ID: 1084982665

View in Genome Browser
Species Human (GRCh38)
Location 11:72839553-72839575
Sequence CTCTGCAAGGTATACCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084982665 Original CRISPR CTCTGCAAGGTATACCTGGC AGG Intronic
901391578 1:8949513-8949535 CTGTGCAAGCCATTCCTGGCAGG - Intronic
906154615 1:43606673-43606695 CCCTACAAGGTGGACCTGGCAGG - Intronic
907825177 1:58009427-58009449 CTGTGTAAGGTATAGCTTGCTGG + Intronic
908011088 1:59777942-59777964 CTCTGTAAGGCATAGCTGGTGGG - Intergenic
909251728 1:73365879-73365901 CTTTGGAAGGTATACCTAGATGG - Intergenic
909403068 1:75256273-75256295 CTCTGCAAGGTAGACCTTCAGGG + Intronic
909466533 1:75979806-75979828 CTCAAGAAGGTATACCTGGCAGG - Intergenic
910445316 1:87294056-87294078 CTCTGCAAGAGATACCTGTGTGG + Intergenic
923885252 1:238147117-238147139 CTCTTCAAGGTATATCTCTCTGG - Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1068991157 10:63152431-63152453 CTCTAAAAGGTACATCTGGCTGG - Intronic
1072061055 10:91811001-91811023 CACTGCAACCTATACCTGCCGGG + Intronic
1077502753 11:2916747-2916769 CTGGGCAGGGTGTACCTGGCGGG - Intronic
1079042655 11:17073069-17073091 CACTGCAAGCTCTACCTGCCGGG - Intergenic
1081930258 11:46865161-46865183 CTCTGAAAGGGATGCCAGGCTGG - Exonic
1082212770 11:49525673-49525695 CTCTGTGAGGCATACCTAGCAGG - Intergenic
1083631201 11:64096373-64096395 GTCTGCCAGGTAGAGCTGGCAGG + Intronic
1084982665 11:72839553-72839575 CTCTGCAAGGTATACCTGGCAGG + Intronic
1086636825 11:89098837-89098859 CTCTGTGAGGCATACCTAGCAGG + Intergenic
1086993800 11:93333821-93333843 CTCTGCTATGGATACCAGGCAGG - Intronic
1090112539 11:123929349-123929371 GTCTGGAAGGTAAACGTGGCAGG - Intergenic
1094549842 12:31440687-31440709 CTTTGCAAGGTTGACCAGGCTGG + Intronic
1098167643 12:67714583-67714605 CTCTGCATATTATACCTGGCTGG + Intergenic
1101162646 12:101994522-101994544 CTCTGCTGGTTATTCCTGGCAGG + Intronic
1101807136 12:108073849-108073871 CTCCCCAAGGTAAACCAGGCAGG - Intergenic
1103454757 12:121056435-121056457 CTCTCCAAGATATTCATGGCAGG + Intergenic
1105065199 12:133191239-133191261 CACTGCAAGGTATACCTCCTGGG - Intronic
1108182771 13:47857299-47857321 TTCTCCATGGTATCCCTGGCTGG - Intergenic
1118733517 14:68685866-68685888 GCTTGAAAGGTATACCTGGCAGG - Intronic
1122673743 14:103392743-103392765 CTCTACAAAGTATTGCTGGCTGG - Intronic
1124706777 15:31973178-31973200 ATCTGCAAAGAAGACCTGGCTGG + Intergenic
1125530448 15:40409910-40409932 CTCTGCAAGCTCCACCTGCCAGG + Intronic
1130182677 15:81646169-81646191 CTCTGCAAGGTGGGACTGGCAGG - Intergenic
1130959060 15:88647884-88647906 CTGTGCAAGGGCTACCAGGCTGG - Intronic
1132385122 15:101394891-101394913 ATCTGCAAGGTGAACCTGTCGGG + Intronic
1132585188 16:703102-703124 CCCTGTGAGGTACACCTGGCAGG - Intronic
1132810441 16:1794316-1794338 CTCTTCTAGGAATGCCTGGCAGG + Intronic
1134801844 16:17091752-17091774 CTCTGGAAGGTAGAGCTGGGCGG + Intergenic
1136990749 16:35150029-35150051 CCCTGCAAGGGTTACCTTGCTGG - Intergenic
1139359390 16:66388117-66388139 CCCTTCAAGGTTGACCTGGCTGG + Intronic
1140122859 16:72098655-72098677 CCCTTCAAGGTCTACCTGGGAGG + Exonic
1147636760 17:41968678-41968700 CTCTTCCAGGAAGACCTGGCCGG - Exonic
1151337398 17:73447911-73447933 CTCTGCAAACTAAACGTGGCGGG - Intronic
1156887841 18:42156292-42156314 CTCTGAAAGGGATATCTGGATGG - Intergenic
1157677995 18:49581635-49581657 CTCTGAAAGGCATGCCTGCCCGG - Exonic
1159616502 18:70586116-70586138 CTTTGCCAGGTATTCCTGGGTGG - Intergenic
1160339941 18:78080856-78080878 CTCTGCAAGGTAAACCAGCATGG + Intergenic
1166430694 19:42724387-42724409 CTCTGCCATGGAGACCTGGCAGG - Intronic
925068285 2:947168-947190 CACTGCAAGCTCTACCTCGCTGG - Intergenic
939020058 2:136947882-136947904 CCCTGCAAGTTGGACCTGGCAGG - Intronic
939670231 2:145001992-145002014 CTGTGGAAGATATTCCTGGCAGG + Intergenic
946055196 2:216895083-216895105 CTCTGCCATGTCTGCCTGGCAGG + Intergenic
948122781 2:235543500-235543522 CTCGGCCTGGTCTACCTGGCTGG + Intronic
1169181932 20:3576990-3577012 CCCTGCAAGGCCTACCGGGCAGG - Exonic
1170570768 20:17631183-17631205 CTCTGCCAGGTGTCCCGGGCAGG + Intronic
1171186080 20:23125391-23125413 CTCTGGCAGGTGTGCCTGGCGGG + Intergenic
1174919926 20:54690997-54691019 CTCTGCAACCTCTACCTGCCAGG + Intergenic
1184463895 22:44657907-44657929 CACTGCAAGCTCTACCTGCCAGG - Intergenic
1184716351 22:46284293-46284315 CTCCGCAGGGTGTACCTGCCTGG + Intronic
950052046 3:9999315-9999337 CTCTGCAATCTCTACCTTGCGGG + Intronic
952805771 3:37350086-37350108 CTCCCTAAGGAATACCTGGCAGG + Intronic
956445994 3:69326307-69326329 CTCTCCAGGGTTTAACTGGCGGG - Intronic
960127541 3:114016902-114016924 CTCAGAAAGGAATAGCTGGCAGG - Intronic
962042175 3:131718802-131718824 ATATGCCAAGTATACCTGGCTGG - Intronic
962418276 3:135203629-135203651 GTCTGAAAGCTAAACCTGGCTGG - Intronic
962566712 3:136667889-136667911 CTCTAGAAAGTAGACCTGGCCGG + Intronic
962894282 3:139699828-139699850 CTCTGCAAGATCTACCTGTGAGG - Intergenic
963136920 3:141914601-141914623 CTCTTCAAGGGAGACCTTGCAGG - Intronic
964731408 3:159870392-159870414 CTTTGTAAGTTATACCTGGGAGG - Intronic
966936738 3:184715317-184715339 CTATGAAATGCATACCTGGCTGG - Intergenic
967648011 3:191950279-191950301 CACTGCAGGGTATACTTGGCTGG - Intergenic
973119889 4:46508965-46508987 CACTGCAAGCTCTACCTCGCGGG - Intergenic
975390733 4:73814233-73814255 CTTTGAAAGGTATAGCTGTCAGG - Intergenic
977679313 4:99781437-99781459 CACTGCAACGTCTACCTCGCGGG - Intergenic
977688094 4:99872248-99872270 ATCTTCAAGGTATGCCTGGATGG - Intergenic
979938748 4:126732059-126732081 CACTGCAAGCTCTACCTCGCGGG - Intergenic
982177412 4:152718904-152718926 ATCTGTAAGGGATACCTGTCTGG - Intronic
983227110 4:165095550-165095572 TTCTGGAAGGAATTCCTGGCAGG - Intronic
984184414 4:176525724-176525746 CTCTGCATGGTTTTCCTTGCTGG - Intergenic
987883387 5:23779688-23779710 CTCTACAAGGTGTACATGGAAGG + Intergenic
997263104 5:132478683-132478705 CTCAGAAGGGTATAGCTGGCTGG - Intergenic
1001141036 5:169144268-169144290 CTCAGCAAGGTAAACATGGGAGG - Intronic
1002360981 5:178670637-178670659 CTCTGCCAGGAATATCTGCCTGG + Intergenic
1003801078 6:9668152-9668174 CTCTGGAAGGTGAAGCTGGCTGG + Intronic
1004979633 6:21008726-21008748 CTCTGCACCGTATATATGGCAGG + Intronic
1007397116 6:41584291-41584313 TCCTGCAAGGTAGGCCTGGCTGG - Intronic
1009018335 6:57927102-57927124 CTCAGCACTGTGTACCTGGCAGG - Intergenic
1014673147 6:124331451-124331473 CACTGCAAGGTCTGCCTCGCAGG - Intronic
1016340403 6:143055886-143055908 CTCTGAATGGTCTACCTGGATGG - Intergenic
1018862450 6:167720871-167720893 CAGTGCAAGGGATACCTCGCTGG - Intergenic
1027660499 7:80982480-80982502 CACTGCAAGGTCTGCCTGCCGGG - Intergenic
1027893443 7:84008413-84008435 CACTGCAAGCTCTACCTCGCCGG - Intronic
1032500789 7:132398331-132398353 CTCAGCAGGGTCTTCCTGGCAGG - Intronic
1046313797 8:112474114-112474136 CTCTGCAAGTTATAGCCAGCAGG + Intronic
1057207406 9:93181964-93181986 CTCTGCAAGGAATCTCAGGCTGG - Intergenic
1062120808 9:134833128-134833150 CTCTGCAGGGAAGGCCTGGCTGG - Intronic
1187676901 X:21725170-21725192 CTCTGCAAGGTAATCATAGCTGG + Intronic
1194961442 X:100240881-100240903 TTCTGCAGGGATTACCTGGCTGG - Intergenic
1198361033 X:135895161-135895183 CTCTCCCAGGTATAACTAGCTGG + Intronic
1199095838 X:143737409-143737431 GTCTGCAAAGTATTCCTGGTGGG - Intergenic
1199137202 X:144267036-144267058 CACTGCAAGCTACACCTCGCAGG + Intergenic
1201426704 Y:13859422-13859444 CTCTGCAAGCTACACCTCCCAGG + Intergenic
1201856956 Y:18555066-18555088 CTCTGCAAGCTTTACCTCCCTGG - Intronic
1201876365 Y:18765314-18765336 CTCTGCAAGCTTTACCTCCCTGG + Intronic