTGCAGGAGCAAAGGCCCTAAGG + Intergenic
962649727 3:137476337-137476359 CAGCCAGTACAAAGGCCCTGAGG - Intergenic
963043425 3:141085384-141085406 CAGCAGGCAGAAGGAGCCTGGGG - Intronic
963044192 3:141090575-141090597 CAGCATGTACAAAGGCTCTGTGG + Intronic
963045902 3:141102564-141102586 CAGCATGTGCAAAGGCCCTGTGG + Intronic
963136432 3:141909577-141909599 CAGTAGGTGCAAAGGCCCTGAGG + Intronic
963265278 3:143233991-143234013 CAGCATGTAAAAAGGCCCTGAGG - Intergenic
963314613 3:143745967-143745989 CTACAGGAGTAAAGGCCCTGAGG + Intronic
964122151 3:153196208-153196230 CAGCAACAGAAAAGGCCCTGAGG + Intergenic
964158123 3:153611773-153611795 CAGCACGTAGGAAGGCCTTGAGG - Intergenic
964159681 3:153632014-153632036 CAGCAGGTAGAGAGGACCAGTGG + Intergenic
964323869 3:155525974-155525996 CAGCAGGGGGTAAGGCCCAGGGG + Intronic
964724176 3:159796881-159796903 CATCGGGAAGAAAGACACTGTGG - Intronic
964764983 3:160170934-160170956 CAGCATGTGCAAAGGCCCTGGGG + Intergenic
964769580 3:160210376-160210398 CAGCCAGAACAAAGGCCCCGAGG - Intergenic
964806401 3:160614346-160614368 AAGCAGGAACAAAAGCCCAGAGG - Intergenic
965619561 3:170629354-170629376 CAGCAGGAGCAAAGGCTCTGAGG + Intronic
966005561 3:175007509-175007531 CATCAGAAAGAAGGCCCCTGGGG + Intronic
966077873 3:175960593-175960615 CAGAAGGACAAAAAGCCCTGGGG - Intergenic
966306016 3:178535621-178535643 TAGCAGGAAGAAAGGAAATGCGG + Intronic
966837754 3:184062059-184062081 TAGCTGCAAGAAAGACCCTGAGG + Intergenic
966938286 3:184729035-184729057 TTCCAGGTAGAAAGGCCCTGCGG - Intergenic
967730985 3:192906485-192906507 CAGCAGGTGTAAAGGCCCTGAGG - Intronic
967907035 3:194509967-194509989 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
967968724 3:194984125-194984147 CAGCAGGGCGACAGGCCCAGTGG - Intergenic
968120356 3:196121540-196121562 CAGCAGGCAGGAGGGCCATGGGG + Intergenic
968120854 3:196124851-196124873 AAGAAGGAAGAAAGGCAGTGGGG + Intergenic
968878855 4:3288400-3288422 CACCAGGAAGCCAGGCCCAGAGG - Intergenic
968935352 4:3607419-3607441 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
969117051 4:4877149-4877171 CAGCAAGTTCAAAGGCCCTGCGG - Intergenic
969255256 4:5996833-5996855 CAGCAGCCAGCAAGGCCCTCTGG - Intergenic
969307691 4:6335268-6335290 CAGCAGGCAGATAGGTGCTGGGG + Intronic
969317794 4:6392554-6392576 CAGCACGAGCAAAGGCCCTGAGG + Intronic
969337369 4:6519536-6519558 CAGCAGATGCAAAGGCCCTGTGG - Intronic
969363501 4:6680545-6680567 CAGCATGGGCAAAGGCCCTGGGG - Intergenic
969465869 4:7356044-7356066 CAGCTGGTGCAAAGGCCCTGGGG - Intronic
969511146 4:7618609-7618631 CAGCATGCACAAAGGTCCTGAGG - Intronic
969566832 4:7983718-7983740 CTGCAGGCAGAGGGGCCCTGAGG + Intronic
969568242 4:7992761-7992783 CAGCAGGAGGAGAGGCCCCGGGG - Intronic
969684930 4:8666140-8666162 CAGCAGGCAGAAGGGACCAGAGG - Intergenic
969688574 4:8690661-8690683 CAGAAGCAGCAAAGGCCCTGGGG + Intergenic
969857567 4:10012720-10012742 CAGCACGCACAAAGGCTCTGAGG + Intronic
969863020 4:10052489-10052511 AAGCAAGAGCAAAGGCCCTGAGG - Intronic
969912739 4:10460542-10460564 GAGCATGTACAAAGGCCCTGAGG + Intergenic
970078646 4:12254322-12254344 CAGCAGAAAGAAAGGTCTTGAGG + Intergenic
970850276 4:20594624-20594646 CTGCATGAAGAAAGGCAGTGTGG - Intronic
971170070 4:24224941-24224963 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
971236901 4:24850495-24850517 CAGCAGGCACAAAGGTCCTGTGG + Intronic
971260773 4:25054724-25054746 CAGAAGGCAGAAAGGCCCTGGGG + Intergenic
971423092 4:26491634-26491656 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
972018003 4:34270731-34270753 CATCAAAAAGTAAGGCCCTGTGG + Intergenic
972615718 4:40696048-40696070 CAGGAAGAAGAAAGGATCTGGGG - Intergenic
973266482 4:48216131-48216153 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
973278164 4:48332153-48332175 GAGCAAGTACAAAGGCCCTGAGG - Intergenic
973738601 4:53897733-53897755 CAGTAGGAAAAAAGCCCCAGCGG + Intronic
973739349 4:53904103-53904125 CAGCAGGTATAAAGGTCCTGAGG - Intronic
973791731 4:54384510-54384532 CAGTATGTAGAAAGGTCCTGGGG + Intergenic
973855397 4:55006067-55006089 CAGCCTGAGCAAAGGCCCTGAGG + Intergenic
974107317 4:57485107-57485129 AGGCATGAAGAAAGGCTCTGGGG - Intergenic
975173294 4:71258225-71258247 TTGCATGAACAAAGGCCCTGAGG - Intronic
975230480 4:71926880-71926902 CAGCATGAATAAAGGCTCTGGGG - Intergenic
975496446 4:75040828-75040850 CAGCAAGTACAGAGGCCCTGAGG - Intronic
975762223 4:77631568-77631590 CAGCAGGCACAAAGTCCATGGGG + Intergenic
976106163 4:81620005-81620027 TAGCAAGAAGAAAGGCCCTAAGG + Intronic
976201725 4:82585838-82585860 TAGCAAGAAGAAGGTCCCTGTGG + Intergenic
976356399 4:84122671-84122693 CCGCAGGAGGAGAGGCCCTGAGG - Intergenic
977151487 4:93518817-93518839 CAGCCAGTACAAAGGCCCTGAGG + Intronic
977546458 4:98387577-98387599 GAAGAGGAAGAAAGGCACTGAGG - Intronic
977874457 4:102132078-102132100 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
977950863 4:102968911-102968933 TAGCAGTAAGCAAGGCTCTGTGG - Intronic
978151702 4:105443810-105443832 CAGCAAGTATAAAGGTCCTGAGG - Intronic
978399367 4:108314511-108314533 CAGCCTGTACAAAGGCCCTGAGG - Intergenic
978581589 4:110236945-110236967 GTCCAGGAAGAAGGGCCCTGTGG - Intergenic
978937770 4:114399223-114399245 CAGCAGGAGCAAACTCCCTGCGG + Intergenic
979510699 4:121550445-121550467 TAGCAGTAAGCAAGGCTCTGTGG + Intergenic
979781240 4:124653545-124653567 ATGCAGAAAGAAAGGGCCTGGGG - Intergenic
980028294 4:127792912-127792934 CAGCATTTACAAAGGCCCTGAGG + Intronic
980354624 4:131725233-131725255 CAGCAGTAAGAAACGCCAGGAGG + Intergenic
980355154 4:131727739-131727761 CAGCAGGAAGAAACGCCAGAAGG + Intergenic
980355704 4:131730223-131730245 CAGCAGGAAGAAACGCCAGGAGG + Intergenic
980378016 4:131975995-131976017 CAGCAGGAAGAAACGCCAGGAGG - Intergenic
980378550 4:131978469-131978491 CAGCAGGAAGAAACCCCTGGAGG - Intergenic
980492878 4:133552470-133552492 CAGCAGGAAAAAATTCCATGTGG + Intergenic
980498754 4:133620184-133620206 CAGCAGTAAGAAAGGCTCATGGG - Intergenic
980869444 4:138594291-138594313 CAACAGGAAGACATGGCCTGTGG - Intergenic
981066887 4:140495163-140495185 AAGCAAGTACAAAGGCCCTGCGG - Intronic
981199680 4:141966058-141966080 TAGCAGCAAGCAAGGCTCTGTGG - Intergenic
981366904 4:143914427-143914449 AAGCAGGGCGTAAGGCCCTGTGG + Intergenic
981653032 4:147080370-147080392 AAGCAGGAAGAAGGGCACAGAGG - Intergenic
982358022 4:154490687-154490709 CAACTGGAAGAACGGGCCTGCGG + Intronic
982495913 4:156091979-156092001 CAGCAGATACAAAGGTCCTGTGG + Intergenic
982842076 4:160201866-160201888 CAACAAGAACAAAGGCCCAGAGG - Intergenic
983163464 4:164446753-164446775 CAGCAGGATGAAACCCTCTGTGG + Intergenic
983636726 4:169905362-169905384 CAGGAGGCAGAAAGGGCATGAGG - Intergenic
983960925 4:173752865-173752887 AAGCAGGAAGAAAGGGTTTGGGG + Intergenic
984018131 4:174450440-174450462 CAGCAAGAAGAGAGGCCTTCTGG - Intergenic
984844542 4:184098471-184098493 CAGAAGGAAGAAAGGCAGGGTGG - Intronic
985236464 4:187880705-187880727 CAGCAGCCAGCAAGGGCCTGAGG - Intergenic
985641540 5:1065584-1065606 CAGCAGGAGGGAAGGCCCGAAGG + Intronic
985679172 5:1246955-1246977 CGGCAGGAAGCCAGGACCTGCGG - Intergenic
985953880 5:3246426-3246448 CAGCAGGCAGAAAGTCAGTGAGG - Intergenic
986211465 5:5676957-5676979 CAGCAAGGACAAAGGCCTTGAGG + Intergenic
986330000 5:6711084-6711106 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
986685847 5:10274555-10274577 CACCAAGAAGCAAGACCCTGAGG - Intergenic
986688411 5:10294068-10294090 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
987039890 5:14052570-14052592 CAGCAAGGGCAAAGGCCCTGAGG + Intergenic
987236747 5:15950398-15950420 CAGCAAAAACAAAGGCCTTGAGG + Intergenic
987317041 5:16733551-16733573 CAGAAGGAAGGAAGGCCTGGTGG + Intronic
987320445 5:16764300-16764322 CAGCAGGATCAAAGGCAATGAGG - Exonic
988363291 5:30263644-30263666 CATCAGGAAGAGAAGCCCTTGGG + Intergenic
988442142 5:31245104-31245126 TAGCAGGAAGCAAGTCCCAGTGG + Intronic
988502296 5:31793381-31793403 CTGCAGGTGCAAAGGCCCTGGGG - Intronic
988893953 5:35651391-35651413 CAGCAGGAGGAGAAGGCCTGGGG + Intronic
988908587 5:35815980-35816002 TAGCAAGCACAAAGGCCCTGCGG - Intergenic
988962373 5:36383054-36383076 CAGGAGGATGAAAGGCCAAGAGG - Intergenic
989110607 5:37903529-37903551 CAGCCAGTGGAAAGGCCCTGAGG + Intergenic
989156266 5:38347601-38347623 CAGCAGGTTCAAAGGCCCAGAGG + Intronic
990267585 5:54094475-54094497 CAGCAACAAAAAAGGCACTGGGG + Intronic
991020166 5:61972004-61972026 CAGCAAGAACAAAAGCCTTGGGG - Intergenic
991283710 5:64945060-64945082 CAGCATGAGCAATGGCCCTGAGG - Intronic
991478281 5:67047405-67047427 CAGCAAGAGCAGAGGCCCTGAGG - Intronic
991596269 5:68309877-68309899 CAGCAGGAAGAAAGGTGTGGAGG + Intergenic
992253314 5:74897183-74897205 CAGCAGTGGGAAAGGCACTGTGG - Intergenic
992388647 5:76310397-76310419 CAGCAGGTGCAAAGGTCCTGAGG + Intronic
992486767 5:77204687-77204709 CAGCATGAACAAAGGCACAGAGG - Intergenic
992494199 5:77276237-77276259 CAGCAGGCGCAAAGGCCCTGAGG - Intronic
992516709 5:77501253-77501275 TAGCAGTGAGCAAGGCCCTGTGG - Intronic
992524351 5:77593063-77593085 CACCAGGAGCAAAAGCCCTGAGG + Intronic
993044094 5:82847807-82847829 TAGCAGTGAGCAAGGCCCTGTGG + Intergenic
993382800 5:87227115-87227137 CACCAAGAAAAAAGGCCGTGAGG + Intergenic
993635179 5:90334408-90334430 CAGCAAGTAGAAAGACCCTGAGG + Intergenic
993868385 5:93221381-93221403 GAGCAGAACCAAAGGCCCTGTGG + Intergenic
994820295 5:104641707-104641729 CCACAGGAAGAAAAGCCCAGTGG + Intergenic
996558350 5:124801776-124801798 GGAAAGGAAGAAAGGCCCTGTGG - Intergenic
996678359 5:126202417-126202439 AAGCAGCAGGAAAAGCCCTGTGG + Intergenic
997205516 5:132046848-132046870 TGGGAGGAAGAAAGGCCCAGTGG - Intergenic
997518924 5:134509701-134509723 CAGCGAGTACAAAGGCCCTGAGG + Intergenic
997677678 5:135725424-135725446 CAGCACGTGCAAAGGCCCTGAGG + Intergenic
997697397 5:135872440-135872462 TAGCAGGTACAAAGGCCCTGTGG - Intronic
997834826 5:137183798-137183820 CAGCAGGCAGGAAGGCACAGAGG + Intronic
997846907 5:137294797-137294819 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
998153049 5:139768180-139768202 CAGCAGGAAGGAAGGAAGTGGGG + Intergenic
998471815 5:142389605-142389627 CAGCCTGTACAAAGGCCCTGAGG + Intergenic
998533918 5:142911377-142911399 GAGCAGGTGGACAGGCCCTGGGG - Intronic
998586661 5:143434003-143434025 TAGCCAGTAGAAAGGCCCTGAGG - Intronic
998617042 5:143752019-143752041 AAGAAGGGAGACAGGCCCTGGGG + Intergenic
998629763 5:143884952-143884974 CAGAAGCAGGAAAGTCCCTGAGG - Intergenic
999247692 5:150163924-150163946 CAGTATGAACAGAGGCCCTGAGG - Intergenic
999266178 5:150268352-150268374 CAGCAGGTACAGAGGCCCTGAGG - Intronic
999326496 5:150647495-150647517 CAGCAAGTCCAAAGGCCCTGGGG + Intronic
999965597 5:156806211-156806233 TAGCAGTGAGCAAGGCCCTGTGG - Intergenic
1000165459 5:158643874-158643896 CAGCCAGTACAAAGGCCCTGAGG - Intergenic
1000285523 5:159823205-159823227 CAGCAAGTACAAAGGTCCTGAGG + Intergenic
1000286783 5:159833705-159833727 CAGCAAGAGCAAAGGCACTGAGG + Intergenic
1001197004 5:169682365-169682387 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1001249547 5:170136180-170136202 CATCAGCAGGAAAGGCACTGAGG - Intergenic
1001422400 5:171597725-171597747 CAGCAGGTGCAAAGGCCCTGTGG - Intergenic
1001423839 5:171610276-171610298 CAGCAAGTGCAAAGGCCCTGGGG - Intergenic
1001560826 5:172667940-172667962 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1001850659 5:174962149-174962171 CAGCTGGAAGCAAGCACCTGAGG + Intergenic
1001988761 5:176098345-176098367 CACCAAGGAGAAAGGGCCTGCGG + Intronic
1002060954 5:176625743-176625765 CAGCAAGTACCAAGGCCCTGAGG - Intronic
1002122995 5:177020226-177020248 CAGCAGGTACAAAGGCCCTGAGG - Intronic
1002228107 5:177739791-177739813 CACCAAGGAGAAAGGGCCTGCGG - Intronic
1002274267 5:178094274-178094296 CAGCAAGTGTAAAGGCCCTGCGG + Intergenic
1002391359 5:178914870-178914892 CAGCAGGTGCGAAGGCCCTGAGG + Intronic
1002448845 5:179307725-179307747 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1002582447 5:180216905-180216927 GAACAGGAAGCATGGCCCTGGGG - Intergenic
1002591414 5:180293323-180293345 AAGCAGGAAGAGAGGCACTGAGG + Intergenic
1002820148 6:717270-717292 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
1003169440 6:3709543-3709565 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
1003174986 6:3747540-3747562 GAGCAGGTGCAAAGGCCCTGAGG - Intronic
1003403678 6:5811018-5811040 CAGCAGGTGCAAAGGCCCCGGGG + Intergenic
1003586131 6:7390653-7390675 CAGCAAGAGCAAAGGCCCCGAGG + Intronic
1003647502 6:7926046-7926068 TAGCAGTAAGCAAGGCTCTGTGG - Intronic
1003712295 6:8605456-8605478 CAGCAGAGAGAAAGGCAATGGGG - Intergenic
1003900112 6:10647168-10647190 CAGCACCAAGGGAGGCCCTGGGG + Intergenic
1003987551 6:11452157-11452179 TAGCAGTAAGCAAGGCTCTGTGG - Intergenic
1004023106 6:11792137-11792159 CAGGAAGAAGAAAGGACCAGAGG - Intronic
1004194458 6:13490640-13490662 CAGCAAGTGCAAAGGCCCTGGGG - Intergenic
1004722160 6:18277292-18277314 CAGCAGCCAGAGAGGCTCTGAGG + Intergenic
1004927877 6:20432859-20432881 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1005589624 6:27310767-27310789 CAGCAGGATGAAAGTAGCTGTGG + Exonic
1005804602 6:29462458-29462480 CAGCATGGAGAAAGGCCTTTGGG + Exonic
1006362570 6:33594991-33595013 CAGCATGAAGGCAGGCCCTGGGG + Intergenic
1006430845 6:33994866-33994888 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
1006440395 6:34050170-34050192 CAGCAAGTGCAAAGGCCCTGGGG - Intronic
1006451387 6:34107664-34107686 CAGCAGGTACAAAGGCCCTGTGG + Intronic
1006457477 6:34140230-34140252 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1006471326 6:34230786-34230808 CAGCAAGTGCAAAGGCCCTGTGG + Intergenic
1006607079 6:35265687-35265709 CAGCAAACACAAAGGCCCTGAGG + Intronic
1006703664 6:35997903-35997925 CACCAGGAAGAAGGAACCTGTGG + Exonic
1006720214 6:36145280-36145302 CAGCAGGAAGAATGGTGCAGTGG - Intergenic
1006781629 6:36636391-36636413 CAGCATGTGCAAAGGCCCTGGGG + Intergenic
1006797360 6:36740319-36740341 CAGCAGGCGCAAAGGCCCTGTGG - Intergenic
1006809976 6:36813731-36813753 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1006815313 6:36845874-36845896 TAGCAAATAGAAAGGCCCTGAGG - Intergenic
1006815659 6:36848231-36848253 TGGCAGGAAGAAAGGCCCAGGGG - Intergenic
1006913303 6:37578304-37578326 CAGCCGGAGCAAAGGCCCTGGGG + Intergenic
1006920831 6:37626107-37626129 CAGCAGGCAGAAAGCCCCCTTGG - Intergenic
1006934843 6:37710162-37710184 CAGAAGGTACAAAGGCCCTGAGG + Intergenic
1007468062 6:42069046-42069068 CAGCAGATGCAAAGGCCCTGAGG + Intronic
1007692419 6:43711346-43711368 CAGCTGGAGCAAAGGCCGTGAGG + Intergenic
1007768176 6:44173407-44173429 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1007932826 6:45707861-45707883 CAGAAGGCACACAGGCCCTGTGG + Intergenic
1008081460 6:47199141-47199163 CAGATGGAAGAAAGGTCTTGTGG - Intergenic
1008413988 6:51217916-51217938 CAGAAAGTACAAAGGCCCTGAGG - Intergenic
1008675106 6:53810803-53810825 CAGCACCAAGAAAGGCACAGAGG - Intronic
1008778394 6:55069737-55069759 GAGCAGGAACAAAGGCCCTGAGG + Intergenic
1009567172 6:65324030-65324052 GAGCAGGTGTAAAGGCCCTGAGG - Intronic
1010688324 6:78877873-78877895 TAGCAGCAAGAGAGGCTCTGTGG - Intronic
1011181248 6:84623619-84623641 TAGCAGTAAAGAAGGCCCTGGGG - Intergenic
1011323700 6:86125668-86125690 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
1011463468 6:87630793-87630815 AAGCAGGTAGAAAGGACCTGAGG + Intronic
1011527637 6:88282463-88282485 CGGCAAGTACAAAGGCCCTGTGG + Intergenic
1011549790 6:88520642-88520664 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
1011554918 6:88564147-88564169 CAGCCGGAGCAAAGGCCCTGAGG - Intergenic
1011620514 6:89237900-89237922 AAGCAGTAGGAAAAGCCCTGTGG - Intergenic
1011754752 6:90487047-90487069 CAGCAGGCAGGAAGAACCTGTGG + Intergenic
1011847992 6:91590312-91590334 TAGCAGTAAGCAAGGCTCTGTGG - Intergenic
1011964425 6:93136344-93136366 TAGCAAGAATAAAGGCCCTCAGG - Intergenic
1012484180 6:99702475-99702497 CAGCAGTGAGCAAGGCTCTGTGG - Intergenic
1012840836 6:104326989-104327011 CAGTAAGAGCAAAGGCCCTGAGG - Intergenic
1013221415 6:108080805-108080827 AAGCAGCAGGAAAAGCCCTGTGG - Intronic
1013620701 6:111885798-111885820 CAGCACGTGCAAAGGCCCTGGGG + Intergenic
1013635412 6:112024673-112024695 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
1013717914 6:112985560-112985582 GAGGAGGAAGAAAATCCCTGGGG - Intergenic
1014221917 6:118806458-118806480 CAGCAAGTAAAATGGCCCTGAGG + Intergenic
1014259769 6:119203356-119203378 GAGCAAGTACAAAGGCCCTGAGG + Intronic
1014892034 6:126854605-126854627 AAGCAGGGAGCAAGGACCTGAGG + Intergenic
1015547315 6:134374666-134374688 CAGCAGGAGCAATGGCCCTGAGG - Intergenic
1015579155 6:134704588-134704610 CAGCAGGGGGAGAGGCCATGAGG + Intergenic
1015940943 6:138451246-138451268 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1015995226 6:138989705-138989727 TGGCAGGAACAAAGGCCCTGGGG - Intergenic
1016580415 6:145623434-145623456 CAGCAGGAGCAAGTGCCCTGAGG + Intronic
1016662810 6:146600439-146600461 CAGCAAGTGCAAAGGCCCTGCGG - Intronic
1017028532 6:150201433-150201455 CAGCACGTGCAAAGGCCCTGTGG + Intronic
1017043410 6:150325574-150325596 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
1017044774 6:150337277-150337299 CAGCATGAGGAAAGGCCCTGTGG + Intergenic
1017209418 6:151838337-151838359 CAGCAGGAAGAGAGGAGGTGGGG + Intronic
1017870492 6:158482532-158482554 CAGGAGGAAGGAAGGCACAGTGG + Intronic
1019073940 6:169371617-169371639 CAGCACCAGGAAGGGCCCTGAGG + Intergenic
1019075675 6:169386416-169386438 CAGAAGAAAGAAATGGCCTGTGG + Intergenic
1019308780 7:348811-348833 CAGAGGGAAGAAAGGCCCAGGGG + Intergenic
1019310151 7:356599-356621 CAGGAGGAACAAAGGCATTGAGG - Intergenic
1019394578 7:810626-810648 CAGGAGCAAGAGAGGCCGTGAGG + Intergenic
1019442935 7:1056505-1056527 CAGCAGGAGACACGGCCCTGTGG - Intronic
1019609818 7:1930732-1930754 CACCAGGAAGCAAGTCCCAGGGG - Intronic
1019732548 7:2635893-2635915 CGGCAGGTGCAAAGGCCCTGAGG + Intronic
1020024044 7:4886001-4886023 CACCCAGAAGAAAGGCCATGTGG - Intergenic
1020033089 7:4946720-4946742 AAGAAGGAAGAAAGGCCAGGAGG - Intronic
1020128737 7:5547712-5547734 CAGCAAGTGCAAAGGCCCTGTGG - Intronic
1020536609 7:9405448-9405470 CAGAAGAATGAAAGGCCCAGAGG - Intergenic
1021113523 7:16723216-16723238 CAGAAGGAAGAACAGCCCTCAGG - Intergenic
1021399126 7:20189044-20189066 CAGCAAGTATAAAGGCCCTAAGG - Intronic
1021416638 7:20393714-20393736 CAGCAAGAACAAAGGCACAGAGG - Intronic
1021803601 7:24332931-24332953 CAGCATGTGCAAAGGCCCTGGGG + Intergenic
1021873690 7:25028963-25028985 CAGGTGGAAGAAAGGCCTTGGGG + Intergenic
1021941944 7:25686746-25686768 CACCAGGAAGAAGAGGCCTGAGG + Intergenic
1022355930 7:29614458-29614480 CAGCAAGTGCAAAGGCCCTGGGG - Intergenic
1022690763 7:32650527-32650549 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
1022918329 7:34984361-34984383 CAGCATGTGCAAAGGCCCTGAGG + Intronic
1023357752 7:39384593-39384615 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1023374612 7:39543593-39543615 CAGCACAAGCAAAGGCCCTGGGG + Intergenic
1023735389 7:43231662-43231684 CAGCAGGAACCAAGTCCCGGTGG + Intronic
1024280384 7:47713868-47713890 CAGCTGGAACAGAGGCCATGTGG + Intronic
1024343814 7:48292641-48292663 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1024632450 7:51261053-51261075 CAGCAGGAAGGCAGGCAGTGTGG - Intronic
1025253742 7:57369236-57369258 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
1026444123 7:70469426-70469448 CAGCAAGAGCAAAGGCCCTGAGG + Intronic
1026479291 7:70764463-70764485 CAGGAGCGAGAGAGGCCCTGAGG + Intronic
1026970528 7:74464942-74464964 GTGCAGGAAGGAAGGCCCTTGGG + Intronic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1027442172 7:78231236-78231258 CAGCAGAAAGAAAAGATCTGAGG + Intronic
1028446434 7:90928980-90929002 CAGCAGTGAGCAAGGCTCTGTGG + Intronic
1028596104 7:92547389-92547411 CAGGAGGCAGACAGGCTCTGGGG + Intergenic
1028614313 7:92748291-92748313 CAGAAGGAAGAAAGGCCTTTAGG + Intronic
1028656782 7:93218051-93218073 CAGCAAGTACAAAGGCCCTGAGG + Intronic
1028743735 7:94305050-94305072 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
1028961454 7:96753864-96753886 TAGCAGGTGCAAAGGCCCTGAGG + Intergenic
1029403144 7:100357612-100357634 CAGCAGGAAGATGGGCACTGGGG + Intronic
1029591563 7:101510495-101510517 TAGCAGGTGCAAAGGCCCTGAGG - Intronic
1029598448 7:101549978-101550000 GAGCAGGTACAAAGGCCCTGAGG + Intronic
1029842295 7:103378503-103378525 GAGCAAGGAGAAAGGCCATGCGG - Exonic
1029918519 7:104237517-104237539 TTGCAGGAAGGAAGACCCTGGGG + Intergenic
1030064873 7:105651931-105651953 CAGCAGGGAGACATGCGCTGGGG - Intronic
1030237844 7:107286149-107286171 CAGCAAGTACAAAGGCCCTGAGG + Intronic
1031186081 7:118481657-118481679 CACAAAGAAGAAAGGCCCTGTGG + Intergenic
1031612846 7:123846806-123846828 AAGCAGCAAGAAAAGCCCTGTGG - Intronic
1031614266 7:123862995-123863017 AAGCAGGTGCAAAGGCCCTGTGG - Intronic
1031992088 7:128205203-128205225 CAGCATGCGCAAAGGCCCTGAGG + Intergenic
1032096034 7:128938946-128938968 CAGCAGGAGGAGAGGTCCAGAGG + Intronic
1032429119 7:131846559-131846581 CAGCAGGAAGATGGGACATGAGG + Intergenic
1032456668 7:132078297-132078319 CAGTATGGAGAAAGGCTCTGAGG + Intergenic
1032703552 7:134403234-134403256 CAGCAGATGCAAAGGCCCTGTGG + Intergenic
1032719577 7:134539604-134539626 CAGCAGGTGCAAAGTCCCTGAGG + Intronic
1032724539 7:134578373-134578395 CAGCAGGTGCAAAGTCCCTGAGG + Intronic
1032863603 7:135904499-135904521 CGGCAGGTGCAAAGGCCCTGAGG + Intergenic
1034089354 7:148349800-148349822 TAGCAGGACCAAAGACCCTGAGG + Intronic
1034162171 7:149001860-149001882 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
1034300484 7:150010891-150010913 CAGCAGCAGGAAGGGCACTGTGG - Intergenic
1034326645 7:150241260-150241282 CCATAGGAATAAAGGCCCTGTGG + Intergenic
1034766561 7:153728007-153728029 CCATAGGAATAAAGGCCCTGTGG - Intergenic
1034805570 7:154086417-154086439 CAGCAGCAGGAAGGGCACTGTGG + Intronic
1034894332 7:154866144-154866166 CAGCACGTGCAAAGGCCCTGGGG + Intronic
1035129968 7:156642502-156642524 ATGCAGTAAGAAAGGCCCAGCGG - Intronic
1035146259 7:156820789-156820811 CAGAAGGAGGGAAGGCTCTGCGG + Intronic
1035302992 7:157909600-157909622 CAGCAGGTACAAAGGCCCTGAGG - Intronic
1035643605 8:1201477-1201499 CAGAAGGAAGCCAGGTCCTGGGG + Intergenic
1037019217 8:13947503-13947525 CAGCAGGCAGTAAGGAACTGAGG + Intergenic
1037594714 8:20345449-20345471 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
1037609037 8:20460968-20460990 CAGCAAGCGCAAAGGCCCTGGGG - Intergenic
1037638904 8:20724877-20724899 TAGCATGGACAAAGGCCCTGAGG + Intergenic
1037860113 8:22399018-22399040 CAGCAGGAAGAGCTGGCCTGGGG + Intronic
1038126260 8:24676087-24676109 CAGCAGGAAGAAAGTCTATGTGG + Intergenic
1038168702 8:25109025-25109047 CAGCAGCAAATTAGGCCCTGTGG - Intergenic
1038924827 8:32126972-32126994 CACCAAGAAGAAATGCCCAGTGG + Intronic
1039923390 8:41908394-41908416 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
1040278350 8:46025251-46025273 AAGCATCAAGAAAGCCCCTGTGG - Intergenic
1040278605 8:46026337-46026359 AAGCAGCAAGAAGGCCCCTGGGG - Intergenic
1040594207 8:48821899-48821921 CTGCAGGCAGACATGCCCTGGGG + Intergenic
1041354391 8:56984938-56984960 CAGTAAGTACAAAGGCCCTGAGG - Intronic
1042296934 8:67230000-67230022 CAGCAATAAGACAGGTCCTGTGG + Intronic
1042769728 8:72366452-72366474 AAGCTGGAACAAAGGCCTTGTGG - Intergenic
1042963937 8:74330825-74330847 CTTCAGGAAGAAAGGCCCCCAGG + Intronic
1043553546 8:81403087-81403109 CAGGAGGATGAAAGGACCTGGGG - Intergenic
1043869233 8:85412745-85412767 CAGCATGCTGAAAGGCCCTGAGG + Intronic
1044433320 8:92134223-92134245 CAGGAGGAAGAAAGGCTATTAGG - Intergenic
1044437905 8:92187782-92187804 CAGCATTTAGAAAGGCTCTGAGG - Intergenic
1044626028 8:94235541-94235563 CAGGAAGAAGAAAGGCCTTTTGG + Intergenic
1044808374 8:96032170-96032192 CAGCACGTGCAAAGGCCCTGTGG + Intergenic
1044824324 8:96182149-96182171 TAGCAGGTGCAAAGGCCCTGGGG + Intergenic
1044907155 8:97017237-97017259 AAGCAGGAGAAAAGTCCCTGTGG + Intronic
1045111260 8:98940835-98940857 CACCAGGAGAAAAGGCTCTGGGG + Intronic
1045219550 8:100185087-100185109 CAGCATGTGCAAAGGCCCTGTGG - Intronic
1045298088 8:100889615-100889637 CAGCAGGCACAAAGGCACAGAGG + Intergenic
1045358052 8:101406642-101406664 CAGCAGGAAGTAAGGCAGTGAGG - Intergenic
1045384240 8:101655948-101655970 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1046612081 8:116437234-116437256 CAGCAAGTGCAAAGGCCCTGGGG + Intergenic
1046738781 8:117806584-117806606 CAGCGAGAATAAATGCCCTGAGG - Intronic
1047190394 8:122674121-122674143 CAGGAGGAACAAAGACACTGAGG - Intergenic
1047718252 8:127615634-127615656 CAGCATGCAGAAAGGCATTGGGG - Intergenic
1047814816 8:128452009-128452031 CAGCATGTACAAAGGTCCTGTGG + Intergenic
1048035273 8:130672085-130672107 CAGCAGGAAGAATGCCGGTGTGG + Intergenic
1048045498 8:130768742-130768764 CAGCAGTTGCAAAGGCCCTGTGG - Intergenic
1048293656 8:133198852-133198874 CAGCATGTGCAAAGGCCCTGGGG - Intronic
1048295466 8:133210584-133210606 CTGCAGGGAGGAAGGCTCTGTGG - Intronic
1048335284 8:133497947-133497969 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
1048428496 8:134344663-134344685 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
1048565950 8:135597400-135597422 CAGCAAGCATAAAGGCCATGAGG - Intronic
1048804388 8:138226500-138226522 CAGCATGTGCAAAGGCCCTGTGG + Intronic
1048968991 8:139633994-139634016 CGGCAGGCACAAATGCCCTGGGG - Intronic
1048982942 8:139712861-139712883 CAGCGGATGGAAAGGCCCTGAGG + Intergenic
1049034318 8:140062462-140062484 CAGCTGGAGTAAAGGCCCTGGGG - Intronic
1049051397 8:140199512-140199534 TGGAAGGAAGAAAGGCTCTGGGG - Intronic
1049051405 8:140199576-140199598 TGGAAGGAAGAAAGGCTCTGGGG - Intronic
1049092942 8:140530406-140530428 CAGCAGGAAGAGGGGACCTACGG + Intergenic
1049097542 8:140557862-140557884 CAGAAGGACGAGAGGGCCTGTGG - Intronic
1049505193 8:142992383-142992405 AAGCAGGAAGGAAGGGGCTGGGG + Intergenic
1049568911 8:143359358-143359380 CTCCGGGAAGAAAGGCCCTGGGG + Intronic
1049764961 8:144350893-144350915 GAAAAGGCAGAAAGGCCCTGGGG - Intergenic
1050488520 9:6162100-6162122 CAAGGGGAAGAAGGGCCCTGCGG - Intergenic
1050620702 9:7449296-7449318 GAGCAGGAAATTAGGCCCTGGGG + Intergenic
1051329605 9:16010431-16010453 AAGCAGGCAGCAAGGGCCTGTGG + Intronic
1052196214 9:25718036-25718058 CAGCATGTACATAGGCCCTGTGG + Intergenic
1052206134 9:25843071-25843093 ATGGAGAAAGAAAGGCCCTGGGG - Intergenic
1052455890 9:28697792-28697814 CAGCAATAAGAAGCGCCCTGGGG - Intergenic
1052825246 9:33169361-33169383 CAGCAAGTACAAAGGCCCTGAGG - Intergenic
1052857908 9:33418408-33418430 CAGCAGGAAGAGGGGGCTTGAGG + Intergenic
1052863270 9:33449779-33449801 CAGCACCAAGAAAGCCCCAGGGG + Intergenic
1053287878 9:36861642-36861664 CAGCAAGTGCAAAGGCCCTGGGG + Intronic
1053454700 9:38225144-38225166 CAGCAGCTACAAAGGCCCAGAGG - Intergenic
1053463063 9:38285435-38285457 CAGCAGGTGCAAAGGCCCTGGGG - Intergenic
1053463836 9:38290614-38290636 CAGTAGGAAAAAAGGCCTGGTGG - Intergenic
1053531812 9:38890026-38890048 CACCAAGTACAAAGGCCCTGAGG - Intergenic
1053621901 9:39828108-39828130 AAGCAGGTGCAAAGGCCCTGGGG - Intergenic
1053643038 9:40106430-40106452 CAGCAGGAAGAAACCCCAGGAGG - Intergenic
1053763109 9:41359058-41359080 CAGCAGGAAGAAACCCCAGGAGG + Intergenic
1053837836 9:42159970-42159992 AAGCAGGTGCAAAGGCCCTGGGG - Intergenic
1053883182 9:42616160-42616182 AAGCAGGTGCAAAGGCCCTGGGG + Intergenic
1053889487 9:42678139-42678161 AAGCAGGTGCAAAGGCCCTGGGG - Intergenic
1054204035 9:62114446-62114468 CACCAAGTACAAAGGCCCTGAGG - Intergenic
1054222207 9:62423633-62423655 AAGCAGGTGCAAAGGCCCTGGGG + Intergenic
1054228506 9:62485539-62485561 AAGCAGGTGCAAAGGCCCTGGGG - Intergenic
1054454833 9:65424484-65424506 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
1054541719 9:66270173-66270195 CAGCAGGAAGAAACCCCAGGAGG + Intergenic
1054634327 9:67473919-67473941 CACCAAGTACAAAGGCCCTGAGG + Intergenic
1054806775 9:69403295-69403317 CAGCAGTGGCAAAGGCCCTGAGG + Intergenic
1054809380 9:69422646-69422668 CAGCAAGGACAAAGGCCCTGAGG - Intergenic
1055249596 9:74287048-74287070 CAGCAAGTGCAAAGGCCCTGAGG - Intergenic
1055488231 9:76777900-76777922 CAGCAGGTACAAAGTCCCTGAGG + Intronic
1055873367 9:80913240-80913262 TAGCAGGAAGCTGGGCCCTGTGG - Intergenic
1056544020 9:87598035-87598057 CAGCAGGAGATAAGACCCTGAGG - Intronic
1056759953 9:89407305-89407327 CAGCAGGAAGAGAAGGACTGAGG - Intronic
1056831810 9:89923345-89923367 GAGCAGCCAGGAAGGCCCTGGGG + Intergenic
1057179831 9:93023682-93023704 CAGCAGGTGTCAAGGCCCTGGGG - Intronic
1057263009 9:93596585-93596607 TAGCAGGAAGAGAGGCTGTGTGG + Intronic
1057277300 9:93682795-93682817 GTGCAGGAGCAAAGGCCCTGAGG + Intergenic
1057280833 9:93710359-93710381 CAGCAGAGAGAATGGCCCCGGGG - Intergenic
1057297665 9:93859026-93859048 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
1057517014 9:95730153-95730175 CAGCAGGAAGAAAGAAACTGCGG + Intergenic
1057779846 9:98040611-98040633 AGGCAGGAAGAAAGGCAATGTGG - Intergenic
1057834797 9:98435703-98435725 GAGCAGGTGCAAAGGCCCTGGGG - Intronic
1058086024 9:100749223-100749245 TAGCAGGGAGCAAGGCTCTGTGG + Intergenic
1058117052 9:101096222-101096244 CAGCATCAGGAAAGGGCCTGGGG + Intronic
1058570722 9:106340050-106340072 CACCAGGAAGGAAGTCCATGTGG - Intergenic
1058599951 9:106658462-106658484 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
1058603563 9:106697012-106697034 CAGCAAGTACAAAGGTCCTGAGG - Intergenic
1058992632 9:110269367-110269389 CTGGAGGATGAAAGGCCATGTGG - Intergenic
1059380156 9:113917122-113917144 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1059412326 9:114140219-114140241 GAGCTGGAAGGAAGGCCCCGTGG + Intergenic
1059422771 9:114202718-114202740 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1059427889 9:114232415-114232437 AAGTGGGAAGACAGGCCCTGGGG + Intronic
1059457690 9:114410040-114410062 CGGCAGGTGCAAAGGCCCTGGGG - Intronic
1059671875 9:116499692-116499714 CTGCTGGAAGAAAGCCCATGGGG + Intronic
1059713083 9:116887479-116887501 CAGCAGGTGCAAAGGCCCAGGGG + Intronic
1059714685 9:116903018-116903040 CAGCAAGTGCAAAGGCCCTGAGG - Intronic
1060019651 9:120117978-120118000 CAGCCAGAAGAAAGGGCCTAAGG - Intergenic
1060148372 9:121270379-121270401 CTGGAGGCAGGAAGGCCCTGAGG + Intronic
1060488659 9:124065655-124065677 CAGCAGGAAGAGATGGTCTGGGG + Intergenic
1060493461 9:124101420-124101442 GAGCAGGAAGAAAGGCTTTAAGG - Intergenic
1060523406 9:124307445-124307467 CCGCTGGAACAAGGGCCCTGGGG - Intronic
1060691825 9:125668646-125668668 CAGCAAGAAGAAAAGACTTGGGG - Intronic
1060814424 9:126627169-126627191 CAGCAGGAAGAGAGACCCCCCGG + Intronic
1060976033 9:127765609-127765631 CAGCACGTGCAAAGGCCCTGAGG - Intronic
1060993255 9:127860984-127861006 CAGCAGGTGCAAAGGCCCTGGGG - Intergenic
1061205475 9:129160722-129160744 CAGCAAGTACCAAGGCCCTGAGG + Intergenic
1061247471 9:129408121-129408143 CAGCAGGTGCCAAGGCCCTGGGG - Intergenic
1061308919 9:129749747-129749769 CAGCACGTGCAAAGGCCCTGAGG + Intronic
1061475418 9:130862527-130862549 CAGCAGGTACAGAGGCCCTGAGG + Intronic
1061573872 9:131494301-131494323 CACAAGGAAGGAAGGGCCTGCGG - Intronic
1061579121 9:131526057-131526079 CAGCAGGAGGGGCGGCCCTGGGG + Intronic
1061665804 9:132160742-132160764 CATCAAGAACAAAGGGCCTGAGG - Intergenic
1061670181 9:132184212-132184234 CAGCAGGAAGAAACCCTCGGAGG + Intronic
1061904299 9:133688709-133688731 CAGCAGGTGCAAAGGCCCCGTGG - Intronic
1061995210 9:134179753-134179775 CAGCACGTGCAAAGGCCCTGGGG + Intergenic
1062007808 9:134250199-134250221 CACACGGAAGAAAGGGCCTGTGG + Intergenic
1062207433 9:135344893-135344915 CAGGAGGGATGAAGGCCCTGAGG - Intronic
1062277280 9:135736923-135736945 CGGCAGGAAGCAGGGCGCTGTGG - Intronic
1062357986 9:136174032-136174054 CAGCAGGCTCAAAGGCCCTGAGG + Intergenic
1062414784 9:136442714-136442736 CTGCAGGCAGAACGGCCCTGGGG + Intronic
1202790789 9_KI270719v1_random:89402-89424 CAGCAGGAAGAAACCCCAGGAGG - Intergenic
1185839184 X:3372867-3372889 CAGCAGGTGCAAAGGACCTGGGG - Intergenic
1186611553 X:11142816-11142838 CAGAAGGGAAAGAGGCCCTGTGG + Intronic
1186654725 X:11600526-11600548 CAGCCAGAAGAAAAGCCCTCAGG - Intronic
1187367994 X:18680193-18680215 CAGCAGCAGCAAAGGCCCCGAGG - Intronic
1187452554 X:19411733-19411755 CAGCAAGTGCAAAGGCCCTGAGG + Intronic
1188494051 X:30765123-30765145 CAGCAAGTATAAAGGCCCAGAGG + Intergenic
1188592233 X:31851956-31851978 CAGCAAGTGCAAAGGCCCTGGGG + Intronic
1188661919 X:32771027-32771049 CAGCAAGTACAAAGGTCCTGAGG + Intronic
1188734653 X:33697291-33697313 ATGCAGGAAGAAAAGTCCTGGGG + Intergenic
1189370114 X:40421219-40421241 GTGGAGGGAGAAAGGCCCTGGGG - Intergenic
1189539471 X:41971298-41971320 AAGCAGCAGGAAAAGCCCTGTGG + Intergenic
1189668232 X:43380604-43380626 AAGCAGCAGGAAAAGCCCTGTGG + Intergenic
1189774294 X:44456194-44456216 CAGCAAGTAGAAAGGCCATGTGG + Intergenic
1190221475 X:48515031-48515053 CAGCAGGTGCAAAGGTCCTGAGG + Intronic
1190388413 X:49908059-49908081 CAGCAAGGGCAAAGGCCCTGAGG + Intergenic
1190827151 X:54028172-54028194 CAGCAAGTACAAAAGCCCTGTGG + Intronic
1190882173 X:54499469-54499491 CAGCAAGTAGGAAGGCCCTGGGG + Intergenic
1191713264 X:64175262-64175284 GAGCATGTAGAAAGGCCCTGTGG + Intergenic
1192134210 X:68581821-68581843 CACCAAGTACAAAGGCCCTGAGG - Intergenic
1192226627 X:69232734-69232756 CAGCAAGAAAAAAGGCCCTGAGG - Intergenic
1192576087 X:72244419-72244441 TAGCATGATCAAAGGCCCTGAGG + Intronic
1192577793 X:72256842-72256864 CAGTAGGTACAAAGGCCCTCAGG + Intronic
1193404165 X:81082144-81082166 AAGCAGTGAGAAAAGCCCTGTGG + Intergenic
1195111962 X:101658316-101658338 CACCAAAAAGAAAGGGCCTGGGG + Intronic
1195304156 X:103562656-103562678 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
1195594009 X:106667245-106667267 CAGCAAGCACAAAAGCCCTGAGG + Intronic
1195653778 X:107314635-107314657 CAGCAGGTGCAAAGTCCCTGAGG - Intergenic
1195795355 X:108641717-108641739 AAGCAGCAGGAAAGGCCCTGGGG + Intronic
1195964691 X:110419281-110419303 GAGCACGAACAAAGGCCCTGGGG - Intronic
1196694854 X:118600800-118600822 CAGCAAGTACAAAGGCCCCGAGG + Intronic
1197318254 X:124995079-124995101 AAGCATGTACAAAGGCCCTGTGG - Intergenic
1197694692 X:129538579-129538601 CAGCAAGTGTAAAGGCCCTGAGG + Intergenic
1197714302 X:129695253-129695275 CAGCAGGTTCAAAGGCCCTGAGG - Intergenic
1198283905 X:135171264-135171286 AAGCAGGAAGTGAGTCCCTGAGG - Exonic
1198390156 X:136166366-136166388 CAGAAGAAAGAAAGGCCCAAAGG - Intronic
1198552186 X:137756802-137756824 CAGCAAGTGCAAAGGCCCTGAGG + Intergenic
1199225716 X:145370872-145370894 CAGCAGGACAACAGACCCTGTGG + Intergenic
1199585161 X:149407041-149407063 CAGCAGATAAAAATGCCCTGAGG + Intergenic
1199708868 X:150453792-150453814 CAGCAAGTGGGAAGGCCCTGGGG - Intronic
1199719711 X:150534009-150534031 CAGCATGTGCAAAGGCCCTGTGG + Intergenic
1200152055 X:153956092-153956114 CACCAGGAAGGAAAGGCCTGTGG + Intronic
1200179016 X:154139173-154139195 CAGCAAGTGCAAAGGCCCTGGGG - Intergenic
1200205473 X:154312397-154312419 CAGCTTGGACAAAGGCCCTGAGG - Intronic
1200212727 X:154354047-154354069 AGGCAGGAAGAAGGGCCTTGTGG + Intronic
1200933999 Y:8722410-8722432 CAGGAGGAAGAGAGGCAGTGAGG - Intergenic