ID: 1084995363

View in Genome Browser
Species Human (GRCh38)
Location 11:72972109-72972131
Sequence TATTAACGAGAGTATTGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084995363 Original CRISPR TATTAACGAGAGTATTGTAT AGG (reversed) Intronic
903677865 1:25075975-25075997 TATTCACGAGGGTTTTGTAAGGG + Intergenic
904655803 1:32046147-32046169 GATTAAGGACAGTATAGTATAGG - Intronic
904966144 1:34375081-34375103 TAATTAAGAGAGTATGGTATAGG - Intergenic
905590491 1:39159076-39159098 TATTATGGTGTGTATTGTATAGG + Intronic
911504892 1:98736559-98736581 TATCAGCGAGAATACTGTATGGG - Intronic
912071773 1:105819460-105819482 CATTAATGAGAGGTTTGTATAGG + Intergenic
912590480 1:110813960-110813982 TATTAAAGAGATTATAATATTGG - Intergenic
917172180 1:172189233-172189255 TAATAAAGAGAGTATGGTATTGG - Intronic
917206482 1:172578247-172578269 TCTTAACGAGTGTTTTGTTTTGG + Intronic
921775369 1:219093140-219093162 TATTAATGTGAAGATTGTATTGG - Intergenic
921959166 1:221016175-221016197 TATTAGCGAAAGTTTTCTATAGG - Intergenic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
1066341267 10:34536090-34536112 TTTCAACGAGAGTTTTGAATTGG - Intronic
1074091522 10:110263350-110263372 TATTACCTAGAATATTCTATGGG - Intronic
1076286313 10:129300540-129300562 TAATCAAGAGAGTATAGTATTGG - Intergenic
1076332412 10:129680094-129680116 TATGAACGAGAGGAATGTATGGG - Intronic
1078373247 11:10769730-10769752 AATTAACACTAGTATTGTATTGG + Intronic
1079145272 11:17845757-17845779 TAGAAAAGAGAGAATTGTATTGG - Intronic
1084995363 11:72972109-72972131 TATTAACGAGAGTATTGTATAGG - Intronic
1087557104 11:99734790-99734812 TTTTAAAGAGACTATTGTATAGG - Intronic
1098232338 12:68384667-68384689 TTTTAACAAGAGTAATGAATTGG + Intergenic
1101234348 12:102773653-102773675 TAATTACCAGAGTATTATATAGG - Intergenic
1106457703 13:29941834-29941856 CATTAAAGAGAAAATTGTATGGG + Intergenic
1108298137 13:49045575-49045597 CATTTAAGAGAGTATGGTATGGG - Intronic
1108613445 13:52106861-52106883 TAATAATGAGAGTATTGACTAGG - Intronic
1109385694 13:61626855-61626877 TATTAGAGAGACTATTGTGTGGG + Intergenic
1109553542 13:63938098-63938120 TATTCAACATAGTATTGTATTGG + Intergenic
1109952945 13:69525338-69525360 TCTTAAAGAGCATATTGTATTGG + Intergenic
1110279578 13:73677240-73677262 TATAAAAGAGACTATTGTTTTGG + Intergenic
1112999772 13:105620646-105620668 TTTTAATGATAGTATTGTAGTGG - Intergenic
1116220399 14:42078193-42078215 AATTAATGATAGTATTCTATGGG - Intergenic
1116316950 14:43409347-43409369 TATGAATGAGAGTTTTGTTTAGG + Intergenic
1118131649 14:62971623-62971645 CAATAAAGAGAGTATGGTATTGG + Intronic
1118537711 14:66787595-66787617 TATTCAAGATAGTATAGTATTGG + Intronic
1123794482 15:23757725-23757747 TATTAAAGGGATTCTTGTATGGG + Intergenic
1125010773 15:34871596-34871618 TATTAAACTGGGTATTGTATTGG - Intronic
1125185857 15:36929464-36929486 TTTGTACGAGAGTATTGTGTAGG + Intronic
1133465472 16:6022923-6022945 TTTTAAGGATAGTATTGTATAGG + Intronic
1138711090 16:58971326-58971348 TATTAATAAGAGTATTATAGTGG - Intergenic
1139183497 16:64775034-64775056 TATTTAAGACAGTATTGTAATGG - Intergenic
1141980091 16:87544825-87544847 TATTAATGAGAGTATTGGTTTGG + Intergenic
1145727136 17:27140462-27140484 TATGAACGTGTGTATTGTGTGGG + Intergenic
1156184440 18:34645332-34645354 TATTAATAAGATTTTTGTATGGG + Intronic
1159665243 18:71150742-71150764 AACTATAGAGAGTATTGTATAGG + Intergenic
1163967084 19:20755737-20755759 TAAAAACCACAGTATTGTATTGG - Intronic
1168484851 19:56752441-56752463 TATTAAGAAGAGTATTGGCTGGG + Intergenic
925598408 2:5583078-5583100 TATTAAAGTGAGGATTGTAAGGG - Intergenic
932515014 2:72337165-72337187 TATTAACAGGAGCATAGTATAGG - Intronic
935649749 2:105372129-105372151 TATTAACCAGAGAAATGTAGTGG + Intronic
940592026 2:155741709-155741731 TACTAACAAGTTTATTGTATAGG + Intergenic
941128357 2:161614850-161614872 TATTAATGTGAGAATTGTTTTGG + Intronic
942156611 2:173135259-173135281 TATTAATGGAAGTATTGAATAGG - Intronic
942433317 2:175940548-175940570 TATTCAGAAGAGTACTGTATAGG + Intronic
944597947 2:201279179-201279201 TATGAATCAGAGGATTGTATAGG - Intronic
948216094 2:236234013-236234035 TATTCAAGACAGTATGGTATTGG + Intronic
1172877325 20:38173060-38173082 TATTAACAAAAGTATTTTAGGGG - Intergenic
1173146853 20:40532319-40532341 TATTCACTAGAGTATCGTTTTGG - Intergenic
1175317858 20:58064218-58064240 TATTCAAGACAGTATGGTATTGG + Intergenic
1177005851 21:15671485-15671507 TAAAAATGAGAGTATTGTATTGG + Intergenic
1177990013 21:28026102-28026124 GATTAAGGAGAGAATTGTGTGGG - Intergenic
1179108949 21:38428589-38428611 TTTAAACCAGAGTAGTGTATGGG + Intronic
949345636 3:3073910-3073932 TAATCAAGACAGTATTGTATTGG + Intronic
951015136 3:17723104-17723126 TATTAACTATATTATTGTCTAGG + Intronic
959760311 3:109955292-109955314 TATTTACCAGAGTCTTGTAAAGG - Intergenic
960475613 3:118121602-118121624 TAATAAAGACAGTATGGTATTGG - Intergenic
964996609 3:162890311-162890333 TATTAAAGATAGCATAGTATTGG + Intergenic
970378992 4:15487257-15487279 TATTAATGGGAGACTTGTATTGG + Intronic
971892013 4:32536973-32536995 TATGAAAGAGAGTACTGTAAGGG - Intergenic
976873378 4:89823730-89823752 TATTCACATGACTATTGTATAGG + Intronic
977478700 4:97545627-97545649 CATTAACGAAAGTATTGAATAGG - Intronic
978962170 4:114693565-114693587 TATTAATGATAGTAATATATTGG - Intergenic
979055692 4:115990980-115991002 TTTTAACGTAAGTATTATATAGG - Intergenic
982633244 4:157859476-157859498 TAATAAAGATAGTATTTTATTGG + Intergenic
982643084 4:157986922-157986944 TATTAAAAAGAGTATAATATGGG - Intergenic
990618626 5:57534863-57534885 TATTCAAGATAGTATGGTATTGG - Intergenic
993570255 5:89528487-89528509 TAATAAAGATAGTATTATATTGG + Intergenic
995029976 5:107469329-107469351 TATTAAGGGGAATATTGTTTAGG - Intronic
995053384 5:107731756-107731778 TATTAAGGAAAATAGTGTATTGG + Intergenic
995579719 5:113583845-113583867 TTTTAACAAGAATATTTTATAGG + Intronic
995867062 5:116702423-116702445 TGTTAAAGAACGTATTGTATCGG - Intergenic
997912209 5:137887009-137887031 TATTAACCAAAGTATTATAAGGG + Intronic
998063895 5:139140873-139140895 TATTAAGCAGAGTATTGCCTAGG + Intronic
1001899526 5:175413854-175413876 TATTAATGAGGGTATTCAATTGG - Intergenic
1006549652 6:34811376-34811398 TATTAAAGACAGTGTGGTATTGG + Intronic
1009602880 6:65825631-65825653 TATTAAAGAAAGGATTTTATAGG + Intergenic
1012619817 6:101329197-101329219 TAATAAAGAGAGTGTGGTATTGG - Intergenic
1018315218 6:162549930-162549952 TATTAAAGAGATTATTGGCTGGG - Intronic
1021070854 7:16238140-16238162 TATTAAGGAAATAATTGTATTGG - Intronic
1022396784 7:29994678-29994700 TAATCAAGAGAGTATAGTATTGG - Intergenic
1023730594 7:43188198-43188220 CATTAACCAGAGTATTGTACAGG - Intronic
1026393173 7:69923357-69923379 TAATAAAGACAGTATAGTATAGG - Intronic
1031295744 7:120001067-120001089 TAATTAAGAGAGTATGGTATTGG - Intergenic
1031576384 7:123420073-123420095 TCTTAACCAAAATATTGTATTGG + Intergenic
1033854114 7:145535714-145535736 TAATAAAGACAGTATGGTATTGG + Intergenic
1039234785 8:35489738-35489760 TATTAAGGAGCCCATTGTATTGG + Intronic
1041550700 8:59097467-59097489 AATTAACGGCAGTATTTTATTGG - Intronic
1043195807 8:77289920-77289942 TTTCAATGAGAGTAATGTATAGG - Intergenic
1044849492 8:96414392-96414414 TGTTAACTAGAATATTGTCTTGG - Intergenic
1044896402 8:96897111-96897133 TTTTAAGGACAGTATTGAATAGG + Intronic
1048227985 8:132608737-132608759 TAGTAACCAGAATATTCTATAGG - Intronic
1053843948 9:42216788-42216810 TAATCAAGAGAGTGTTGTATTGG - Intergenic
1186074578 X:5864197-5864219 TATTAAAGAGAGTTTGATATTGG - Intronic
1187925030 X:24242141-24242163 TATTAACAAGAATATTTGATTGG + Intergenic
1190678751 X:52805813-52805835 TATTCAAGACAGTATGGTATTGG + Intergenic
1193460212 X:81782150-81782172 TTTTAACAAGATTATTTTATAGG + Intergenic
1196019000 X:110969712-110969734 TAATCAAGAGAGCATTGTATTGG - Intronic
1197149419 X:123203769-123203791 TATTAGAGACAGCATTGTATGGG + Intronic
1197373570 X:125654967-125654989 TTTTAACGAGAGAAGTGCATTGG + Intergenic
1198614268 X:138438213-138438235 TAGTAAAGATAGTATTGTAGTGG - Intergenic
1198712057 X:139515148-139515170 TAATCAAGAGAGTATAGTATTGG - Intergenic