ID: 1084994142

View in Genome Browser
Species Human (GRCh38)
Location 11:72958888-72958910
Sequence CTGTTTCCATAGATGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 316}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084994142_1084994146 21 Left 1084994142 11:72958888-72958910 CCCATTTCCATCTATGGAAACAG 0: 1
1: 0
2: 2
3: 28
4: 316
Right 1084994146 11:72958932-72958954 TCTCAATTATTTTCTTGCTTCGG 0: 1
1: 0
2: 5
3: 55
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084994142 Original CRISPR CTGTTTCCATAGATGGAAAT GGG (reversed) Intronic
902170718 1:14608548-14608570 CTGTTTGGATAGATTGGAATTGG + Intronic
902696214 1:18142714-18142736 TTGTTTGCATATATGCAAATTGG + Intronic
903038446 1:20510413-20510435 TTCTTTCCATAGAAGGGAATGGG + Intergenic
904474855 1:30758104-30758126 CTGTTTCCTCATCTGGAAATGGG - Intergenic
905644856 1:39618016-39618038 CTGTTTCCTTATCTGTAAATTGG + Intergenic
905651583 1:39660587-39660609 CTGTTTCCAGTGAGGGAAACAGG + Intronic
906029981 1:42711159-42711181 GTGGTTCAATATATGGAAATTGG - Intergenic
906132199 1:43467238-43467260 CCATTTCCATAGCTGGGAATGGG + Intergenic
907010920 1:50961953-50961975 GTGTTTCCTTAAATGAAAATAGG + Intronic
907566730 1:55442470-55442492 CTGTTTTCACTGAAGGAAATAGG - Intergenic
907894421 1:58672189-58672211 CTGGTACCATTGATTGAAATGGG - Intronic
908532530 1:65047318-65047340 CAGTTTCCATATCTGTAAATGGG + Intergenic
908620388 1:65973160-65973182 CAGTTTCCTTCTATGGAAATGGG - Intronic
908824756 1:68122746-68122768 CTCTTTCCACTGATTGAAATGGG + Intronic
910283909 1:85531818-85531840 CTGTTTCCCCAGTTGAAAATGGG - Intronic
911405848 1:97438285-97438307 CTTTATCCATAGATAAAAATGGG + Intronic
911939417 1:104022491-104022513 CAGTTTCCATAGATGAAAATGGG - Intergenic
912889906 1:113519063-113519085 CTGTTTTCATAGAGAGAATTAGG - Intronic
913083645 1:115413689-115413711 CTATTTCCACATAAGGAAATTGG - Intergenic
913658573 1:120985296-120985318 CTGTTTCATCAAATGGAAATGGG - Intergenic
914009937 1:143768416-143768438 CTGTTTCATCAAATGGAAATGGG - Intergenic
914206110 1:145531167-145531189 CTGTTTCCCCAGTTGAAAATGGG + Intergenic
914523185 1:148436540-148436562 CTGTTTCATCAAATGGAAATGGG - Intergenic
914648558 1:149677077-149677099 CTGTTTCATCAAATGGAAATGGG - Intergenic
917368609 1:174262528-174262550 ATGTTACCATAGGGGGAAATGGG - Intronic
917527972 1:175806168-175806190 GTGTTCCCATAGATAGAACTTGG - Intergenic
918102249 1:181386545-181386567 CTTTTTGCAGTGATGGAAATTGG + Intergenic
918533535 1:185549367-185549389 CTGTCTCCATAAATGGCACTTGG - Intergenic
919421211 1:197372536-197372558 GTGTTGCCATAAATGGCAATGGG - Intronic
919657364 1:200210646-200210668 CTGTTTATATGAATGGAAATTGG + Intergenic
920525751 1:206664647-206664669 CTGTTTCCATATCTGTAATTTGG + Intronic
921153225 1:212418114-212418136 ATGTGACCTTAGATGGAAATAGG + Intergenic
921750168 1:218783037-218783059 GTGTTTACACAGGTGGAAATAGG + Intergenic
924714907 1:246564571-246564593 CTGTTTCCTTATATGTAAAAAGG - Intronic
1063600063 10:7473086-7473108 CTGTTACCTTAGATGGCAAAGGG - Intergenic
1064084167 10:12332700-12332722 CAGTTTCCATATCTGGAAAATGG - Intergenic
1064679461 10:17795370-17795392 CCGTTTCCATAGTTGTAAAATGG + Intronic
1065123786 10:22553408-22553430 CTGTTTCCATAGATGCAGAAAGG + Intronic
1066524860 10:36266435-36266457 ATGTTTACATTGATGGACATAGG + Intergenic
1067452571 10:46391293-46391315 CTGTTTCAGTAGATGGGAATGGG - Exonic
1067584661 10:47468462-47468484 CTGTTTCAGTAGATGGGAATGGG + Exonic
1068204667 10:53834727-53834749 CTGCCTCCATTGATGGATATGGG + Intronic
1068672858 10:59741682-59741704 CTGTTTCAAAATAAGGAAATAGG - Intergenic
1069168920 10:65200577-65200599 CTATTCCCATAGATGCAAGTTGG - Intergenic
1069326659 10:67239250-67239272 CTGTGTCTTTAGATGGACATAGG - Intronic
1071022173 10:81070433-81070455 CTTTTTCTATATATGGCAATCGG + Intergenic
1071583214 10:86792884-86792906 CTGTTTCCCTATATATAAATGGG + Intronic
1072417206 10:95259171-95259193 ATGTTACCATTGAGGGAAATTGG + Intronic
1072541339 10:96400474-96400496 CTGTTTCCAAACTGGGAAATGGG - Intronic
1074741713 10:116491507-116491529 CTGTTGCCAATGATGTAAATAGG - Intergenic
1077582399 11:3424873-3424895 CTGATTCCATAGATTGGAAGCGG + Intergenic
1078550848 11:12279718-12279740 CTGTCTCCACACATGGAACTCGG + Intronic
1078906913 11:15696093-15696115 CAGTTTCCATATCTGGAGATTGG + Intergenic
1079095682 11:17508753-17508775 TTTTTTCTATAGCTGGAAATTGG + Intronic
1079257427 11:18844195-18844217 CTGTTTCCCTAGGAGTAAATGGG - Intergenic
1079607172 11:22384587-22384609 CTGTCTCCATAAATGGAAGGTGG + Intergenic
1080842235 11:35995138-35995160 CTGATTCCTTTGATGGATATGGG - Intronic
1081889532 11:46529298-46529320 CTGTTTCCAAAGGGGGAAAATGG - Intronic
1084833126 11:71785153-71785175 CTGATTCCATAGATTGGAAGCGG - Intergenic
1084994142 11:72958888-72958910 CTGTTTCCATAGATGGAAATGGG - Intronic
1085175050 11:74478542-74478564 ATTTTTCAATAGATGAAAATAGG - Intergenic
1086009722 11:82085895-82085917 ATGTTTCCATAGACGGAAGTGGG - Intergenic
1086402035 11:86468902-86468924 CTGTTTCCAGAGAAGGAATCTGG + Intronic
1086860768 11:91922425-91922447 CTGTTTCCTTAGCTGTAAAATGG + Intergenic
1087082192 11:94182028-94182050 CTATTTACATAGTTGGAATTGGG - Intergenic
1088346533 11:108833335-108833357 CTTTTTCCATAGATAGAGTTGGG + Intronic
1088608619 11:111555904-111555926 CTGTGTCCATAAAATGAAATAGG + Intronic
1088977919 11:114832205-114832227 GTGTTTCTCTAGCTGGAAATTGG - Intergenic
1089999060 11:122938115-122938137 CTGTTTTCATAGATTGAGCTGGG + Intronic
1090670946 11:128944891-128944913 CTGTGTCAAGAGATGGGAATAGG - Intergenic
1091242794 11:134065329-134065351 CTGTTTCCTTAGAGGGAGGTGGG + Intergenic
1091508215 12:1094785-1094807 CTATTACCAGAGATGGTAATGGG + Intronic
1091602896 12:1928704-1928726 CTGTTTCCAGAGAGGGAACCGGG - Intergenic
1092611177 12:10174674-10174696 CTGTGTACATACATAGAAATAGG - Intronic
1092649050 12:10613327-10613349 CTGCTTCCCTCGAAGGAAATAGG - Intronic
1092666288 12:10802843-10802865 CTGTTTACTAAGATGCAAATTGG + Intergenic
1092829888 12:12433569-12433591 ATGTTTCCATTGAGGGAAATTGG + Intronic
1093144498 12:15548907-15548929 CTGCTTCCATGGAAGGGAATTGG + Intronic
1093634974 12:21455517-21455539 CTGTTTGCAAAGATGCAGATGGG - Intronic
1093707391 12:22289319-22289341 CTGTTTCCTCAGATGAGAATTGG - Intronic
1097524384 12:60711970-60711992 CTGTTTCCAGAACTGGATATTGG + Intergenic
1099213558 12:79824088-79824110 CTATTTCCCAAGATTGAAATGGG - Intronic
1100188998 12:92170625-92170647 CTGTAGCCATGGATGGAAGTGGG - Intergenic
1100564703 12:95784167-95784189 CAATTTTCAAAGATGGAAATTGG + Intronic
1101635530 12:106537607-106537629 ATTTTTCCATAGATGGGAGTAGG - Intronic
1101870731 12:108563126-108563148 CTGTTTCCCCAGGTGTAAATGGG + Intronic
1102906065 12:116676063-116676085 CTGTTGCCAGAGGTGGAAATTGG + Intergenic
1102991606 12:117320197-117320219 ATGTTTCCTTAGATGGAGAAAGG + Intronic
1104287354 12:127436244-127436266 ATGTCTCTATAGATGTAAATAGG - Intergenic
1106453084 13:29902069-29902091 CAGTTTCCATAGCTGCAAAATGG + Intergenic
1107435833 13:40380089-40380111 CTGTCTCCCTAGCTGGATATGGG + Intergenic
1108080245 13:46727739-46727761 TTGTTACCATTGAAGGAAATTGG + Intronic
1108256998 13:48620502-48620524 CTTTTTCCATTGTTGGAACTTGG - Intergenic
1108932065 13:55837502-55837524 CTGTTTCCTCATCTGGAAATGGG + Intergenic
1109741987 13:66565849-66565871 TTTTTTCCATAGGAGGAAATAGG - Intronic
1111265424 13:85805972-85805994 ATGTTTCCATATACTGAAATGGG + Intergenic
1111348029 13:86988794-86988816 CAGTTCCCATAGATGTGAATAGG + Intergenic
1111761683 13:92474270-92474292 CTGTTTGCATAGATTGTAATAGG + Intronic
1112047926 13:95616348-95616370 TTGTTTTCATAGATGGAGAAAGG - Intronic
1112884949 13:104158822-104158844 CTGTTTCCTTAGATGGTAGAAGG + Intergenic
1113022010 13:105897570-105897592 CTGTTACCAAAGATTGCAATAGG - Intergenic
1115616896 14:35104042-35104064 TTGTTTCCATCCATGGAAAGAGG + Intronic
1117299772 14:54413165-54413187 CTTTTTCCATAGAGGAAGATGGG - Intronic
1117846023 14:59912761-59912783 ATGTTACCATATTTGGAAATAGG - Intergenic
1118513827 14:66505869-66505891 ATTTTTCCATGGATGGAGATGGG - Intergenic
1118829644 14:69418514-69418536 CTTTTTCTATTGATTGAAATAGG + Intronic
1119795928 14:77397494-77397516 CTATTTCCATTGATGGAAAATGG + Intronic
1119802166 14:77455481-77455503 CTGTTTCCTTATTTGGAGATAGG - Intronic
1121445268 14:93974733-93974755 CTGTTTCCAGACCTGAAAATGGG + Intronic
1121720219 14:96104068-96104090 ATGTTTCCTTAGATGGCAAAAGG + Intergenic
1122412554 14:101533365-101533387 CTGAGTCCATAGATTCAAATGGG + Intergenic
1124032216 15:26021877-26021899 TTTTTGCCATAGATGGACATTGG + Intergenic
1124047291 15:26162020-26162042 CTGTTTTCTTACATGGAACTGGG + Intergenic
1125181208 15:36882483-36882505 GTGTCTCCAAAGATGGGAATGGG + Intergenic
1125692344 15:41606410-41606432 CTGTTTCCATAACTGTAAAATGG + Intergenic
1126618223 15:50608547-50608569 CTGTCTCCACTGATGAAAATAGG - Intronic
1127066511 15:55245217-55245239 CTGTCTCCACTTATGGAAATGGG - Intronic
1127351452 15:58156939-58156961 AGGTTTCCTTAGATGGAAACAGG + Intronic
1127581360 15:60341881-60341903 GGGTTTCCAGAGATGGAAAGAGG - Intergenic
1127665738 15:61145346-61145368 CTGTGTCCATATCTGTAAATTGG - Intronic
1128907904 15:71484699-71484721 CTGTTTCCACACCTGCAAATGGG - Intronic
1129683930 15:77674096-77674118 GGGTTGCCATAGATGGAGATGGG - Intronic
1129996481 15:80010593-80010615 CTGTTTCCCTATATGCAAAACGG + Intergenic
1130630996 15:85569081-85569103 GTGGTTTCATAAATGGAAATAGG + Intronic
1131493916 15:92887172-92887194 CTTATTCCATTGATTGAAATAGG + Intronic
1132019137 15:98345429-98345451 ATGTTTCCATAGCTGGACTTTGG - Intergenic
1132183734 15:99784106-99784128 CTGTTTGCATAGATTGTAATAGG - Intergenic
1132198457 15:99931668-99931690 GTGTTTCCATAGATGGAGAGTGG + Intergenic
1132434649 15:101789064-101789086 CTGTTTGCATAGATTGTAATAGG + Intergenic
1133451324 16:5906193-5906215 CTGTGTCCTTATTTGGAAATAGG + Intergenic
1133880782 16:9779667-9779689 TTCTTTCCATAGAGGGTAATAGG + Intronic
1133958087 16:10464715-10464737 ATGTTTACAGAGATGGAAAGGGG + Intronic
1135246200 16:20859389-20859411 CTGTTTACATAGATGAATTTAGG - Exonic
1135856992 16:26020919-26020941 CAGTTTCCATATATGTAAAATGG + Intronic
1137752353 16:50875911-50875933 CTGTTCACATAGCTGGAAAGTGG - Intergenic
1137925959 16:52542254-52542276 CTGTCTACATAGTTGGACATGGG + Intronic
1137953007 16:52801465-52801487 CTGTTTACATAGATGAAAAGTGG - Intergenic
1138575542 16:57905109-57905131 CAGTTTCCATATCTGTAAATGGG - Intronic
1138774393 16:59704071-59704093 CTGTTTCCATGCCTGGAAAATGG - Intergenic
1140711574 16:77683130-77683152 CAGTTTCTTTATATGGAAATGGG + Intergenic
1141007403 16:80365161-80365183 CTGTTTCCACATCTGGAAAATGG - Intergenic
1141235706 16:82214018-82214040 CCCTTTGCATAGGTGGAAATAGG + Intergenic
1144376532 17:14647889-14647911 CAGTTTCCATATCTGTAAATAGG + Intergenic
1146827631 17:36037193-36037215 TTGCTTCCAGAGAAGGAAATGGG + Intergenic
1147880090 17:43647791-43647813 CTGTTTCCTCTGCTGGAAATCGG - Intronic
1148423816 17:47572728-47572750 CTGTTTCACTAGATGGATGTTGG - Intronic
1148594362 17:48841052-48841074 CTGTTTCCTTATCTGTAAATTGG - Intronic
1150921257 17:69486006-69486028 AAGTTTACATAAATGGAAATAGG - Intronic
1151979928 17:77502741-77502763 CTGTGTGCAAGGATGGAAATTGG - Intergenic
1153366486 18:4262783-4262805 CTGTTTCCATATCTGTAAAATGG + Intronic
1153501291 18:5752515-5752537 CTGTTTCCTAAGAAGGAAAGTGG + Intergenic
1153658041 18:7302747-7302769 CTGTTCACAGAGATGGAACTCGG + Intergenic
1153663731 18:7349689-7349711 CTGTGTCTATATTTGGAAATAGG - Intergenic
1155382515 18:25239760-25239782 CTGTTGTCAGAGCTGGAAATAGG + Intronic
1156149413 18:34224477-34224499 TTGTTTCCAGAGCTGGAAATAGG + Intronic
1156335135 18:36164605-36164627 CTGTTTCCAGAGATCGAACCTGG + Exonic
1156735842 18:40258231-40258253 CTGTTTTCATAGGTTGAAAGAGG + Intergenic
1156934767 18:42690348-42690370 CTCTTACCATAAATGGAAAGAGG + Intergenic
1157357084 18:46945660-46945682 CTGTTTGCATAACTGCAAATTGG + Intronic
1158062369 18:53360967-53360989 CTGTGACCTTAGATGGAAAAGGG + Intronic
1159038857 18:63303812-63303834 ATGTTGTCATAAATGGAAATGGG + Intronic
1161437660 19:4273306-4273328 CTGTTTCCTTATCTGGGAATGGG + Intergenic
1161458614 19:4382664-4382686 CTGTTCCCTTACATGGAAAATGG - Intronic
1161465555 19:4428414-4428436 CTGTTTTGAGTGATGGAAATAGG - Intronic
1165899961 19:39164767-39164789 CTGTTTCCACAGCTGCAAAATGG + Intronic
1166400993 19:42479897-42479919 CTGGTTTCAAAGATGGAAAAGGG - Intergenic
1168065294 19:53915784-53915806 CTGTTTCCATATCTGTAAAATGG - Intronic
1168205647 19:54848716-54848738 CTGTATCTTTGGATGGAAATTGG - Intronic
925189962 2:1874819-1874841 CCGTTGCCCTAGGTGGAAATGGG - Intronic
926663585 2:15495103-15495125 CTGTTCACATAAATGGAAACTGG + Intronic
931013378 2:57944983-57945005 CTGTTTCCTCATATGTAAATTGG - Intronic
931175194 2:59847367-59847389 CTGATTCCACAGCTGGAAATTGG - Intergenic
931895507 2:66724822-66724844 CAGTTTCCTTAGTTGCAAATGGG + Intergenic
933463867 2:82625144-82625166 ATGTTACCATACATGGAAAATGG + Intergenic
933468140 2:82682708-82682730 CTGTTTTCTCAGAGGGAAATTGG - Intergenic
935014330 2:99165699-99165721 TTGTTTCCATAGAAGGAAGTAGG - Intronic
935358815 2:102230258-102230280 TTTTTTCCATAGATAGAAAATGG - Intronic
935899387 2:107774578-107774600 CTGTTTCTTTAGATGCAAAGTGG + Intergenic
936328258 2:111524032-111524054 CTGTGTGCATAGCTGGAGATGGG + Intergenic
936998732 2:118441960-118441982 AGGTTTCCAGAGATGGAACTGGG - Intergenic
938772930 2:134516136-134516158 CAGTTTCCTTAGAAGGAAAATGG + Intronic
938924075 2:136023364-136023386 CAGTTTCCATATACGTAAATTGG + Intergenic
939244328 2:139603756-139603778 CTGTTTCCAAATTTGGCAATTGG + Intergenic
940259158 2:151762739-151762761 ATTTATCCTTAGATGGAAATAGG + Intergenic
940492551 2:154382153-154382175 CTGTGTCCATAGAGGGGATTGGG - Intronic
941292343 2:163693032-163693054 CAGTTTCCTTAGGTGAAAATGGG - Intronic
942311251 2:174658970-174658992 CTGTTTCAATATCTGGAAAATGG + Intronic
942508749 2:176673099-176673121 CAGTTTCCTTTTATGGAAATAGG + Intergenic
942590352 2:177538160-177538182 CTGTTTCCAAAGATGTTATTGGG - Exonic
942596739 2:177598809-177598831 CTCTTTTCACAGATGGAAAAAGG + Intergenic
942964081 2:181868693-181868715 GTGTTTAAATACATGGAAATGGG - Intergenic
942993249 2:182228707-182228729 CTTTTACCATAGATGGAGAAAGG - Intronic
945867482 2:215192808-215192830 CTATATAGATAGATGGAAATGGG + Intergenic
945869763 2:215214365-215214387 CTGTTTCCCTACAGGGAAAGGGG - Intergenic
946926119 2:224628620-224628642 CTGTTTCCCTAGAGGCAAAATGG - Intergenic
947015883 2:225619186-225619208 TTGTTTACAAATATGGAAATTGG + Intronic
947990363 2:234482773-234482795 CTGTTTCCCTATATTTAAATTGG - Intergenic
948851421 2:240709138-240709160 CCTTTTCAATAGATGGAACTAGG + Intergenic
1169027701 20:2384358-2384380 CACTTTCCAGAGAAGGAAATCGG + Intronic
1169362253 20:4960994-4961016 CTGCCTCCAGAGATGGAAACTGG + Intronic
1170177703 20:13490803-13490825 CAGTTTCCATAGCTGTAAAATGG + Intronic
1170309575 20:14977580-14977602 CAGTTTCCTCAGCTGGAAATTGG + Intronic
1170369046 20:15628301-15628323 CTGTTTGCTTATATGAAAATGGG - Intronic
1172883379 20:38216001-38216023 CTGTTTCCTTAGGTGGAAATGGG + Intronic
1173155669 20:40606532-40606554 CTGTTTCCTTATCTGCAAATTGG + Intergenic
1173853538 20:46234147-46234169 CAGTTTCCATAGCTGTAAAATGG + Intronic
1174093645 20:48069972-48069994 TTGCTTCAAAAGATGGAAATTGG + Intergenic
1175206444 20:57315335-57315357 CAGTTTCCTTATATGGAAAATGG + Intergenic
1175711878 20:61227837-61227859 CTATTTTCATAGCTAGAAATTGG + Intergenic
1176955053 21:15092810-15092832 CTTTTTACATAGTTGGAAGTGGG - Intergenic
1177800359 21:25822853-25822875 CTGTTTTCATTGATGAAAACTGG + Intergenic
1177840151 21:26227067-26227089 CTGTTTCCATGGGTGGGAAAGGG - Intergenic
1179087880 21:38236622-38236644 CTGTTTCCATCACTGGAAAATGG - Intronic
1181952426 22:26564102-26564124 CAGTCTCCATAGTTGGAAAATGG - Intronic
1184142728 22:42587685-42587707 CTGGCTCCACAGATGGAGATGGG + Intronic
1184640557 22:45867886-45867908 CTGTTTCCAGAGCTGGAAGGAGG - Intergenic
949794186 3:7828389-7828411 CTGTTTCCATAAATGGTACCGGG + Intergenic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
951010977 3:17679051-17679073 CTTTTTCATTATATGGAAATAGG - Intronic
951138037 3:19127001-19127023 CTGTTTGCATAGGTGGACAAAGG + Intergenic
951553621 3:23899024-23899046 ATTTTTCCACAGATGGAGATGGG - Intronic
953522669 3:43657845-43657867 CTGCTTTCAAAGATGGAATTTGG - Intronic
955050519 3:55406194-55406216 CGGTTTCCATAAATGCTAATTGG - Intergenic
955392594 3:58532166-58532188 CTGTTTCCTTAACTGGAAAATGG - Intronic
955566418 3:60251771-60251793 AGATTTCCATAGGTGGAAATGGG - Intronic
957801585 3:85090885-85090907 ATTTTTCCACAGATGGAAAGGGG - Intronic
959795576 3:110424151-110424173 ATGTAACCATATATGGAAATAGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
961299596 3:125914231-125914253 CTGATTCCATAGATTGGAAGCGG - Intergenic
961888904 3:130113828-130113850 CTGATTCCATAGATTGGAAACGG + Intergenic
962387541 3:134944120-134944142 CTGGGGCCATAGAGGGAAATGGG - Intronic
964814516 3:160702413-160702435 TTTTTTCCAGAGAGGGAAATAGG - Intergenic
965832282 3:172806019-172806041 CTGTTCCTAGAGATGGAGATGGG - Intronic
966142474 3:176771535-176771557 ATGGTTCAATAGATGCAAATTGG - Intergenic
966951970 3:184828598-184828620 CAGTTTCAATGGAAGGAAATAGG - Intronic
967515170 3:190360228-190360250 CTGTTTCCAGGGAGGAAAATAGG + Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969362143 4:6671758-6671780 CTGTTTCCTCAGCTTGAAATGGG - Intergenic
969816281 4:9690069-9690091 CTGATTCCATAGATTGGAAGCGG - Intergenic
970731405 4:19107932-19107954 CTGGTTTCAAAGATGGAAAGGGG + Intergenic
971819464 4:31532400-31532422 CTGTTTCAAAAGATTGAAAAGGG - Intergenic
973611442 4:52639436-52639458 TTGGTTCCAAAGATGGAAACTGG - Intronic
973869845 4:55155313-55155335 CCCTTTCCATAGATTGAAATCGG + Intergenic
974049137 4:56924026-56924048 CAGTCTCCATAGAAAGAAATAGG - Intronic
975812912 4:78188129-78188151 TTGTTTCCATAGAAAGAAAGGGG - Intronic
976219544 4:82745012-82745034 CTTTTTCCATAGCCAGAAATAGG - Intronic
978326106 4:107558336-107558358 CTGTGTCAATAAATGTAAATAGG - Intergenic
979924198 4:126539313-126539335 CAGTTTCCTTCTATGGAAATTGG - Intergenic
980458365 4:133073750-133073772 CTGTTTCAAAAGAAAGAAATTGG - Intergenic
981491097 4:145340323-145340345 CTGTTTCCACATTTGAAAATGGG + Intergenic
981942067 4:150292241-150292263 CTGTTTTCCTAAATGGATATAGG - Intronic
981985277 4:150846816-150846838 CTGTTCTTATATATGGAAATGGG - Intronic
983040859 4:162924043-162924065 ATGTTTCCATAGATGGGGGTGGG - Intergenic
983552626 4:169032989-169033011 CTGTTTCCACAGGTGTAAATTGG - Intergenic
983621165 4:169761996-169762018 CTGTAACCATATTTGGAAATAGG - Intergenic
984152944 4:176157040-176157062 ATGTAACCATATATGGAAATAGG - Intronic
986595200 5:9414481-9414503 CTGCATAAATAGATGGAAATAGG + Intronic
987016917 5:13829925-13829947 CTGTTTTCCTGAATGGAAATTGG - Intronic
987624646 5:20382570-20382592 GAGTTTCTATAGAAGGAAATGGG + Intronic
988399742 5:30747516-30747538 CTGTGGCAATAGAGGGAAATAGG - Intergenic
990033797 5:51294662-51294684 TTGTTGCTATAGATGCAAATTGG + Intergenic
990492292 5:56314409-56314431 CTGAATCCATATATGGAAAGAGG + Intergenic
990957879 5:61361967-61361989 ATGTTTTCACATATGGAAATAGG + Intronic
993250044 5:85510110-85510132 CTGTTTTCATAGAATGAATTAGG + Intergenic
996925214 5:128817280-128817302 CTGTTTTCATAGATTGAATTGGG - Intronic
998099370 5:139419368-139419390 CTGTCTCCAGAGAGGGAAATAGG + Intronic
998249199 5:140538925-140538947 GTGCCTCCATACATGGAAATTGG - Exonic
998902858 5:146874577-146874599 CAGTTTCCTTAGCTGGAAAGTGG - Intronic
1000044102 5:157507406-157507428 CTGATTCCTTGGAAGGAAATGGG + Intronic
1000412784 5:160950983-160951005 GTGTTTCCAGAGATAGAAAATGG + Intergenic
1000928426 5:167222074-167222096 CTGTTTCCTTAGAAAAAAATTGG + Intergenic
1004365613 6:15010214-15010236 CAGTTTACATAATTGGAAATGGG - Intergenic
1006016545 6:31085795-31085817 CTGTTTTCAGAGAAGGATATGGG + Intergenic
1006304901 6:33213093-33213115 CGGTTTCTATAGCTGGAAAGAGG + Intergenic
1008226259 6:48920427-48920449 CCGTTTCAAAAGAGGGAAATTGG - Intergenic
1008691718 6:53986765-53986787 CTGTTTCCTCAGCTGAAAATGGG - Intronic
1009480687 6:64154987-64155009 ATATTTCCATAGTAGGAAATGGG + Intronic
1009490901 6:64289444-64289466 CTCCTGCCATAGAGGGAAATTGG - Intronic
1012160370 6:95877624-95877646 GTGTTTGGATTGATGGAAATTGG + Intergenic
1012250739 6:96977231-96977253 TTGTTTCCATATATGCAAAATGG - Intronic
1012409715 6:98943149-98943171 GTGTTACCATAGGTGGAAACTGG + Intronic
1012948500 6:105492916-105492938 TTGGTTCCATAGTTGGAAATGGG - Intergenic
1014089605 6:117388822-117388844 CAGTTTCCACACCTGGAAATGGG - Intronic
1014411856 6:121134504-121134526 CAGTTTAGATAGCTGGAAATTGG + Intronic
1016281251 6:142421690-142421712 CTGTTTCCATTAATGAGAATTGG + Intronic
1016550916 6:145279033-145279055 CTCTTTCCACAATTGGAAATTGG + Intergenic
1017207546 6:151819772-151819794 ATTTTTCCACAGATGGAACTGGG - Intronic
1019012487 6:168853072-168853094 CTGTTTCCATGTCTGCAAATAGG + Intergenic
1020356548 7:7282073-7282095 CTGTATCCTTAGATGGTAAAAGG + Intergenic
1020390638 7:7654299-7654321 CTGTATTCAGTGATGGAAATAGG + Intronic
1020954661 7:14726041-14726063 CTGTTTTCTTAGATGTAAAATGG - Intronic
1021061640 7:16119494-16119516 CTGTTTACATTTATTGAAATTGG - Intronic
1021969584 7:25952520-25952542 ATCTTTCCATAGGGGGAAATGGG - Intergenic
1023025349 7:36044812-36044834 CTGTTTCCTTAGCTGTAAAATGG + Intergenic
1024726185 7:52198584-52198606 CTGGTTCCATAGATTGAGTTAGG + Intergenic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1025275539 7:57579035-57579057 GTGTTTCTATAGATGGAGAGGGG - Intergenic
1027511985 7:79094557-79094579 CTGTTTCCATTAATGGACCTGGG - Intronic
1028073001 7:86475698-86475720 CTCTTTCCTTAGATGTAAAATGG + Intergenic
1028641238 7:93044029-93044051 CTATTTGCAAAGATGAAAATCGG - Intergenic
1032255703 7:130295474-130295496 CTCTTTCTGAAGATGGAAATTGG - Intronic
1033709316 7:143924427-143924449 ATGTTACCATTGATGAAAATTGG + Intergenic
1035028993 7:155845074-155845096 CTGTGACCACAGATAGAAATCGG - Intergenic
1035494180 7:159307633-159307655 CTGTTTCCATCTATGAGAATTGG + Intergenic
1036379200 8:8226218-8226240 CTGATTCCATAGATTGGAAGCGG - Intergenic
1039143045 8:34414691-34414713 GTGCTTCCATAGATGGTTATTGG - Intergenic
1039218549 8:35301127-35301149 CTGATTCCAGAGATGGAACAGGG + Intronic
1041259427 8:56007632-56007654 CTGTGTCCTTAGATGAAAAAAGG + Intronic
1041380649 8:57251246-57251268 CTTTTTGCATTGATGGAAATGGG - Intergenic
1041506151 8:58600044-58600066 CTATTTCCTTAGCTGAAAATAGG - Intronic
1042115069 8:65422440-65422462 CTGTGACCTTATATGGAAATAGG + Intergenic
1042347331 8:67740928-67740950 CTGTTTCCATGGATGACTATTGG + Intronic
1043378210 8:79673644-79673666 CTGTTTCCTCAGATGTAAATTGG + Intergenic
1043864216 8:85357405-85357427 CTGTTTCCTTATCTGAAAATGGG + Intronic
1044204449 8:89476099-89476121 CTGATTCCATAGATCTAAAGTGG - Intergenic
1046769157 8:118101197-118101219 CAGTTTCCACATCTGGAAATGGG - Intronic
1047322923 8:123805305-123805327 CTGTTTCATCAAATGGAAATGGG - Exonic
1047441176 8:124880011-124880033 CTGTTACCACAAATGGATATTGG - Intergenic
1048561330 8:135540807-135540829 CTGTTTTCATACATGGGACTTGG - Intronic
1049250149 8:141583887-141583909 CTGCTTCCAGAGATGGAAAGTGG + Intergenic
1049418571 8:142506609-142506631 CTGTTTGCAGAGATGGGAACAGG + Intronic
1049526666 8:143130258-143130280 CTTTTCCCAGAGATGGGAATCGG + Intergenic
1051322572 9:15924153-15924175 ATGTTCCAATAGCTGGAAATGGG + Intronic
1052003001 9:23310470-23310492 CTGTTTCCATATCTTGAAATGGG - Intergenic
1052261728 9:26524658-26524680 CTGTTTTCATAGACTGGAATGGG - Intergenic
1053327666 9:37170413-37170435 CTGTTTCAAAAGATTGGAATTGG - Intronic
1056186686 9:84141940-84141962 CTATTACCTTATATGGAAATAGG + Intergenic
1056995728 9:91456154-91456176 ATGTATCCATTGATGGACATAGG + Intergenic
1058739326 9:107927368-107927390 CTGTTTTCTTATATGCAAATTGG + Intergenic
1058811054 9:108639979-108640001 CTGTTTGCATGGTTGGAAAGTGG + Intergenic
1060870663 9:127037388-127037410 CTTTTTCCATTCATGGAGATTGG + Intronic
1061400218 9:130364499-130364521 ATGTTTCCACCGAGGGAAATTGG - Intronic
1186282829 X:8012566-8012588 TTGTTTCCACATATGTAAATAGG + Intergenic
1186682869 X:11894291-11894313 CAGTTTCTCTAGATGTAAATGGG - Intergenic
1187208328 X:17204181-17204203 CTGTTTCCATATCTGTAAAAAGG - Intergenic
1187343729 X:18444224-18444246 ATGGTTCCATAAATGGAAAATGG - Intronic
1188368861 X:29344336-29344358 ATAATTCCATAGATGAAAATAGG - Intronic
1188715846 X:33458012-33458034 CCATTTCCTCAGATGGAAATAGG - Intergenic
1189117961 X:38362851-38362873 CTGTTTCCTTTTATGGAAATTGG + Intronic
1190751513 X:53366067-53366089 CAGTTTCCATAGTGGGAAATAGG + Intergenic
1190803975 X:53817744-53817766 CAGTTTCCATAGTAGGAAGTGGG + Intergenic
1192061166 X:67828161-67828183 CTGGTTTCATAGAATGAAATAGG - Intergenic
1195005512 X:100681512-100681534 CAGTTTCTTTAGAAGGAAATAGG + Intronic
1195960398 X:110380098-110380120 GTGTTTCAACAGATGGGAATGGG + Intronic
1196494678 X:116310649-116310671 TTGTTTCTTTAGATGGAAGTGGG + Intergenic
1199299222 X:146193579-146193601 CAGTTTCCTTATATGGAAATAGG + Intergenic
1199886943 X:152029726-152029748 CTGTTTGCATTCATTGAAATGGG - Intergenic