ID: 1084982453

View in Genome Browser
Species Human (GRCh38)
Location 11:72837726-72837748
Sequence AGGAAGAACCTGGTGGCTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084982453_1084982457 -6 Left 1084982453 11:72837726-72837748 CCACGAGCCACCAGGTTCTTCCT 0: 1
1: 0
2: 2
3: 18
4: 147
Right 1084982457 11:72837743-72837765 CTTCCTTCCACGGAAATGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 128
1084982453_1084982463 8 Left 1084982453 11:72837726-72837748 CCACGAGCCACCAGGTTCTTCCT 0: 1
1: 0
2: 2
3: 18
4: 147
Right 1084982463 11:72837757-72837779 AATGTCAGGGTAGTGGGACCTGG 0: 1
1: 0
2: 1
3: 10
4: 123
1084982453_1084982461 1 Left 1084982453 11:72837726-72837748 CCACGAGCCACCAGGTTCTTCCT 0: 1
1: 0
2: 2
3: 18
4: 147
Right 1084982461 11:72837750-72837772 CCACGGAAATGTCAGGGTAGTGG 0: 1
1: 0
2: 1
3: 11
4: 112
1084982453_1084982458 -5 Left 1084982453 11:72837726-72837748 CCACGAGCCACCAGGTTCTTCCT 0: 1
1: 0
2: 2
3: 18
4: 147
Right 1084982458 11:72837744-72837766 TTCCTTCCACGGAAATGTCAGGG 0: 1
1: 0
2: 1
3: 7
4: 111
1084982453_1084982462 2 Left 1084982453 11:72837726-72837748 CCACGAGCCACCAGGTTCTTCCT 0: 1
1: 0
2: 2
3: 18
4: 147
Right 1084982462 11:72837751-72837773 CACGGAAATGTCAGGGTAGTGGG 0: 1
1: 0
2: 0
3: 4
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084982453 Original CRISPR AGGAAGAACCTGGTGGCTCG TGG (reversed) Intronic
900919174 1:5659847-5659869 AGGAAGCAGCTGGTGACTGGAGG - Intergenic
901672333 1:10863119-10863141 AGGAAGAACTTGGGGGCTCTGGG + Intergenic
902232631 1:15037335-15037357 GGGAGGAAGCTGGTGGCTCAGGG - Intronic
902818784 1:18930888-18930910 AGGCTGAACATGGTGGCTCACGG + Intronic
903210437 1:21814973-21814995 GGGAAGAAGGTGGTGGCTAGTGG + Intronic
905635675 1:39550036-39550058 AGGAAGTGCATGGTGGCTCAAGG - Intergenic
906315755 1:44785474-44785496 AGGATGAACCCGGTGCCTCAGGG + Intronic
907234025 1:53028096-53028118 AGGAAGGACCTTGAGGCTAGAGG + Intronic
907951922 1:59191536-59191558 AGGAAGAAACTGAAGGCTTGTGG + Intergenic
909012266 1:70347886-70347908 AGGAAGAAAGTGGTGTCTAGAGG - Intronic
910802042 1:91156824-91156846 AGAAAGAACTTGGTGGCTCTAGG + Intergenic
910993557 1:93079859-93079881 AGGATGAACCTGGTGACGAGGGG + Intronic
911867197 1:103043989-103044011 AGGAAAAGTCTGGTGGCTCTTGG + Intronic
914897885 1:151693165-151693187 AGGATGAATCTGGGGGCTCCAGG - Intronic
915513529 1:156400156-156400178 TGACAGAACCTGGTGGCTCCTGG - Intergenic
915550458 1:156630007-156630029 AGGAGGCACCTGGTGACTGGCGG + Intergenic
915909956 1:159908755-159908777 AGGGAGAACCTGGGGGCCAGCGG - Intergenic
916068764 1:161157737-161157759 AGGAAGAACTTCGTGGCGGGAGG + Intronic
916254776 1:162775799-162775821 AGGAAGAATTAGGGGGCTCGTGG - Exonic
924548187 1:245050039-245050061 AAGACGAACCTGATGGCTAGAGG + Intronic
1063236447 10:4121610-4121632 AGGAAGCAGCTGGAGGCCCGTGG - Intergenic
1064404282 10:15047331-15047353 AGGAAGAGCCTGGTGGCACAAGG - Intronic
1065404566 10:25349451-25349473 AGGAAGGACCTGGTGGGAGGTGG + Intronic
1069038827 10:63673209-63673231 AGGAAGAATCCGGTGGCACATGG - Intergenic
1070617393 10:77979396-77979418 AGGAAGACCCTGCAGGCTTGGGG - Intronic
1071006836 10:80892932-80892954 TGGAAGAACCAGGAGGCTCCAGG - Intergenic
1071502322 10:86212606-86212628 TGGAGGAACGAGGTGGCTCGTGG - Intronic
1073098536 10:100995312-100995334 AGGAAGAACCTGGGGGGGTGGGG + Intergenic
1074521237 10:114226166-114226188 AGGAAGCGCCAGGTGGCTAGAGG - Exonic
1077661479 11:4072277-4072299 AGGAGGAACCAGGTGGCATGTGG - Intronic
1081988271 11:47323312-47323334 AGGAAGAACCTGGCTGGTCGAGG + Intronic
1083493872 11:63033628-63033650 ATTAAGAACCTGGAGGCTGGAGG + Intergenic
1084982453 11:72837726-72837748 AGGAAGAACCTGGTGGCTCGTGG - Intronic
1087044784 11:93835841-93835863 AGGAGGAACTCGGTGGCTGGAGG + Intronic
1089826743 11:121284531-121284553 AGCAAGAAACTGGTTTCTCGTGG + Intergenic
1089834843 11:121361230-121361252 AGGAAGATATTGGTGGCTGGTGG - Intergenic
1090246399 11:125218892-125218914 AGAAAGAACCTGGGTGCTTGTGG - Intronic
1090949228 11:131458151-131458173 AGGAAGAGCCTGGAGGCAGGAGG + Intronic
1097136757 12:56863538-56863560 AGGAAGGACCTGGTGGGAGGTGG + Intergenic
1101650862 12:106675924-106675946 AGGCAGGACCTGGTGGGTCTGGG + Intronic
1102255780 12:111414163-111414185 AGGAAGAACATGGTGGCCAAGGG + Intronic
1104310327 12:127649005-127649027 AGGAAGAGCCTGGTGCCTGGAGG - Intergenic
1107921551 13:45213364-45213386 AGGTAGAAGCTGGGGCCTCGTGG - Intronic
1112899252 13:104339244-104339266 AGGAAGGTCCTGGAGGCTCCTGG - Intergenic
1114620842 14:24095064-24095086 AGGACGAGCCTGGGGGCTCCAGG - Intronic
1121874860 14:97441993-97442015 AGGAAGAACCAGGGGGCTGGAGG - Intergenic
1130986441 15:88847717-88847739 GGGAAGGATCTGGTGGCTCCTGG - Intronic
1132500624 16:283168-283190 AGGCAGAAGCTGGCGGCTCATGG - Exonic
1132858540 16:2058283-2058305 TGGAAGAACCTGCTGGCAAGAGG - Intronic
1133280828 16:4664325-4664347 AGGAAGCACATGGTGGCTGCCGG + Intronic
1136590897 16:31217061-31217083 AGGTAGGACCTGATGGCTCCAGG - Exonic
1137545285 16:49398653-49398675 AGGAAGAAGATGGTGCCACGTGG - Intronic
1138105657 16:54286040-54286062 GGGAAGGACATGGTGGCCCGCGG + Exonic
1140084633 16:71783900-71783922 AGTAGAAAACTGGTGGCTCGGGG - Intronic
1140455926 16:75105514-75105536 AGGAAGAAGCTCTGGGCTCGAGG - Intronic
1141262542 16:82467081-82467103 ATGAAGAACCATGTGGCTTGAGG - Intergenic
1141775174 16:86118099-86118121 ATGATGAACCTGGGGGCTCTGGG + Intergenic
1143315946 17:6033525-6033547 AGGAAAAGCCAGGTGGCTCCTGG + Intronic
1144195853 17:12894417-12894439 AGAAAGAACCTGGATGCTGGAGG - Intronic
1144628369 17:16857075-16857097 AGGAGGAACCAGCTGGCTCTGGG + Intergenic
1144952463 17:19001668-19001690 AGGAAGCTCCAGGTGGCTCATGG + Intronic
1145159961 17:20567645-20567667 AGGAGGAACCAGCTGGCTCTGGG + Intergenic
1145281895 17:21474145-21474167 AGGAAGAAGAGGGTGGCTCTGGG - Intergenic
1145395554 17:22491475-22491497 AGGAAGAAGAGGGTGGCTCTGGG + Intergenic
1146399195 17:32490058-32490080 AGGCAGAACCTGGTGGCTGGAGG + Exonic
1146943930 17:36861587-36861609 GGCAAGAACCAGGTGGCTAGAGG - Intergenic
1147363901 17:39947895-39947917 AGGAAGAAGCTGGTGGCGGAAGG - Intergenic
1152089942 17:78240727-78240749 AGGAAGCTCCTGGGGGCTTGAGG + Exonic
1152234936 17:79133734-79133756 AGTAGGAACCTGGTGTCTCCTGG - Intronic
1152379355 17:79934429-79934451 TGGAGGAACCTGGTGGCTCAGGG - Exonic
1152559562 17:81071186-81071208 AAGGAGAAGCTGGTGGCTGGAGG + Intronic
1153926876 18:9842311-9842333 AGGATGAGCCTGGTTGCTGGAGG - Intronic
1155766323 18:29638072-29638094 AGGAAGAATCTGATGGCCAGGGG - Intergenic
1159932280 18:74326057-74326079 AGGAAGACCCTGGTGGTTTATGG + Intronic
1160243061 18:77136659-77136681 AGGAAGAACGTGGAGGCAGGAGG - Intergenic
1160474201 18:79167784-79167806 AGGAACAACCTGAAGCCTCGGGG - Intronic
1162305788 19:9872610-9872632 TGGAAGAGCCTTGTGGGTCGGGG + Intronic
1162901264 19:13796458-13796480 AGGTGGAATCTGGAGGCTCGAGG - Intronic
1163324464 19:16594303-16594325 AGGCAGCCCCTGGTGGCTCTGGG + Intronic
1163699400 19:18779811-18779833 AATAAGAACCTGGTGGACCGAGG + Exonic
1163758639 19:19121208-19121230 GGGAAGATCCTGGGGGGTCGGGG - Intronic
1165483876 19:36083578-36083600 AGGAGGGTCCTGGTGGCTCTGGG + Intronic
1165906388 19:39197038-39197060 AGGCAGCTCCTGGAGGCTCGCGG - Exonic
1167119341 19:47507402-47507424 AGGAAGTGCCTGGTGGATGGAGG - Intronic
1167303969 19:48696365-48696387 AGGAAGGACCTGGTGGCCCGGGG - Intronic
1167805907 19:51785162-51785184 AAGAAGAACTTGGTGGGTGGGGG - Intronic
932206989 2:69892066-69892088 AGGAAGAACATGGTGGCCTCAGG - Intergenic
932569114 2:72928542-72928564 AGAAAGCACCTGGTTGCTCCAGG + Intronic
935371557 2:102352126-102352148 GGGAAGAAAATGGTGGCTGGAGG - Intronic
935725264 2:106018406-106018428 AGGAAGGACGTGGTGACTCCAGG - Intergenic
937469933 2:122166071-122166093 AGGAAGATCATGGTGGCCCCTGG - Intergenic
943395668 2:187329552-187329574 AGGAGGAACCTGGTGGGAGGTGG + Intergenic
948835359 2:240623739-240623761 AGGTGGAACCTGGTGGCAAGGGG + Intronic
948961967 2:241346286-241346308 AGGAGGAACATTGTGGCTCAGGG - Intronic
1169066780 20:2698320-2698342 AGGGAGGACCTGGTGGCTGCAGG - Intronic
1172667350 20:36609663-36609685 AGGAAGAATATGGTGGCACGTGG + Exonic
1173830767 20:46085767-46085789 AGGAAGAATCTAGTGGCTAGAGG + Intronic
1175215217 20:57389114-57389136 AGGCAGAAGCTGGTGACCCGTGG + Intergenic
1175549170 20:59805601-59805623 AGGAAGAGCCATGTGGCTGGGGG + Intronic
1176065420 20:63191765-63191787 GGGAGGAGCCTGGTGGCTCGAGG + Intergenic
1179949197 21:44700190-44700212 AGGAAGAACTTGGTGACTTCAGG + Intronic
1181547835 22:23613223-23613245 AGGGATAACCTGGAGGCTCCTGG + Intronic
1182080089 22:27522614-27522636 AGGAAGAATCTGGTGGCACCTGG - Intergenic
1183223510 22:36532830-36532852 AAGAAGAATATGGTGGCTAGAGG - Intergenic
1183334244 22:37237520-37237542 AGGCAGAACCTGGTGGGGCCTGG + Intronic
1183368031 22:37417499-37417521 AGGAAGCCCCTGTTGGCTCAAGG - Intronic
1183688943 22:39377358-39377380 AGGAAGAACCAGGTGACCCCAGG + Intronic
1184431332 22:44442959-44442981 AGGAGGTGCCTGGTGGCTCAGGG - Intergenic
1184627901 22:45752407-45752429 AGGAAGAACCTCCTGGATCCAGG + Intronic
950578269 3:13846108-13846130 AGGCAGAAGGTGGTGGCTCAAGG + Intronic
954150104 3:48653047-48653069 AGGAGGAACCAGGTGGCCGGCGG - Exonic
955355761 3:58231029-58231051 AGGCAGGACATGGTGGCTCAGGG + Intergenic
956740556 3:72272428-72272450 AGCATGAGCCTGGTGGTTCGGGG + Intergenic
961148523 3:124616095-124616117 AGGAAGTAACAGGTGGCTAGAGG - Intronic
961791556 3:129380280-129380302 ACCAAGAACCTGATGGCTTGTGG + Intergenic
963731743 3:148981384-148981406 AAAGAGAACCTGGTGGCTGGAGG + Intergenic
967574399 3:191073578-191073600 AGGAAGAGCCTGGTTGGGCGCGG - Intergenic
967820221 3:193833186-193833208 AGGAAGGCCCTGCTGGCTCCTGG - Intergenic
969415514 4:7055418-7055440 AGGAAATAGCTGGTGGCTTGCGG - Exonic
971362101 4:25947562-25947584 ATGAAAATCCTGGTGGCTCCTGG - Intergenic
972072552 4:35038944-35038966 AGGAAGGACCTGAAGGCTTGGGG + Intergenic
980990521 4:139735235-139735257 AGGAATTCCCTGGTGACTCGAGG + Intronic
982754161 4:159198827-159198849 ATAAAGAAAATGGTGGCTCGAGG + Intronic
982901607 4:161011126-161011148 AGATACAACCTGGTGGCTCAGGG + Intergenic
988253840 5:28797976-28797998 AGGGAGAACATGGTGGGTAGAGG + Intergenic
995383494 5:111563149-111563171 AGGAAGAACTAGCTGGCTCTAGG - Intergenic
996011536 5:118486217-118486239 AGGAAGGACCTGGAGGCTCAAGG + Intergenic
996398235 5:123034431-123034453 AGGAGGAAGCTGGTGGCTGCAGG - Intronic
996763429 5:127010028-127010050 AAGAGGAACCTGGTGACTCCTGG + Intronic
1001953107 5:175829921-175829943 AGGGAGGACCTGGTGGCTGGTGG - Intronic
1003194553 6:3903176-3903198 AGGAAGCAGCTGATGGCTCTGGG + Intergenic
1003869554 6:10390972-10390994 AGGAAGAGCCGGGAGGCTCCAGG - Intergenic
1003958024 6:11183898-11183920 ATGAAGAACCTGATGGCTTGTGG + Exonic
1005598422 6:27401833-27401855 GAGGAGAACCTGGTGGTTCGGGG - Exonic
1006269798 6:32955355-32955377 TGTAAGAATCTGGTGGCACGAGG + Intronic
1007102688 6:39260960-39260982 AGGAAGAGCATGGTGGCCAGTGG - Intergenic
1008023836 6:46611110-46611132 TGGAAGAAGCTGGTGGCTGGAGG - Intronic
1014750231 6:125246804-125246826 AGGAAGAATCTGGTGACTAGGGG - Intronic
1017522845 6:155216897-155216919 AGGAAGAGCTTGGTGGCGCTAGG + Intronic
1018453612 6:163932028-163932050 AGGAAGAAGGTAGTGGCTGGAGG + Intergenic
1019520805 7:1459757-1459779 AGGCAAAACCTGGAGGCTGGGGG - Intergenic
1022829831 7:34054835-34054857 AGAAGGAAACTGGTGGTTCGTGG + Intronic
1023879052 7:44308340-44308362 AGGAAGGCCCAGGTGGCTGGGGG + Intronic
1024801687 7:53087150-53087172 AGGAAAGACCTGGGGGCTCCTGG + Intergenic
1025214332 7:57043222-57043244 AGGGAGAAACTGGTGGCACAGGG - Intergenic
1025657621 7:63533591-63533613 AGGGAGAAACTGGTGGCACAGGG + Intergenic
1029657627 7:101937350-101937372 AGGCAGAACCTGGTGGCCATAGG + Intronic
1030259131 7:107544037-107544059 AGGAAGACCCTCATGGCTCCAGG + Intronic
1030682486 7:112448768-112448790 AGGAAGAAACTTCTGGCTGGAGG + Intronic
1035055998 7:156037139-156037161 AGGAAGAGCCTGGTGGGAGGAGG - Intergenic
1037797744 8:22010595-22010617 CCGAAGAACGCGGTGGCTCGGGG + Intergenic
1040290221 8:46120390-46120412 AGGACAAACCTGGGGGCTTGTGG + Intergenic
1040338107 8:46426444-46426466 GGGAAGACCCTGGTGGCTACTGG - Intergenic
1041094273 8:54333443-54333465 AGGAAGAACTTTGAGGCTGGTGG + Intergenic
1046751712 8:117933733-117933755 AGGAAGAAACAGGAGGCACGGGG + Intronic
1047507585 8:125491903-125491925 AGCAAGAACATGGTGACTCGGGG + Intergenic
1053016596 9:34665567-34665589 AGGAGGAACCAGGCGGCTCCGGG - Intronic
1053367743 9:37535677-37535699 AGGAGGAGCCTGGTTGCTTGAGG - Intronic
1056762611 9:89425879-89425901 AGGAGGAAGCTGTTGGCTCAGGG - Intronic
1060478219 9:124000420-124000442 AGGGAGGACCTGGTGGCAAGTGG + Intergenic
1060662759 9:125414061-125414083 AGGAAGGAGGTGGTGGATCGGGG + Intergenic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1187354357 X:18552979-18553001 AGGAAGAACCTGGTTGCTGAGGG + Intronic
1190626438 X:52342645-52342667 GGGAAGCACCTGGTGGGTCCGGG + Intergenic
1190701568 X:52993193-52993215 GGGAAGCACCTGGTGGGTCTGGG - Intronic
1195931487 X:110081833-110081855 AGGAAGAACATGCTGGCCCCTGG - Intronic
1197792314 X:130268518-130268540 AGGTAGAGCCTGGCGGCCCGCGG - Intronic
1197795996 X:130299406-130299428 AGGGAGAACCTGAAGGCTGGAGG - Intergenic